FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 334:1549 June 6, 1996 Number 23 Next

	Since this article has no abstract, we have provided an extract of the first 100 words of the full text and any section headings.

	Full Text Purchase this article Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

To the Editor: A new group of Flaviviridae viruses — hepatitis GB virus C (HGBV-C)¹ and hepatitis G virus (HGV)² — has recently been described. Patients infected with these viruses have persistent viremia, and they may have chronic hepatitis.

We tested the serum of 61 patients on hemodialysis for HGBV-C, using a reverse-transcriptase–nested polymerase-chain-reaction (PCR) method with primers located in the NS3 region of the viral genome. The outer primers¹ were GB-C-a1 and GB-C-sl, and the inner primers were GBCSMAR (sense, 5'ATCCCCTTTTATGGGCATGG) and GBCAMAR (antisense, 5'GARCTGTCYTTiCCCCTRTAATA, in which R denotes A or G and Y denotes C or T). There . . . [Full Text of this Article]

References

This article has been cited by other articles:

• Pérez-Gracia, T., Galán, F., Girón-González, J. A., Lozano, A., Benavides, B., Fernández, E., Rodríguez-Iglesias, M. (2000). Detection of Hepatitis G Virus (HGV) RNA and Antibodies to the HGV Envelope Protein E2 in a Cohort of Hemodialysis Patients. J. Clin. Microbiol. 38: 4277-4279 [Abstract] [Full Text]  
• Campo, N., Brizzolara, R., Sinelli, N., Torre, F., Russo, R., Deferrari, G., Picciotto, A. (2000). TT virus infection in haemodialysis patients. Nephrol Dial Transplant 15: 1823-1826 [Abstract] [Full Text]  
• Petrik, J, Guella, L, Wight, D G D, Pearson, G M, Hinton, J, Parker, H, Allain, J-P, Alexander, G J M (1998). Hepatic histology in hepatitis C virus carriers coinfected with hepatitis G virus. Gut 42: 103-106 [Abstract] [Full Text]  
• Font, J., Tàssies, D., García-Carrasco, M., Ramos-Casals, M., Cervera, R., Reverter, J. C., Sánchez-Tapias, J. M., Mazzara, R., Ingelmo, M. (1998). Hepatitis G virus infection in primary Sjogren's syndrome: analysis in a series of 100 patients. Ann Rheum Dis 57: 42-44 [Abstract] [Full Text]  
• Sampietro, M., Badalamenti, S., Lunghi, G., Yoshiba, M., Inoue, K., Sekiyama, K., Tomas, J. F., Bartolome, J., Carreno, V., Masuko, K., Okamoto, H., Mayumi, M. (1996). Hepatitis GB Virus C. NEJM 335: 1392-1394 [Full Text]