Familial Hyperglycemia Due to Mutations in Glucokinase -- Definition of a Subtype of Diabetes Mellitus
Philippe Froguel, Habib Zouali, Nathalie Vionnet, Gilberto Velho, Martine Vaxillaire, Fang Sun, Suzanne Lesage, Markus Stoffel, Jun Takeda, Philippe Passa, M. Alan Permutt, Jacques S. Beckmann, Graeme I. Bell, and Daniel Cohen
Background and Methods Non-insulin-dependent diabetes mellitus(NIDDM) is a genetically heterogeneous disorder. Maturity-onsetdiabetes of the young, a form of NIDDM with an early age ofonset and autosomal dominant inheritance, can result from mutationsin glucokinase, a key enzyme of glucose metabolism in beta cellsand the liver. We studied 32 French families with maturity-onsetdiabetes of the young as well as 21 families with late-onsetNIDDM to determine the frequency and clinical features of mutationsof glucokinase. Fasting plasma glucose concentrations and oralglucose-tolerance tests were used to determine metabolic status.DNA was isolated from lymphocytes, and DNA polymorphisms inthe glucokinase gene were tested for linkage with diabetes.Individual exons of the glucokinase gene from one affected memberin each family were amplified by the polymerase chain reactionand screened for mutations by analysis of the conformation-dependentpolymorphisms of single-stranded DNA and by DNA sequencing.
Results We found substantial evidence of linkage between theglucokinase locus and maturity-onset diabetes of the young butnot between this locus and late-onset NIDDM. Sixteen mutationswere identified in 18 of the 32 families with maturity-onsetdiabetes of the young, but none were found in families withlate-onset NIDDM. They included 10 mutations that resulted inan amino acid substitution, 3 that resulted in the synthesisof a truncated protein, and 3 that affected RNA processing.The affected subjects with glucokinase mutations usually hadmild hyperglycemia that began during childhood, whereas in subjectswith maturity-onset diabetes of the young not due to glucokinasemutations, hyperglycemia usually appeared after puberty.
Conclusions Mutations in glucokinase are the primary cause ofhyperglycemia in a substantial fraction of French patients withmaturity-onset diabetes of the young and result in a relativelymild form of NIDDM that can be diagnosed in childhood.
Non-insulin-dependent diabetes mellitus (NIDDM) is a heterogeneousdisorder of glucose homeostasis characterized by defects inthe secretion and action of insulin. The familial aggregationof NIDDM and high concordance rate in identical twins indicatethe important contribution of heredity to its development1.Recent genetic studies of families with maturity-onset diabetesof the young, a form of NIDDM characterized by an age at onsetof less than 25 years and autosomal dominant inheritance, havelocalized diabetes-susceptibility genes to chromosomes 7 and202,3,4. Although the identity of the gene on chromosome 20is not known, mutations in the glucokinase gene on chromosome7 have been identified and shown to be the cause of diabetesin four French families5,6.
The glycolytic enzyme glucokinase is expressed only in liverand pancreatic beta cells and has a key role in the regulationof glucose homeostasis. In hepatocytes, the phosphorylationof glucose by glucokinase facilitates the uptake and metabolismof glucose by maintaining a gradient for glucose transport intothese cells. In pancreatic beta cells, glucokinase appears tomake up part of the glucose-sensing mechanism and to be involvedin the regulation of insulin secretion7,8,9.
The aim of this study was to determine the contribution of mutationsin the glucokinase gene to the development of NIDDM and thefrequency of mutations in the glucokinase gene in patients withmaturity-onset diabetes of the young as compared with that inpatients with late-onset NIDDM. Molecular genetic and clinicalstudies were performed in 53 French families in which familialtransmission of diabetes was strong, including 32 families withmaturity-onset diabetes of the young and 21 families with late-onsetNIDDM. We looked for linkage between polymorphisms in the glucokinasegene and NIDDM and screened the glucokinase gene for mutationsin one affected member from each family.
Methods
Families
Information on family history and clinical data were obtainedfrom 801 members of 53 white French families with NIDDM,10 inwhich at least two subjects in consecutive generations had beengiven a diagnosis of diabetes mellitus based on criteria fromthe World Health Organization11. These included 32 familieswith maturity-onset diabetes of the young, defined as NIDDMthat developed before the age of 25 years and was inheritedin an autosomal dominant fashion in at least two family members,12and 21 families with late-onset NIDDM, in which the transmissionof diabetes was consistent with an autosomal dominant mode ofinheritance. Fasting plasma glucose concentrations were measuredin all subjects. In addition, 65 percent of the affected membersof both groups who did not have overt diabetes underwent oralglucose-tolerance testing. For the purposes of the linkage analysis,220 of the 551 subjects with maturity-onset diabetes of theyoung and 115 of the 250 subjects with late-onset NIDDM wereconsidered to be affected. These included subjects with overtNIDDM and subjects with impaired glucose tolerance,11 as wellas subjects with mild fasting hyperglycemia, which was definedas a fasting plasma glucose concentration between 110 and 140mg per deciliter (between 6.1 and 7.8 mmol per liter) on twoseparate occasions and a plasma glucose concentration of lessthan 140 mg per deciliter two hours after the oral administrationof glucose during a glucose-tolerance test. A fasting plasmaglucose concentration of more than 110 mg per deciliter representsa value 2 SD above the mean normal value for the French population13.Clinical data were obtained for each subject during a standardizedclinical examination performed at the Endocrinology Serviceof Hopital Saint-Louis or by the subject's personal physician.
Molecular Studies
DNA was prepared from peripheral-blood lymphocytes14. The genotypesof the subjects were established with use of the polymerasechain reaction (PCR) to detect the two previously describedDNA polymorphisms in the glucokinase gene,3 as well as a thirdrecently identified five-allele DNA polymorphism (GCK3) locatedapproximately 4.3 kb upstream of exon 1a. GCK3 was detectedwith primers 5'GGTTATGTAGCATCAGGATG3' and 5'TCTCTCTGTCTCTGTGAGTC3';the PCR product was 280 base pairs (bp). The AluVpA/PstI haplotypesin the adenosine deaminase gene, a marker for the diabetes-susceptibilitygene on chromosome 20, were determined as described previously2,3.
Molecular scanning for mutations in the glucokinase gene wasdone by PCR amplification of genomic DNA followed by analysisof the conformation-dependent polymorphisms of single-strandedDNA or direct sequencing of the PCR product15,16. The amplifiedPCR products were sequenced with an Applied Biosystems DNA sequencer(model 373A, Foster City, Calif.) and a dideoxy-cycle-sequencingprotocol in the presence of the specific primers6 together withfluorescent-labeled dideoxy terminators or after cloning intothe HincII site of M13mp18 DNA17.
Specific amplification18 of normal and mutant alleles of themutation in exon 8 in which glutamine is substituted for glutamicacid at codon 300 was performed with primers hGK8b6 (5'CTGAGATCCGGCATGTCTTG3')and F51-8-E (5'AGGTGGCAAGTACATGGGCG3') for the normal alleleor with primer F51-8-Q (5'AGGTGGCAAGTACATGGGCC3') for the mutantallele. Exon 7 was amplified with exon 8 as an internal control.The PCR conditions consisted of denaturation at 94 °C for5 minutes, followed by 35 cycles of denaturation at 94 °Cfor 1 minute, annealing and extension at 65 °C for 2 minutes,and a final 10 minutes of extension at 65 °C. The PCR productswere separated by electrophoresis on 3 percent NuSieve agarosegel (FMC Bioproducts, Rockland, Me.).
Linkage Analyses
Linkage analyses were performed with the LINKAGE package ofcomputer programs19. In analyzing families with maturity-onsetdiabetes of the young, we assumed an autosomal dominant model3.In analyzing families with late-onset NIDDM, we tested two models.The first was an autosomal dominant model with equal penetrancefor susceptible heterozygotes and homozygotes, and the secondwas an intermediate model with different levels of penetrancefor susceptible heterozygotes and homozygotes. For both models,we assumed three classes of penetrance related to age and body-massindex (the weight in kilograms divided by the square of theheight in meters), a population prevalence for the disease geneof 1 percent, and a penetrance in the normal homozygotes of1 percent. The liability classes and levels of penetrance usedare summarized in Table 120.
Table 1. Models Used in Linkage Analyses in Families with Late-Onset NIDDM to Determine Penetrance, According to the Age at Onset and Body-Mass Index.
Statistical Analysis
The results are expressed as means ±SD. The statisticalsignificance of the differences between groups was assessedwith the Mann-Whitney U test (two-tailed) for nonparametricresults and contingency-table chi-square analysis.
Results
Linkage Analyses in Diabetic Families
The analysis of linkage between DNA polymorphisms in the glucokinasegene and diabetes in the 32 families with maturity-onset diabetesof the young indicated odds of more than 1023:1 in favor oflinkage (lod score, 23.9). However, analysis of the heterogeneityof linkage between maturity-onset diabetes of the young andthe glucokinase gene with the computer program HOMOG21 showedrelative odds in favor of genetic heterogeneity of 1.2 x 108(P<0.001) and indicated that the disorder was linked to theglucokinase gene in only about 60 percent of the families (range,35 to 80 percent). Because of the small size of most of thefamilies studied, the linkage results provided formal evidenceof linkage (i.e., a lod score exceeding 3.0, or odds in favorof linkage of more than 1000:1) between maturity-onset diabetesof the young and the glucokinase gene in only three families(F8, F51, and F393). The linkage studies also excluded glucokinaseas the cause of maturity-onset diabetes of the young in fourfamilies (F30, F159, F213, and F257); in other words, the lodscore was less than -2 or the odds against linkage exceeded100:1 in each of these families. The 32 families with maturity-onsetdiabetes of the young were also tested for linkage between diabetesand DNA polymorphisms in the adenosine deaminase gene, whichis a marker2 for the diabetes-susceptibility gene on chromosome20; no evidence of linkage was found in any family. Moreover,this analysis excluded the diabetes-susceptibility gene on chromosome20 as the probable cause of diabetes in three families (F159,F213, and F257). These linkage studies demonstrate that maturity-onsetdiabetes of the young is genetically heterogeneous and suggestthat mutations in the glucokinase gene may be the primary causeof NIDDM in about 60 percent of families with this form of diabetesmellitus.
Analysis of linkage between the glucokinase gene and diabetesin the 21 families with late-onset NIDDM gave an overall lodscore of -7.73 at a recombination fraction of 0.00, providingno evidence of linkage between the glucokinase locus and NIDDMin these families. No family had a positive lod score. Theseresults were insensitive to changes in the genetic models.
Identification of Mutations in the Glucokinase Gene
Each of the 12 exons of the glucokinase gene6 in one diabeticmember from each of the 32 families with maturity-onset diabetesof the young and from each of the 21 families with late-onsetNIDDM was amplified by PCR and screened for mutations by analysisof the conformation-dependent polymorphisms of single-strandedDNA16. Whenever an abnormal pattern of polymorphisms was noted,that exon was sequenced to identify the DNA substitution responsiblefor the abnormal pattern, and the segregation of the mutationwith diabetes was studied in other family members. The mutationsidentified in the glucokinase gene associated with NIDDM areshown in Table 2. They include missense mutations that resultin the synthesis of a glucokinase molecule with a differentamino acid sequence, nonsense mutations that result in the expressionof a truncated molecule, and splicing mutations that alter theprocessing of glucokinase messenger RNA. In addition to thesemutations, DNA substitutions that did not cosegregate with NIDDMand that therefore represent polymorphisms or rare variantswere also found. The mutations listed in Table 2 were presentin all affected members of the family and were not found inany unaffected members or in at least 40 unrelated normal subjects,implying that they were the cause of the diabetes. By contrast,the polymorphisms and variants listed in Table 2 occurred inboth affected and unaffected subjects.
Table 2. Characterization of the Mutations and Polymorphisms in the Glucokinase Gene in Families with Maturity-Onset Diabetes of the Young.
Mutations in the glucokinase gene were detected in 18 of the32 families (56 percent) with maturity-onset diabetes of theyoung. In the 14 families in which we did not find a mutation,the lod scores were negative, suggesting that NIDDM in thesefamilies was not due to unidentified mutations in the glucokinasegene. By contrast, studies of the glucokinase gene in the 21families with late-onset NIDDM showed an abnormality in only1 (F15). This was a substitution of thymidine for cytosine (Cto T) 12 bp upstream from the intron 1c splice acceptor siteand was present in only two of the five affected subjects. Thisnucleotide substitution was also found in 1 of 121 unrelatedsubjects with late-onset NIDDM, but in none of 55 unrelatednormal subjects.
Mutations in Glucokinase Causing Diabetes Mellitus
The presence of mutations in the glucokinase gene in patientswith maturity-onset diabetes of the young suggested that themutations were the direct cause of this disorder. We addressedthis issue in Family F51 by testing all available subjects forthe presence of the Glu300-to-Gln mutation, using allele-specificamplification18 (Figure 1 and Figure 2). This mutation was presentin each of the 41 subjects with hyperglycemia and in none oftheir normal relatives. The lod score for linkage between theGlu300-to-Gln mutation and NIDDM was 14.1 (i.e., odds in favorof linkage of more than 1014:1) at a recombination fractionof 0.00, indicating that this mutation was the cause of glucoseintolerance in this family. We tested 23 members of Family F51who were younger than 10 years of age, 5 of whom had mild fastinghyperglycemia and the Glu300-to-Gln mutation.
Figure 1. Allele-Specific Amplification of the Glu-to-Gln Mutation at Codon 300 in 13 Members of the Third Generation of Family F51.
The subjects are identified by numbers corresponding to the numbers in the pedigree shown in Figure 2. The normal and mutant alleles at Glu300 were amplified with exon 7, which served as a PCR control, as described in the Methods section. The presence of a PCR product of 202 bp after amplification with PCR primers specific for the normal (N) or the mutant (M) allele denotes the presence of the corresponding allele.
Figure 2. Cosegregation of the Glu-to-Gln Mutation at Codon 300 in the Glucokinase Gene with the Gene for Maturity-Onset Diabetes of the Young (MODY) in Family F51.
The genotypes for the subjects tested for the presence of this mutation by allele-specific amplification are shown. N denotes normal allele, and M mutant allele. Squares denote male family members, circles female family members, and symbols with a slash deceased family members.
Clinical Features of Families with Mutations in Glucokinase
We compared the clinical features of subjects with maturity-onsetdiabetes of the young due to mutations in glucokinase with thoseof subjects with maturity-onset diabetes of the young due toother causes (Table 3). There were no differences between thetwo groups in fasting plasma glucose and insulin concentrations.However, the group with glucokinase mutations were younger atthe time of diagnosis and had a milder form of diabetes, inthat they had a lower frequency of overt NIDDM.
Table 3. Clinical Characteristics of Patients with Maturity-Onset Diabetes of the Young and Patients with Late-Onset NIDDM.
With respect to age at the time of the diagnosis of hyperglycemia,we identified at least one affected subject who was 12 yearsof age or younger in 17 of the 18 families with mutations inthe glucokinase gene. Moreover, 11 subjects were given a diagnosisbefore the age of 6 years, and 1 was given a diagnosis at 16months. This boy had a fasting plasma glucose concentrationof 92 mg per deciliter (5.1 mmol per liter) at 3 months of ageand of 120 mg per deciliter (6.7 mmol per liter) at 16 months;the normal values at this age range from 48 to 80 mg per deciliter(2.7 to 4.4 mmol per liter).
Discussion
We identified mutations in the glucokinase gene in 18 of the32 families with maturity-onset diabetes of the young (56 percent).In contrast, no such mutations were found in 21 families withlate-onset NIDDM, implying that mutations in glucokinase arenot a major cause of this form of NIDDM. However, we cannotexclude the possibility that glucokinase mutations may contributeto the development of NIDDM in other ethnic or racial groupswith late-onset NIDDM. In this regard, associations betweenspecific glucokinase microsatellite alleles and NIDDM have beenreported in American blacks22 and Mauritian Creoles23.
The molecular mechanism whereby mutations in glucokinase causea dominantly inherited form of hyperglycemia is not known. Theresults suggest that a gene-dosage mechanism may be the mostlikely cause of the hyperglycemia, since all RNA splicing mutationsas well as nonsense and missense mutations were associated withdiabetes, and each would be expected to decrease cellular levelsof glucokinase. Since the amount of glucokinase in beta cellsis believed to determine the threshold for glucose-stimulatedinsulin secretion, any decrease in the intracellular contentor activity of glucokinase would be predicted to increase thisthreshold. In Families F51, F85, F386, and F423 (Table 2), theplasma glucose concentrations required to cause insulin secretionwere increased,24 a finding consistent with this hypothesis.The mutations in glucokinase were also highly penetrant, andall the subjects with glucokinase mutations that we have studiedhad a metabolic defect, whether mild fasting hyperglycemia,impaired glucose tolerance, or NIDDM.
Sixteen different mutations were identified in 18 families withmaturity-onset diabetes of the young. Thus, rather than oneor two mutations being responsible for the diabetes in thisrelatively homogeneous group of white subjects of French ancestry,there are many. A similar spectrum of mutations will probablybe found in other ethnic and racial groups, especially sinceabout 50 percent of the mutations shown in Table 2 occur inthe context of a cytosine-phosphate-guanosine dinucleotide,which represents a hot spot for mutations25.
Our results indicate that 56 percent of the French familieswith maturity-onset diabetes of the young carry a mutation inthe glucokinase gene. In the remaining 44 percent of the families,linkage analysis with highly polymorphic DNA markers as wellas direct screening of the glucokinase gene for mutations suggestedthat mutations in the glucokinase gene are not the cause ofhyperglycemia. Although we could have missed a mutation in theglucokinase gene, we believe it to be unlikely. In fact, 2 ofthe 14 families in which we were unable to identify a mutationin the glucokinase gene had positive but nonsignificant lodscores for linkage with adenosine deaminase, a marker for agene for maturity-onset diabetes of the young on chromosome20, suggesting that the NIDDM in these families was due to mutationsin the unidentified diabetes gene on this chromosome. The absenceof linkage with the glucokinase or adenosine deaminase genein the remaining 12 families indicates that there is at leastone more gene whose mutation may cause maturity-onset diabetesof the young.
Mutations in glucokinase result in a form of NIDDM that hasan early age of onset, often childhood. Although the age atdiagnosis may be the most easily recognizable variable thatdifferentiates patients with glucokinase mutations from thosewho do not have such mutations, it suffers from a lack of discriminatingability because of ascertainment bias. Indeed, screening fordiabetes in our families with maturity-onset diabetes of theyoung led to a decrease in the mean (±SD) age at diagnosisin consecutive generations: from 41 ±15 years in thegeneration born after 1930 to 22 ±9 years in those bornafter 1950 and 11 ±5 years in those born after 1970.We measured fasting plasma glucose concentrations in all availablesubjects over the age of five years (and in several childrenwho were younger). Thus, we believe that the minimal age atdiagnosis of hyperglycemia shown in Table 3 is a reflectionof the real age at onset and that there is a difference betweenthe subjects with and those without glucokinase mutations.
By contrast, in families with maturity-onset diabetes of theyoung without glucokinase mutations, the onset of disease occurredafter puberty, a period associated with decreased sensitivityto insulin26. However, the disease began in childhood in twoaffected subjects in families with maturity-onset diabetes ofthe young without glucokinase mutations. One was from a familyin which the diabetes may be due to a mutation in the gene formaturity-onset diabetes of the young on chromosome 20. The secondsubject had a mother with maturity-onset diabetes of the youngand a father with late-onset NIDDM. It has been suggested thatabnormalities in glucose metabolism occur at an earlier agein persons with two diabetic parents27.
The NIDDM due to mutations in glucokinase appears to be relativelymild, as indicated by the number of affected subjects who didnot have overt diabetes and by the fact that the disease wastreated by diet alone in most subjects. Since most were lean,having a normal body weight may be sufficient to maintain fastingplasma glucose concentrations around 125 mg per deciliter (6.9mmol per liter).
NIDDM is a heterogeneous disorder, and several genetic mechanismshave been implicated in its cause. These include mutations inthe insulin28 and insulinreceptor genes,29 the mitochondria,30and a gene linked to adenosine deaminase on chromosome 20,2as well as in the glucokinase gene. Although further studiesare required to determine their actual prevalence, mutationsin the glucokinase gene have been identified in 18 of the 300diabetes-prone French families (6 percent) for whom we havedata. Thus, mutations in this gene are the most common causeof NIDDM identified to date.
Continuing genetic studies of families with maturity-onset diabetesof the young should provide a better understanding of the causesof NIDDM as well as a foundation for addressing the geneticfactors that contribute to the more common late-onset formsof this disease.
Supported by the Association Francaise contre les Myopathiesthrough the Genethon program, the Assistance Publique-Hopitauxde Paris, Boehringer-Mannheim, the French Ministry for Researchand Technology, the Deutsche Forschungsgemeinschaft, the HowardHughes Medical Institute, and the National Institutes of Health(grants DK-20595, DK-44840, and DK-16746).
We are indebted to Drs. H. Lestradet and J.J. Robert for referringtheir patients, to the Caisse Nationale de Prevoyance-Assurancesand the Regie Autonome des Transports Parisiens for help inidentifying families, and to Ms. F. Lethrosne, Ms. F. Dufour,Ms. C. Roudaut, Ms. M.O. Butel, and Mr. J.M. Sebaoun for theirtechnical assistance.
Source Information
From the Centre d'Etude du Polymorphisme Humain, Paris (P.F., H.Z., G.V., M.V., F.S., S.L., J.S.B., D.C.); Service d'Endocrinologie, Hopital Saint-Louis, Paris (P.F., P.P.); the Metabolism Division, Washington University School of Medicine, St. Louis (M.A.P.); and the Howard Hughes Medical Institute and Departments of Biochemistry and Molecular Biology and Medicine, University of Chicago, Chicago (N.V., M.S., J.T., G.I.B.).
Address reprint requests to Dr. Froguel at the Centre d'Etude du Polymorphisme Humain, 27 rue Juliette Dodu, 75010 Paris, France.
Bell GI, Xiang KS, Newman MV, et al. Gene for non-insulin-dependent diabetes mellitus (maturity-onset diabetes of the young subtype) is linked to DNA polymorphism on human chromosome 20q. Proc Natl Acad Sci U S A 1991;88:1484-1488. [Free Full Text]
Froguel P, Vaxillaire M, Sun F, et al. Close linkage of glucokinase locus on chromosome 7p to early-onset non-insulin-dependent diabetes mellitus. Nature 1992;356:162-164. [CrossRef][Medline]
Hattersley AT, Turner RC, Permutt MA, et al. Linkage of type 2 diabetes to the glucokinase gene. Lancet 1992;339:1307-1310. [CrossRef][Medline]
Vionnet N, Stoffel M, Takeda J, et al. Nonsense mutation in the glucokinase gene causes early-onset non-insulin-dependent diabetes mellitus. Nature 1992;356:721-722. [CrossRef][Medline]
Stoffel M, Froguel P, Takeda J, et al. Human glucokinase gene: isolation, characterization, and identification of two missense mutations linked to early-onset non-insulin-dependent (type 2) diabetes mellitus. Proc Natl Acad Sci U S A 1992;89:7698-7702. [Free Full Text]
Meglasson MD, Matschinsky FM. New perspectives on pancreatic islet glucokinase. Am J Physiol 1984;246:E1-E13. [Free Full Text]
Matschinsky FM. Glucokinase as glucose sensor and metabolic signal generator in pancreatic beta-cells and hepatocytes. Diabetes 1990;39:647-652. [Abstract]
Froguel P, Velho G, Cohen D, Passa P. Strategies for the collection of sibling-pair data for genetic studies in type 2 (non-insulin-dependent) diabetes mellitus. Diabetologia 1991;34:685-685. [Medline]
WHO Expert Committee on Diabetes Mellitus: second report. WHO Tech Rep Ser 1980;646:1-80.
Fajans SS. Scope and heterogeneous nature of MODY. Diabetes Care 1990;13:49-64. [Erratum, Diabetes Care 1990;13:910.] [Abstract]
Tchobroutsky G. Blood glucose levels in diabetic and non-diabetic subjects. Diabetologia 1991;34:67-73. [CrossRef][Medline]
Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Plainview, N.Y.: Cold Spring Harbor Laboratory Press, 1989.
Saiki RK, Gelfand DH, Stoffel S, et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 1988;239:487-491. [Free Full Text]
Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 1989;5:874-879. [CrossRef][Medline]
Sanger F, Coulson AR, Barrell BG, Smith AJH, Roe BA. Cloning in single-stranded bacteriophage as an aid to rapid DNA sequencing. J Mol Biol 1980;143:161-178. [CrossRef][Medline]
Newton CR, Graham A, Heptinstall LE, et al. Analysis of any point mutation in DNA: the amplification refractory mutation system (ARMS). Nucleic Acids Res 1989;17:2503-2516. [Free Full Text]
Lathrop GM, Lalouel JM. Easy calculations of lod scores and genetic risks on small computers. Am J Hum Genet 1984;36:460-465. [Medline]
Kobberling J, Tillil H. Empirical risk figures for first degree relatives of non-insulin dependent diabetics. In: Kobberling J, Tattersall R, eds. The genetics of diabetes mellitus. Vol. 47 of Proceedings of the Serono Symposia. London: Academic Press, 1982:201-9.
Ott J. Analysis of human genetic linkage. Rev. ed. Baltimore: Johns Hopkins University Press, 1991.
Chiu KC, Province MA, Permutt MA. Glucokinase gene is genetic marker for NIDDM in American blacks. Diabetes 1992;41:843-849. [Abstract]
Chiu KC, Province MA, Dowse GK, et al. A genetic marker at the glucokinase gene locus for type 2 (non-insulin-dependent) diabetes mellitus in Mauritian Creoles. Diabetologia 1992;35:632-638. [CrossRef][Medline]
Velho G, Froguel P, Clement K, et al. Primary pancreatic beta-cell secretory defect caused by mutations in glucokinase gene in kindreds of maturity onset diabetes of the young. Lancet 1992;340:444-448. [CrossRef][Medline]
Cooper DN, Krawczak M. The mutational spectrum of single base-pair substitutions causing human genetic disease: patterns and predictions. Hum Genet 1990;85:55-74. [Medline]
Lestradet H, Deschamps I, Tichet J, Lestradet MO. Hyperglycemie chronique non insulinoprive de l'enfant. Arch Fr Pediatr 1989;46:19-23. [Medline]
O'Rahilly S, Wainscoat JS, Turner RC. Type 2 (non-insulin-dependent) diabetes mellitus: new genetics for old nightmares. Diabetologia 1988;31:407-414. [CrossRef][Medline]
Steiner DF, Tager HS, Chan SJ, Nanjo K, Sanke T, Rubenstein AH. Lessons learned from molecular biology of insulin-gene mutations. Diabetes Care 1990;13:600-609. [Abstract]
Taylor SI, Cama A, Accili D, et al. Genetic basis of endocrine disease. 1. Molecular genetics of insulin resistant diabetes mellitus. J Clin Endocrinol Metab 1991;73:1158-1163. [Free Full Text]
Ballinger SW, Shoffner JM, Hedaya EV, et al. Maternally transmitted diabetes and deafness associated with a 10.4 kb mitochondrial DNA deletion. Nat Genet 1992;1:11-15. [CrossRef][Medline]
Ueda, T., Furusawa, T., Kurahashi, T., Tessarollo, L., Bustin, M.
(2009). The Nucleosome Binding Protein HMGN3 Modulates the Transcription Profile of Pancreatic {beta} Cells and Affects Insulin Secretion. Mol. Cell. Biol.
29: 5264-5276
[Abstract][Full Text]
Borowiec, M., Liew, C. W., Thompson, R., Boonyasrisawat, W., Hu, J., Mlynarski, W. M., El Khattabi, I., Kim, S.-H., Marselli, L., Rich, S. S., Krolewski, A. S., Bonner-Weir, S., Sharma, A., Sale, M., Mychaleckyj, J. C., Kulkarni, R. N., Doria, A.
(2009). Mutations at the BLK locus linked to maturity onset diabetes of the young and {beta}-cell dysfunction. Proc. Natl. Acad. Sci. USA
106: 14460-14465
[Abstract][Full Text]
Radha, V., Ek, J., Anuradha, S., Hansen, T., Pedersen, O., Mohan, V.
(2009). Identification of Novel Variants in the Hepatocyte Nuclear Factor-1{alpha} Gene in South Indian Patients with Maturity Onset Diabetes of Young. J. Clin. Endocrinol. Metab.
94: 1959-1965
[Abstract][Full Text]
Huber, A., Menconi, F., Corathers, S., Jacobson, E. M., Tomer, Y.
(2008). Joint Genetic Susceptibility to Type 1 Diabetes and Autoimmune Thyroiditis: from Epidemiology to Mechanisms. Endocr. Rev.
29: 697-725
[Abstract][Full Text]
Vaxillaire, M., Froguel, P.
(2008). Monogenic Diabetes in the Young, Pharmacogenetics and Relevance to Multifactorial Forms of Type 2 Diabetes. Endocr. Rev.
29: 254-264
[Abstract][Full Text]
Molven, A., Ringdal, M., Nordbo, A. M., Raeder, H., Stoy, J., Lipkind, G. M., Steiner, D. F., Philipson, L. H., Bergmann, I., Aarskog, D., Undlien, D. E., Joner, G., Sovik, O., the Norwegian Childhood Diabetes Study Group, , Bell, G. I., Njolstad, P. R.
(2008). Mutations in the Insulin Gene Can Cause MODY and Autoantibody-Negative Type 1 Diabetes. Diabetes
57: 1131-1135
[Abstract][Full Text]
Watanabe, R. M., Black, M. H., Xiang, A. H., Allayee, H., Lawrence, J. M., Buchanan, T. A.
(2007). Genetics of Gestational Diabetes Mellitus and Type 2 Diabetes. Diabetes Care
30: S134-S140
[Full Text]
Pino, M. F., Kim, K.-A., Shelton, K. D., Lindner, J., Odili, S., Li, C., Collins, H. W., Shiota, M., Matschinsky, F. M., Magnuson, M. A.
(2007). Glucokinase Thermolability and Hepatic Regulatory Protein Binding Are Essential Factors for Predicting the Blood Glucose Phenotype of Missense Mutations. J. Biol. Chem.
282: 13906-13916
[Abstract][Full Text]
Zhang, J., Li, C., Chen, K., Zhu, W., Shen, X., Jiang, H.
(2006). Conformational transition pathway in the allosteric process of human glucokinase. Proc. Natl. Acad. Sci. USA
103: 13368-13373
[Abstract][Full Text]
Welters, H. J, Senkel, S., Klein-Hitpass, L., Erdmann, S., Thomas, H., Harries, L. W, Pearson, E. R, Bingham, C., Hattersley, A. T, Ryffel, G. U, Morgan, N. G
(2006). Conditional expression of hepatocyte nuclear factor-1{beta}, the maturity-onset diabetes of the young-5 gene product, influences the viability and functional competence of pancreatic {beta}-cells.. J Endocrinol
190: 171-181
[Abstract][Full Text]
Sagen, J. V., Odili, S., Bjorkhaug, L., Zelent, D., Buettger, C., Kwagh, J., Stanley, C., Dahl-Jorgensen, K., de Beaufort, C., Bell, G. I., Han, Y., Grimsby, J., Taub, R., Molven, A., Sovik, O., Njolstad, P. R., Matschinsky, F. M.
(2006). From Clinicogenetic Studies of Maturity-Onset Diabetes of the Young to Unraveling Complex Mechanisms of Glucokinase Regulation. Diabetes
55: 1713-1722
[Abstract][Full Text]
Hattersley, A. T., Pearson, E. R.
(2006). Minireview: Pharmacogenetics and Beyond: The Interaction of Therapeutic Response, {beta}-Cell Physiology, and Genetics in Diabetes. Endocrinology
147: 2657-2663
[Abstract][Full Text]
Anuradha, S., Radha, V., Deepa, R., Hansen, T., Carstensen, B., Pedersen, O., Mohan, V.
(2005). A Prevalent Amino Acid Polymorphism at Codon 98 (Ala98Val) of the Hepatocyte Nuclear Factor-1{alpha} Is Associated With Maturity-Onset Diabetes of the Young and Younger Age at Onset of Type 2 Diabetes in Asian Indians. Diabetes Care
28: 2430-2435
[Abstract][Full Text]
Rose, C. S., Ek, J., Urhammer, S. A., Glumer, C., Borch-Johnsen, K., Jorgensen, T., Pedersen, O., Hansen, T.
(2005). A -30G>A Polymorphism of the {beta}-Cell-Specific Glucokinase Promoter Associates With Hyperglycemia in the General Population of Whites. Diabetes
54: 3026-3031
[Abstract][Full Text]
Printz, R. L., Granner, D. K.
(2005). Tweaking the Glucose Sensor: Adjusting Glucokinase Activity with Activator Compounds. Endocrinology
146: 3693-3695
[Full Text]
Efanov, A. M., Barrett, D. G., Brenner, M. B., Briggs, S. L., Delaunois, A., Durbin, J. D., Giese, U., Guo, H., Radloff, M., Gil, G. S., Sewing, S., Wang, Y., Weichert, A., Zaliani, A., Gromada, J.
(2005). A Novel Glucokinase Activator Modulates Pancreatic Islet and Hepatocyte Function. Endocrinology
146: 3696-3701
[Abstract][Full Text]
Johansen, A., Ek, J., Mortensen, H. B., Pedersen, O., Hansen, T.
(2005). Half of Clinically Defined Maturity-Onset Diabetes of the Young Patients in Denmark Do Not Have Mutations in HNF4A, GCK, and TCF1. J. Clin. Endocrinol. Metab.
90: 4607-4614
[Abstract][Full Text]
Habener, J. F., Kemp, D. M., Thomas, M. K.
(2005). Minireview: Transcriptional Regulation in Pancreatic Development. Endocrinology
146: 1025-1034
[Abstract][Full Text]
Mauvais-Jarvis, F., Smith, S. B., May, C. L., Leal, S. M., Gautier, J.-F., Molokhia, M., Riveline, J.-P., Rajan, A. S., Kevorkian, J.-P., Zhang, S., Vexiau, P., German, M. S., Vaisse, C.
(2004). PAX4 gene variations predispose to ketosis-prone diabetes. Hum Mol Genet
13: 3151-3159
[Abstract][Full Text]
Inoue, Y., Inoue, J., Lambert, G., Yim, S. H., Gonzalez, F. J.
(2004). Disruption of Hepatic C/EBP{alpha} Results in Impaired Glucose Tolerance and Age-dependent Hepatosteatosis. J. Biol. Chem.
279: 44740-44748
[Abstract][Full Text]
Bouche, C., Serdy, S., Kahn, C. R., Goldfine, A. B.
(2004). The Cellular Fate of Glucose and Its Relevance in Type 2 Diabetes. Endocr. Rev.
25: 807-830
[Abstract][Full Text]
Cuesta-Munoz, A. L., Huopio, H., Otonkoski, T., Gomez-Zumaquero, J. M., Nanto-Salonen, K., Rahier, J., Lopez-Enriquez, S., Garcia-Gimeno, M. A., Sanz, P., Soriguer, F. C., Laakso, M.
(2004). Severe Persistent Hyperinsulinemic Hypoglycemia due to a De Novo Glucokinase Mutation. Diabetes
53: 2164-2168
[Abstract][Full Text]
Wang, L., Coffinier, C., Thomas, M. K., Gresh, L., Eddu, G., Manor, T., Levitsky, L. L., Yaniv, M., Rhoads, D. B.
(2004). Selective Deletion of the Hnf1{beta} (MODY5) Gene in {beta}-Cells Leads to Altered Gene Expression and Defective Insulin Release. Endocrinology
145: 3941-3949
[Abstract][Full Text]
Inoue, M., Sakuraba, Y., Motegi, H., Kubota, N., Toki, H., Matsui, J., Toyoda, Y., Miwa, I., Terauchi, Y., Kadowaki, T., Shigeyama, Y., Kasuga, M., Adachi, T., Fujimoto, N., Matsumoto, R., Tsuchihashi, K., Kagami, T., Inoue, A., Kaneda, H., Ishijima, J., Masuya, H., Suzuki, T., Wakana, S., Gondo, Y., Minowa, O., Shiroishi, T., Noda, T.
(2004). A series of maturity onset diabetes of the young, type 2 (MODY2) mouse models generated by a large-scale ENU mutagenesis program. Hum Mol Genet
13: 1147-1157
[Abstract][Full Text]
Thackaberry, E. A., Bedrick, E. J., Goens, M. B., Danielson, L., Lund, A. K., Gabaldon, D., Smith, S. M., Walker, M. K.
(2003). Insulin Regulation in AhR-null Mice: Embryonic Cardiac Enlargement, Neonatal Macrosomia, and Altered Insulin Regulation and Response in Pregnant and Aging AhR-null Females. Toxicol Sci
76: 407-417
[Abstract][Full Text]
Tripathy, D., Lindholm, E., Isomaa, B., Saloranta, C., Tuomi, T., Groop, L.
(2003). Familiality of metabolic abnormalities is dependent on age at onset and phenotype of the type 2 diabetic proband. Am. J. Physiol. Endocrinol. Metab.
285: E1297-E1303
[Abstract][Full Text]
Njolstad, P. R., Sagen, J. V., Bjorkhaug, L., Odili, S., Shehadeh, N., Bakry, D., Sarici, S. U., Alpay, F., Molnes, J., Molven, A., Sovik, O., Matschinsky, F. M.
(2003). Permanent Neonatal Diabetes Caused by Glucokinase Deficiency: Inborn Error of the Glucose-Insulin Signaling Pathway. Diabetes
52: 2854-2860
[Abstract][Full Text]
Tomer, Y., Davies, T. F.
(2003). Searching for the Autoimmune Thyroid Disease Susceptibility Genes: From Gene Mapping to Gene Function. Endocr. Rev.
24: 694-717
[Abstract][Full Text]
Al-Hasani, H., Tschop, M. H., Cushman, S. W.
(2003). Two Birds with One Stone: Novel Glucokinase Activator Stimulates Glucose-Induced Pancreatic Insulin Secretion and Augments Hepatic Glucose Metabolism. Mol. Interv.
3: 367-370
[Abstract][Full Text]
Martin, L. J., Comuzzie, A. G., Dupont, S., Vionnet, N., Dina, C., Gallina, S., Houari, M., Blangero, J., Froguel, P.
(2002). A Quantitative Trait Locus Influencing Type 2 Diabetes Susceptibility Maps to a Region on 5q in an Extended French Family. Diabetes
51: 3568-3572
[Abstract][Full Text]
Wang, H., Hagenfeldt-Johansson, K., Otten, L. A., Gauthier, B. R., Herrera, P. L., Wollheim, C. B.
(2002). Experimental Models of Transcription Factor-Associated Maturity-Onset Diabetes of the Young. Diabetes
51: S333-342
[Abstract][Full Text]
Matschinsky, F. M.
(2002). Regulation of Pancreatic {beta}-Cell Glucokinase: From Basics to Therapeutics. Diabetes
51: S394-404
[Abstract][Full Text]
McCarthy, M. I., Froguel, P.
(2002). Genetic approaches to the molecular understanding of type 2 diabetes. Am. J. Physiol. Endocrinol. Metab.
283: E217-E225
[Abstract][Full Text]
Barrio, R., Bellanne-Chantelot, C., Moreno, J. C., Morel, V., Calle, H., Alonso, M., Mustieles, C.
(2002). Nine Novel Mutations in Maturity-Onset Diabetes of the Young (MODY) Candidate Genes in 22 Spanish Families. J. Clin. Endocrinol. Metab.
87: 2532-2539
[Abstract][Full Text]
Elbein, S. C.
(2002). Perspective: The Search for Genes for Type 2 Diabetes in the Post-Genome Era. Endocrinology
143: 2012-2018
[Abstract][Full Text]
Cha, J.-y., Kim, H.-s., Kim, H.-i., Im, S.-s., Kim, S.-y., Kim, J.-w., Yeh, B.-i., Ahn, Y.-h.
(2002). Analysis of Polymorphism of the GLUT2 Promoter in NIDDM Patients and its Functional Consequence to the Promoter Activity. Annals of Clinical & Laboratory Science
32: 114-122
[Abstract][Full Text]
Christesen, H. B.T., Jacobsen, B. B., Odili, S., Buettger, C., Cuesta-Munoz, A., Hansen, T., Brusgaard, K., Massa, O., Magnuson, M. A., Shiota, C., Matschinsky, F. M., Barbetti, F.
(2002). The Second Activating Glucokinase Mutation (A456V): Implications for Glucose Homeostasis and Diabetes Therapy. Diabetes
51: 1240-1246
[Abstract][Full Text]
Vague, P., Nguyen, L.
(2002). Rationale and Methods for the Estimation of Insulin Secretion in a Given Patient: From Research to Clinical Practice. Diabetes
51: S240-244
[Abstract][Full Text]
Frayling, T. M, Hattersley, A. T
(2001). The role of genetic susceptibility in the association of low birth weight with type 2 diabetes. Br Med Bull
60: 89-101
[Abstract][Full Text]
Fajans, S. S., Bell, G. I., Polonsky, K. S.
(2001). Molecular Mechanisms and Clinical Pathophysiology of Maturity-Onset Diabetes of the Young. NEJM
345: 971-980
[Full Text]
Gautier, J.-F., Wilson, C., Weyer, C., Mott, D., Knowler, W. C., Cavaghan, M., Polonsky, K. S., Bogardus, C., Pratley, R. E.
(2001). Low Acute Insulin Secretory Responses in Adult Offspring of People With Early Onset Type 2 Diabetes. Diabetes
50: 1828-1833
[Abstract][Full Text]
Njolstad, P. R., Sovik, O., Cuesta-Munoz, A., Bjorkhaug, L., Massa, O., Barbetti, F., Undlien, D. E., Shiota, C., Magnuson, M. A., Molven, A., Matschinsky, F. M., Bell, G. I.
(2001). Neonatal Diabetes Mellitus Due to Complete Glucokinase Deficiency. NEJM
344: 1588-1592
[Full Text]
Ng, M. C.Y., Lee, S.-C., Ko, G. T.C., Li, J. K.Y., So, W.-Y., Hashim, Y., Barnett, A. H., Mackay, I. R., Critchley, J. A.J.H., Cockram, C. S., Chan, J. C.N.
(2001). Familial Early-Onset Type 2 Diabetes in Chinese Patients: Obesity and genetics have more significant roles than autoimmunity. Diabetes Care
24: 663-671
[Abstract][Full Text]
Elbein, S. C., Sun, J., Scroggin, E., Teng, K., Hasstedt, S. J.
(2001). Role of Common Sequence Variants in Insulin Secretion in Familial Type 2 Diabetic Kindreds: The sulfonylurea receptor, glucokinase, and hepatocyte nuclear factor 1{alpha} genes. Diabetes Care
24: 472-478
[Abstract][Full Text]
Shiota, M., Postic, C., Fujimoto, Y., Jetton, T. L., Dixon, K., Pan, D., Grimsby, J., Grippo, J. F., Magnuson, M. A., Cherrington, A. D.
(2001). Glucokinase Gene Locus Transgenic Mice Are Resistant to the Development of Obesity-Induced Type 2 Diabetes. Diabetes
50: 622-629
[Abstract][Full Text]
Aguilar-Salinas, C. A., Reyes-RodrÍguez, E., Ordóñez-Sánchez, Ma. L., Torres, M. A., Ramírez-Jiménez, S., Domínguez-López, A., MartÍnez-Francois, J. R., Velasco-Pérez, Ma. L., Alpizar, M., GarcÍa-GarcÍa, E., Gómez-Pérez, F., Rull, J., Tusié-Luna, Ma. T.
(2001). Early-Onset Type 2 Diabetes: Metabolic and Genetic Characterization in the Mexican Population. J. Clin. Endocrinol. Metab.
86: 220-226
[Abstract][Full Text]
Garcia-Barrado, M.-J., Ravier, M. A., Rolland, J.-F., Gilon, P., Nenquin, M., Henquin, J.-C.
(2001). Inhibition of Protein Synthesis Sequentially Impairs Distinct Steps of Stimulus-secretion Coupling in Pancreatic {beta} Cells. Endocrinology
142: 299-307
[Abstract][Full Text]
Sakagashira, S., Hiddinga, H. J., Tateishi, K., Sanke, T., Hanabusa, T., Nanjo, K., Eberhardt, N. L.
(2000). S20G Mutant Amylin Exhibits Increased in Vitro Amyloidogenicity and Increased Intracellular Cytotoxicity Compared to Wild-Type Amylin. Am. J. Pathol.
157: 2101-2109
[Abstract][Full Text]
Walston, J., Silver, K., Hilfiker, H., Andersen, R. E., Seibert, M., Beamer, B., Roth, J., Poehlman, E., Shuldiner, A. R.
(2000). Insulin Response to Glucose Is Lower in Individuals Homozygous for the Arg 64 Variant of the {beta}-3-Adrenergic Receptor. J. Clin. Endocrinol. Metab.
85: 4019-4022
[Abstract][Full Text]
Emilien, G., Ponchon, M., Caldas, C., Isacson, O., Maloteaux, J.-M.
(2000). Impact of genomics on drug discovery and clinical medicine. QJM
93: 391-423
[Abstract][Full Text]
Jiang, H., Medintz, I., Zhang, B., Michels, C. A.
(2000). Metabolic Signals Trigger Glucose-Induced Inactivation of Maltose Permease in Saccharomyces. J. Bacteriol.
182: 647-654
[Abstract][Full Text]
Kawasaki, E., Sera, Y., Yamakawa, K., Abe, T., Ozaki, M., Uotani, S., Ohtsu, N., Takino, H., Yamasaki, H., Yamaguchi, Y., Matsuura, N., Eguchi, K.
(2000). Identification and Functional Analysis of Mutations in the Hepatocyte Nuclear Factor-1{alpha} Gene in Anti-Islet Autoantibody-Negative Japanese Patients with Type 1 Diabetes. J. Clin. Endocrinol. Metab.
85: 331-335
[Abstract][Full Text]
Vaxillaire, M., Abderrahmani, A., Boutin, P., Bailleul, B., Froguel, P., Yaniv, M., Pontoglio, M.
(1999). Anatomy of a Homeoprotein Revealed by the Analysis of Human MODY3 Mutations. J. Biol. Chem.
274: 35639-35646
[Abstract][Full Text]
Farrelly, D., Brown, K. S., Tieman, A., Ren, J., Lira, S. A., Hagan, D., Gregg, R., Mookhtiar, K. A., Hariharan, N.
(1999). Mice mutant for glucokinase regulatory protein exhibit decreased liver glucokinase: A sequestration mechanism in metabolic regulation. Proc. Natl. Acad. Sci. USA
96: 14511-14516
[Abstract][Full Text]
Taylor,
(1999). Genetically Defined Forms of Diabetes in Children. J. Clin. Endocrinol. Metab.
84: 4390-4396
[Full Text]
Schuit, F., Moens, K., Heimberg, H., Pipeleers, D.
(1999). Cellular Origin of Hexokinase in Pancreatic Islets. J. Biol. Chem.
274: 32803-32809
[Abstract][Full Text]
Foretz, M., Guichard, C., Ferre, P., Foufelle, F.
(1999). Sterol regulatory element binding protein-1c is a major mediator of insulin action on the hepatic expression of glucokinase and lipogenesis-related genes. Proc. Natl. Acad. Sci. USA
96: 12737-12742
[Abstract][Full Text]
Collins, F. S.
(1999). Medical and Societal Consequences of the Human Genome Project. NEJM
341: 28-37
[Full Text]
Jonas, J.-C., Sharma, A., Hasenkamp, W., Ilkova, H., Patane, G., Laybutt, R., Bonner-Weir, S., Weir, G. C.
(1999). Chronic Hyperglycemia Triggers Loss of Pancreatic beta Cell Differentiation in an Animal Model of Diabetes. J. Biol. Chem.
274: 14112-14121
[Abstract][Full Text]
Postic, C., Shiota, M., Niswender, K. D., Jetton, T. L., Chen, Y., Moates, J. M., Shelton, K. D., Lindner, J., Cherrington, A. D., Magnuson, M. A.
(1999). Dual Roles for Glucokinase in Glucose Homeostasis as Determined by Liver and Pancreatic beta Cell-specific Gene Knock-outs Using Cre Recombinase. J. Biol. Chem.
274: 305-315
[Abstract][Full Text]
Møller, A. M., Dalgaard, L. T., Ambye, L., Hansen, L., Schmitz, O., Hansen, T., Pedersen, O.
(1999). A Novel Phe75fsdelT Mutation in the Hepatocyte Nuclear Factor-4{alpha} Gene in a Danish Pedigree with Maturity-Onset Diabetes of the Young. J. Clin. Endocrinol. Metab.
84: 367-369
[Abstract][Full Text]
Tomer, Y., Barbesino, G., Greenberg, D. A., Concepcion, E., Davies, T. F.
(1998). Linkage Analysis of Candidate Genes in Autoimmune Thyroid Disease. III. Detailed Analysis of Chromosome 14 Localizes Graves' Disease-1 (GD-1) Close to Multinodular Goiter-1 (MNG-1). J. Clin. Endocrinol. Metab.
83: 4321-4327
[Abstract][Full Text]
Elbein, S. C., Teng, K., Yount, P., Scroggin, E.
(1998). Linkage and Molecular Scanning Analyses of MODY3/Hepatocyte Nuclear Factor-1{alpha} Gene in Typical Familial Type 2 Diabetes: Evidence for Novel Mutations in Exons 8 and 10. J. Clin. Endocrinol. Metab.
83: 2059-2065
[Abstract][Full Text]
Matyka, K A, Beards, F, Appleton, M, Ellard, S, Hattersley, A, Dunger, D B
(1998). Genetic testing for maturity onset diabetes of the young in childhood hyperglycaemia. Arch. Dis. Child.
78: 552-554
[Abstract][Full Text]
Lee, Y.-H., Sauer, B., Gonzalez, F. J.
(1998). Laron Dwarfism and Non-Insulin-Dependent Diabetes Mellitus in the Hnf-1alpha Knockout Mouse. Mol. Cell. Biol.
18: 3059-3068
[Abstract][Full Text]
Bell, J.
(1998). The new genetics: The new genetics in clinical practice. BMJ
316: 618-620
[Full Text]
Glaser, B., Kesavan, P., Heyman, M., Davis, E., Cuesta, A., Buchs, A., Stanley, C. A., Thornton, P. S., Permutt, M. A., Matschinsky, F. M., Herold, K. C.
(1998). Familial Hyperinsulinism Caused by an Activating Glucokinase Mutation. NEJM
338: 226-230
[Full Text]
Cabanas, E. A.
(1998). Maturity-Onset Diabetes of the Young: Recent Findings Indicate Insulin Resistance/Obesity Are Not Factors. The Diabetes Educator
24: 477-480
Dunaif, A.
(1997). Insulin Resistance and the Polycystic Ovary Syndrome: Mechanism and Implications for Pathogenesis. Endocr. Rev.
18: 774-800
[Abstract][Full Text]
Gremlich, S., Bonny, C., Waeber, G., Thorens, B.
(1997). Fatty Acids Decrease IDX-1 Expression in Rat Pancreatic Islets and Reduce GLUT2, Glucokinase, Insulin, and Somatostatin Levels. J. Biol. Chem.
272: 30261-30269
[Abstract][Full Text]
Blanche, H., Valette, C., Bellanne-Chantelot, C.
(1997). Optimization of Nonisotopic PCR–Single-Strand Conformation Polymorphism Analysis. Clin. Chem.
43: 2190-2192
[Full Text]
Niswender, K. D., Postic, C., Jetton, T. L., Bennett, B. D., Piston, D. W., Efrat, S., Magnuson, M. A.
(1997). Cell-specific Expression and Regulation of a Glucokinase Gene Locus Transgene. J. Biol. Chem.
272: 22564-22569
[Abstract][Full Text]
Niswender, K. D., Shiota, M., Postic, C., Cherrington, A. D., Magnuson, M. A.
(1997). Effects of Increased Glucokinase Gene Copy Number on Glucose Homeostasis and Hepatic Glucose Metabolism. J. Biol. Chem.
272: 22570-22575
[Abstract][Full Text]
Elbein, S. C.
(1997). The Genetics of Human Noninsulin-Dependent (Type 2) Diabetes Mellitus. J. Nutr.
127: 1891-1891
[Abstract][Full Text]
Ma, Z., Landt, M., Bohrer, A., Ramanadham, S., Kipnis, D. M., Turk, J.
(1997). Interleukin-1 Reduces the Glycolytic Utilization of Glucose by Pancreatic Islets and Reduces Glucokinase mRNA Content and Protein Synthesis by a Nitric Oxide-dependent Mechanism. J. Biol. Chem.
272: 17827-17835
[Abstract][Full Text]
Lee, H. c., Song, Y. d., Li, H.-R., Park, J. o., Suh, H. c., Lee, E., Lim, S., Kim, K., Huh, K.
(1997). Mitochondrial Gene Transfer Ribonucleic Acid (tRNA)Leu(UUR) 3243 and tRNALys 8344 Mutations and Diabetes Mellitus in Korea. J. Clin. Endocrinol. Metab.
82: 372-374
[Abstract][Full Text]
Soejima, A., Inoue, K., Takai, D., Kaneko, M., Ishihara, H., Oka, Y., Hayashi, J.-I.
(1996). Mitochondrial DNA Is Required for Regulation of Glucose-stimulated Insulin Secretion in a Mouse Pancreatic Beta Cell Line, MIN6. J. Biol. Chem.
271: 26194-26199
[Abstract][Full Text]
Polonsky, K. S., Sturis, J., Bell, G. I.
(1996). Non-Insulin-Dependent Diabetes Mellitus -- A Genetically Programmed Failure of the Beta Cell to Compensate for Insulin Resistance. NEJM
334: 777-783
[Full Text]
Becker, T. C., Noel, R. J., Johnson, J. H., Lynch, R. M., Hirose, H., Tokuyama, Y., Bell, G. I., Newgard, C. B.
(1996). Differential Effects of Overexpressed Glucokinase and Hexokinase I in Isolated Islets. J. Biol. Chem.
271: 390-394
[Abstract][Full Text]
Kadowaki, T., Kadowaki, H., Mori, Y., Tobe, K., Sakuta, R., Suzuki, Y., Tanabe, Y., Sakura, H., Awata, T., Goto, Y.-i., Hayakawa, T., Matsuoka, K., Kawamori, R., Kamada, T., Horai, S., Nonaka, I., Hagura, R., Akanuma, Y., Yazaki, Y.
(1994). A Subtype of Diabetes Mellitus Associated with a Mutation of Mitochondrial DNA. NEJM
330: 962-968
[Abstract][Full Text]
Reynet, C, Kahn, C.
(1993). Rad: a member of the Ras family overexpressed in muscle of type II diabetic humans. Science
262: 1441-1444
[Abstract]
Weir, G. C.
(1993). A Defective Beta-Cell Glucose Sensor as a Cause of Diabetes. NEJM
328: 729-731
[Full Text]