The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
Original Article
PreviousPrevious
Volume 328:697-702 March 11, 1993 Number 10
NextNext

Familial Hyperglycemia Due to Mutations in Glucokinase -- Definition of a Subtype of Diabetes Mellitus
Philippe Froguel, Habib Zouali, Nathalie Vionnet, Gilberto Velho, Martine Vaxillaire, Fang Sun, Suzanne Lesage, Markus Stoffel, Jun Takeda, Philippe Passa, M. Alan Permutt, Jacques S. Beckmann, Graeme I. Bell, and Daniel Cohen

 

This Article
-Abstract

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation
ABSTRACT

Background and Methods Non-insulin-dependent diabetes mellitus (NIDDM) is a genetically heterogeneous disorder. Maturity-onset diabetes of the young, a form of NIDDM with an early age of onset and autosomal dominant inheritance, can result from mutations in glucokinase, a key enzyme of glucose metabolism in beta cells and the liver. We studied 32 French families with maturity-onset diabetes of the young as well as 21 families with late-onset NIDDM to determine the frequency and clinical features of mutations of glucokinase. Fasting plasma glucose concentrations and oral glucose-tolerance tests were used to determine metabolic status. DNA was isolated from lymphocytes, and DNA polymorphisms in the glucokinase gene were tested for linkage with diabetes. Individual exons of the glucokinase gene from one affected member in each family were amplified by the polymerase chain reaction and screened for mutations by analysis of the conformation-dependent polymorphisms of single-stranded DNA and by DNA sequencing.

Results We found substantial evidence of linkage between the glucokinase locus and maturity-onset diabetes of the young but not between this locus and late-onset NIDDM. Sixteen mutations were identified in 18 of the 32 families with maturity-onset diabetes of the young, but none were found in families with late-onset NIDDM. They included 10 mutations that resulted in an amino acid substitution, 3 that resulted in the synthesis of a truncated protein, and 3 that affected RNA processing. The affected subjects with glucokinase mutations usually had mild hyperglycemia that began during childhood, whereas in subjects with maturity-onset diabetes of the young not due to glucokinase mutations, hyperglycemia usually appeared after puberty.

Conclusions Mutations in glucokinase are the primary cause of hyperglycemia in a substantial fraction of French patients with maturity-onset diabetes of the young and result in a relatively mild form of NIDDM that can be diagnosed in childhood.


Non-insulin-dependent diabetes mellitus (NIDDM) is a heterogeneous disorder of glucose homeostasis characterized by defects in the secretion and action of insulin. The familial aggregation of NIDDM and high concordance rate in identical twins indicate the important contribution of heredity to its development1. Recent genetic studies of families with maturity-onset diabetes of the young, a form of NIDDM characterized by an age at onset of less than 25 years and autosomal dominant inheritance, have localized diabetes-susceptibility genes to chromosomes 7 and 202,3,4. Although the identity of the gene on chromosome 20 is not known, mutations in the glucokinase gene on chromosome 7 have been identified and shown to be the cause of diabetes in four French families5,6.

The glycolytic enzyme glucokinase is expressed only in liver and pancreatic beta cells and has a key role in the regulation of glucose homeostasis. In hepatocytes, the phosphorylation of glucose by glucokinase facilitates the uptake and metabolism of glucose by maintaining a gradient for glucose transport into these cells. In pancreatic beta cells, glucokinase appears to make up part of the glucose-sensing mechanism and to be involved in the regulation of insulin secretion7,8,9.

The aim of this study was to determine the contribution of mutations in the glucokinase gene to the development of NIDDM and the frequency of mutations in the glucokinase gene in patients with maturity-onset diabetes of the young as compared with that in patients with late-onset NIDDM. Molecular genetic and clinical studies were performed in 53 French families in which familial transmission of diabetes was strong, including 32 families with maturity-onset diabetes of the young and 21 families with late-onset NIDDM. We looked for linkage between polymorphisms in the glucokinase gene and NIDDM and screened the glucokinase gene for mutations in one affected member from each family.

Methods

Families

Information on family history and clinical data were obtained from 801 members of 53 white French families with NIDDM,10 in which at least two subjects in consecutive generations had been given a diagnosis of diabetes mellitus based on criteria from the World Health Organization11. These included 32 families with maturity-onset diabetes of the young, defined as NIDDM that developed before the age of 25 years and was inherited in an autosomal dominant fashion in at least two family members,12 and 21 families with late-onset NIDDM, in which the transmission of diabetes was consistent with an autosomal dominant mode of inheritance. Fasting plasma glucose concentrations were measured in all subjects. In addition, 65 percent of the affected members of both groups who did not have overt diabetes underwent oral glucose-tolerance testing. For the purposes of the linkage analysis, 220 of the 551 subjects with maturity-onset diabetes of the young and 115 of the 250 subjects with late-onset NIDDM were considered to be affected. These included subjects with overt NIDDM and subjects with impaired glucose tolerance,11 as well as subjects with mild fasting hyperglycemia, which was defined as a fasting plasma glucose concentration between 110 and 140 mg per deciliter (between 6.1 and 7.8 mmol per liter) on two separate occasions and a plasma glucose concentration of less than 140 mg per deciliter two hours after the oral administration of glucose during a glucose-tolerance test. A fasting plasma glucose concentration of more than 110 mg per deciliter represents a value 2 SD above the mean normal value for the French population13. Clinical data were obtained for each subject during a standardized clinical examination performed at the Endocrinology Service of Hopital Saint-Louis or by the subject's personal physician.

Molecular Studies

DNA was prepared from peripheral-blood lymphocytes14. The genotypes of the subjects were established with use of the polymerase chain reaction (PCR) to detect the two previously described DNA polymorphisms in the glucokinase gene,3 as well as a third recently identified five-allele DNA polymorphism (GCK3) located approximately 4.3 kb upstream of exon 1a. GCK3 was detected with primers 5'GGTTATGTAGCATCAGGATG3' and 5'TCTCTCTGTCTCTGTGAGTC3'; the PCR product was 280 base pairs (bp). The AluVpA/PstI haplotypes in the adenosine deaminase gene, a marker for the diabetes-susceptibility gene on chromosome 20, were determined as described previously2,3.

Molecular scanning for mutations in the glucokinase gene was done by PCR amplification of genomic DNA followed by analysis of the conformation-dependent polymorphisms of single-stranded DNA or direct sequencing of the PCR product15,16. The amplified PCR products were sequenced with an Applied Biosystems DNA sequencer (model 373A, Foster City, Calif.) and a dideoxy-cycle-sequencing protocol in the presence of the specific primers6 together with fluorescent-labeled dideoxy terminators or after cloning into the HincII site of M13mp18 DNA17.

Specific amplification18 of normal and mutant alleles of the mutation in exon 8 in which glutamine is substituted for glutamic acid at codon 300 was performed with primers hGK8b6 (5'CTGAGATCCGGCATGTCTTG3') and F51-8-E (5'AGGTGGCAAGTACATGGGCG3') for the normal allele or with primer F51-8-Q (5'AGGTGGCAAGTACATGGGCC3') for the mutant allele. Exon 7 was amplified with exon 8 as an internal control. The PCR conditions consisted of denaturation at 94 °C for 5 minutes, followed by 35 cycles of denaturation at 94 °C for 1 minute, annealing and extension at 65 °C for 2 minutes, and a final 10 minutes of extension at 65 °C. The PCR products were separated by electrophoresis on 3 percent NuSieve agarose gel (FMC Bioproducts, Rockland, Me.).

Linkage Analyses

Linkage analyses were performed with the LINKAGE package of computer programs19. In analyzing families with maturity-onset diabetes of the young, we assumed an autosomal dominant model3. In analyzing families with late-onset NIDDM, we tested two models. The first was an autosomal dominant model with equal penetrance for susceptible heterozygotes and homozygotes, and the second was an intermediate model with different levels of penetrance for susceptible heterozygotes and homozygotes. For both models, we assumed three classes of penetrance related to age and body-mass index (the weight in kilograms divided by the square of the height in meters), a population prevalence for the disease gene of 1 percent, and a penetrance in the normal homozygotes of 1 percent. The liability classes and levels of penetrance used are summarized in Table 120.

View this table:
[in this window]
[in a new window]
 
Table 1. Models Used in Linkage Analyses in Families with Late-Onset NIDDM to Determine Penetrance, According to the Age at Onset and Body-Mass Index.

 
Statistical Analysis

The results are expressed as means ±SD. The statistical significance of the differences between groups was assessed with the Mann-Whitney U test (two-tailed) for nonparametric results and contingency-table chi-square analysis.

Results

Linkage Analyses in Diabetic Families

The analysis of linkage between DNA polymorphisms in the glucokinase gene and diabetes in the 32 families with maturity-onset diabetes of the young indicated odds of more than 1023:1 in favor of linkage (lod score, 23.9). However, analysis of the heterogeneity of linkage between maturity-onset diabetes of the young and the glucokinase gene with the computer program HOMOG21 showed relative odds in favor of genetic heterogeneity of 1.2 x 108 (P<0.001) and indicated that the disorder was linked to the glucokinase gene in only about 60 percent of the families (range, 35 to 80 percent). Because of the small size of most of the families studied, the linkage results provided formal evidence of linkage (i.e., a lod score exceeding 3.0, or odds in favor of linkage of more than 1000:1) between maturity-onset diabetes of the young and the glucokinase gene in only three families (F8, F51, and F393). The linkage studies also excluded glucokinase as the cause of maturity-onset diabetes of the young in four families (F30, F159, F213, and F257); in other words, the lod score was less than -2 or the odds against linkage exceeded 100:1 in each of these families. The 32 families with maturity-onset diabetes of the young were also tested for linkage between diabetes and DNA polymorphisms in the adenosine deaminase gene, which is a marker2 for the diabetes-susceptibility gene on chromosome 20; no evidence of linkage was found in any family. Moreover, this analysis excluded the diabetes-susceptibility gene on chromosome 20 as the probable cause of diabetes in three families (F159, F213, and F257). These linkage studies demonstrate that maturity-onset diabetes of the young is genetically heterogeneous and suggest that mutations in the glucokinase gene may be the primary cause of NIDDM in about 60 percent of families with this form of diabetes mellitus.

Analysis of linkage between the glucokinase gene and diabetes in the 21 families with late-onset NIDDM gave an overall lod score of -7.73 at a recombination fraction of 0.00, providing no evidence of linkage between the glucokinase locus and NIDDM in these families. No family had a positive lod score. These results were insensitive to changes in the genetic models.

Identification of Mutations in the Glucokinase Gene

Each of the 12 exons of the glucokinase gene6 in one diabetic member from each of the 32 families with maturity-onset diabetes of the young and from each of the 21 families with late-onset NIDDM was amplified by PCR and screened for mutations by analysis of the conformation-dependent polymorphisms of single-stranded DNA16. Whenever an abnormal pattern of polymorphisms was noted, that exon was sequenced to identify the DNA substitution responsible for the abnormal pattern, and the segregation of the mutation with diabetes was studied in other family members. The mutations identified in the glucokinase gene associated with NIDDM are shown in Table 2. They include missense mutations that result in the synthesis of a glucokinase molecule with a different amino acid sequence, nonsense mutations that result in the expression of a truncated molecule, and splicing mutations that alter the processing of glucokinase messenger RNA. In addition to these mutations, DNA substitutions that did not cosegregate with NIDDM and that therefore represent polymorphisms or rare variants were also found. The mutations listed in Table 2 were present in all affected members of the family and were not found in any unaffected members or in at least 40 unrelated normal subjects, implying that they were the cause of the diabetes. By contrast, the polymorphisms and variants listed in Table 2 occurred in both affected and unaffected subjects.

View this table:
[in this window]
[in a new window]
 
Table 2. Characterization of the Mutations and Polymorphisms in the Glucokinase Gene in Families with Maturity-Onset Diabetes of the Young.

 
Mutations in the glucokinase gene were detected in 18 of the 32 families (56 percent) with maturity-onset diabetes of the young. In the 14 families in which we did not find a mutation, the lod scores were negative, suggesting that NIDDM in these families was not due to unidentified mutations in the glucokinase gene. By contrast, studies of the glucokinase gene in the 21 families with late-onset NIDDM showed an abnormality in only 1 (F15). This was a substitution of thymidine for cytosine (C to T) 12 bp upstream from the intron 1c splice acceptor site and was present in only two of the five affected subjects. This nucleotide substitution was also found in 1 of 121 unrelated subjects with late-onset NIDDM, but in none of 55 unrelated normal subjects.

Mutations in Glucokinase Causing Diabetes Mellitus

The presence of mutations in the glucokinase gene in patients with maturity-onset diabetes of the young suggested that the mutations were the direct cause of this disorder. We addressed this issue in Family F51 by testing all available subjects for the presence of the Glu300-to-Gln mutation, using allele-specific amplification18 (Figure 1 and Figure 2). This mutation was present in each of the 41 subjects with hyperglycemia and in none of their normal relatives. The lod score for linkage between the Glu300-to-Gln mutation and NIDDM was 14.1 (i.e., odds in favor of linkage of more than 1014:1) at a recombination fraction of 0.00, indicating that this mutation was the cause of glucose intolerance in this family. We tested 23 members of Family F51 who were younger than 10 years of age, 5 of whom had mild fasting hyperglycemia and the Glu300-to-Gln mutation.


View larger version (42K):
[in this window]
[in a new window]
 
Figure 1. Allele-Specific Amplification of the Glu-to-Gln Mutation at Codon 300 in 13 Members of the Third Generation of Family F51.

The subjects are identified by numbers corresponding to the numbers in the pedigree shown in Figure 2. The normal and mutant alleles at Glu300 were amplified with exon 7, which served as a PCR control, as described in the Methods section. The presence of a PCR product of 202 bp after amplification with PCR primers specific for the normal (N) or the mutant (M) allele denotes the presence of the corresponding allele.

 

View larger version (67K):
[in this window]
[in a new window]
 
Figure 2. Cosegregation of the Glu-to-Gln Mutation at Codon 300 in the Glucokinase Gene with the Gene for Maturity-Onset Diabetes of the Young (MODY) in Family F51.

The genotypes for the subjects tested for the presence of this mutation by allele-specific amplification are shown. N denotes normal allele, and M mutant allele. Squares denote male family members, circles female family members, and symbols with a slash deceased family members.

 
Clinical Features of Families with Mutations in Glucokinase

We compared the clinical features of subjects with maturity-onset diabetes of the young due to mutations in glucokinase with those of subjects with maturity-onset diabetes of the young due to other causes (Table 3). There were no differences between the two groups in fasting plasma glucose and insulin concentrations. However, the group with glucokinase mutations were younger at the time of diagnosis and had a milder form of diabetes, in that they had a lower frequency of overt NIDDM.

View this table:
[in this window]
[in a new window]
 
Table 3. Clinical Characteristics of Patients with Maturity-Onset Diabetes of the Young and Patients with Late-Onset NIDDM.

 
With respect to age at the time of the diagnosis of hyperglycemia, we identified at least one affected subject who was 12 years of age or younger in 17 of the 18 families with mutations in the glucokinase gene. Moreover, 11 subjects were given a diagnosis before the age of 6 years, and 1 was given a diagnosis at 16 months. This boy had a fasting plasma glucose concentration of 92 mg per deciliter (5.1 mmol per liter) at 3 months of age and of 120 mg per deciliter (6.7 mmol per liter) at 16 months; the normal values at this age range from 48 to 80 mg per deciliter (2.7 to 4.4 mmol per liter).

Discussion

We identified mutations in the glucokinase gene in 18 of the 32 families with maturity-onset diabetes of the young (56 percent). In contrast, no such mutations were found in 21 families with late-onset NIDDM, implying that mutations in glucokinase are not a major cause of this form of NIDDM. However, we cannot exclude the possibility that glucokinase mutations may contribute to the development of NIDDM in other ethnic or racial groups with late-onset NIDDM. In this regard, associations between specific glucokinase microsatellite alleles and NIDDM have been reported in American blacks22 and Mauritian Creoles23.

The molecular mechanism whereby mutations in glucokinase cause a dominantly inherited form of hyperglycemia is not known. The results suggest that a gene-dosage mechanism may be the most likely cause of the hyperglycemia, since all RNA splicing mutations as well as nonsense and missense mutations were associated with diabetes, and each would be expected to decrease cellular levels of glucokinase. Since the amount of glucokinase in beta cells is believed to determine the threshold for glucose-stimulated insulin secretion, any decrease in the intracellular content or activity of glucokinase would be predicted to increase this threshold. In Families F51, F85, F386, and F423 (Table 2), the plasma glucose concentrations required to cause insulin secretion were increased,24 a finding consistent with this hypothesis. The mutations in glucokinase were also highly penetrant, and all the subjects with glucokinase mutations that we have studied had a metabolic defect, whether mild fasting hyperglycemia, impaired glucose tolerance, or NIDDM.

Sixteen different mutations were identified in 18 families with maturity-onset diabetes of the young. Thus, rather than one or two mutations being responsible for the diabetes in this relatively homogeneous group of white subjects of French ancestry, there are many. A similar spectrum of mutations will probably be found in other ethnic and racial groups, especially since about 50 percent of the mutations shown in Table 2 occur in the context of a cytosine-phosphate-guanosine dinucleotide, which represents a hot spot for mutations25.

Our results indicate that 56 percent of the French families with maturity-onset diabetes of the young carry a mutation in the glucokinase gene. In the remaining 44 percent of the families, linkage analysis with highly polymorphic DNA markers as well as direct screening of the glucokinase gene for mutations suggested that mutations in the glucokinase gene are not the cause of hyperglycemia. Although we could have missed a mutation in the glucokinase gene, we believe it to be unlikely. In fact, 2 of the 14 families in which we were unable to identify a mutation in the glucokinase gene had positive but nonsignificant lod scores for linkage with adenosine deaminase, a marker for a gene for maturity-onset diabetes of the young on chromosome 20, suggesting that the NIDDM in these families was due to mutations in the unidentified diabetes gene on this chromosome. The absence of linkage with the glucokinase or adenosine deaminase gene in the remaining 12 families indicates that there is at least one more gene whose mutation may cause maturity-onset diabetes of the young.

Mutations in glucokinase result in a form of NIDDM that has an early age of onset, often childhood. Although the age at diagnosis may be the most easily recognizable variable that differentiates patients with glucokinase mutations from those who do not have such mutations, it suffers from a lack of discriminating ability because of ascertainment bias. Indeed, screening for diabetes in our families with maturity-onset diabetes of the young led to a decrease in the mean (±SD) age at diagnosis in consecutive generations: from 41 ±15 years in the generation born after 1930 to 22 ±9 years in those born after 1950 and 11 ±5 years in those born after 1970. We measured fasting plasma glucose concentrations in all available subjects over the age of five years (and in several children who were younger). Thus, we believe that the minimal age at diagnosis of hyperglycemia shown in Table 3 is a reflection of the real age at onset and that there is a difference between the subjects with and those without glucokinase mutations.

By contrast, in families with maturity-onset diabetes of the young without glucokinase mutations, the onset of disease occurred after puberty, a period associated with decreased sensitivity to insulin26. However, the disease began in childhood in two affected subjects in families with maturity-onset diabetes of the young without glucokinase mutations. One was from a family in which the diabetes may be due to a mutation in the gene for maturity-onset diabetes of the young on chromosome 20. The second subject had a mother with maturity-onset diabetes of the young and a father with late-onset NIDDM. It has been suggested that abnormalities in glucose metabolism occur at an earlier age in persons with two diabetic parents27.

The NIDDM due to mutations in glucokinase appears to be relatively mild, as indicated by the number of affected subjects who did not have overt diabetes and by the fact that the disease was treated by diet alone in most subjects. Since most were lean, having a normal body weight may be sufficient to maintain fasting plasma glucose concentrations around 125 mg per deciliter (6.9 mmol per liter).

NIDDM is a heterogeneous disorder, and several genetic mechanisms have been implicated in its cause. These include mutations in the insulin28 and insulinreceptor genes,29 the mitochondria,30 and a gene linked to adenosine deaminase on chromosome 20,2 as well as in the glucokinase gene. Although further studies are required to determine their actual prevalence, mutations in the glucokinase gene have been identified in 18 of the 300 diabetes-prone French families (6 percent) for whom we have data. Thus, mutations in this gene are the most common cause of NIDDM identified to date.

Continuing genetic studies of families with maturity-onset diabetes of the young should provide a better understanding of the causes of NIDDM as well as a foundation for addressing the genetic factors that contribute to the more common late-onset forms of this disease.

Supported by the Association Francaise contre les Myopathies through the Genethon program, the Assistance Publique-Hopitaux de Paris, Boehringer-Mannheim, the French Ministry for Research and Technology, the Deutsche Forschungsgemeinschaft, the Howard Hughes Medical Institute, and the National Institutes of Health (grants DK-20595, DK-44840, and DK-16746).

We are indebted to Drs. H. Lestradet and J.J. Robert for referring their patients, to the Caisse Nationale de Prevoyance-Assurances and the Regie Autonome des Transports Parisiens for help in identifying families, and to Ms. F. Lethrosne, Ms. F. Dufour, Ms. C. Roudaut, Ms. M.O. Butel, and Mr. J.M. Sebaoun for their technical assistance.


Source Information

From the Centre d'Etude du Polymorphisme Humain, Paris (P.F., H.Z., G.V., M.V., F.S., S.L., J.S.B., D.C.); Service d'Endocrinologie, Hopital Saint-Louis, Paris (P.F., P.P.); the Metabolism Division, Washington University School of Medicine, St. Louis (M.A.P.); and the Howard Hughes Medical Institute and Departments of Biochemistry and Molecular Biology and Medicine, University of Chicago, Chicago (N.V., M.S., J.T., G.I.B.).

Address reprint requests to Dr. Froguel at the Centre d'Etude du Polymorphisme Humain, 27 rue Juliette Dodu, 75010 Paris, France.

References

  1. Rich SS. Mapping genes in diabetes: genetic epidemiological perspective. Diabetes 1990;39:1315-1319. [Abstract]
  2. Bell GI, Xiang KS, Newman MV, et al. Gene for non-insulin-dependent diabetes mellitus (maturity-onset diabetes of the young subtype) is linked to DNA polymorphism on human chromosome 20q. Proc Natl Acad Sci U S A 1991;88:1484-1488. [Free Full Text]
  3. Froguel P, Vaxillaire M, Sun F, et al. Close linkage of glucokinase locus on chromosome 7p to early-onset non-insulin-dependent diabetes mellitus. Nature 1992;356:162-164. [CrossRef][Medline]
  4. Hattersley AT, Turner RC, Permutt MA, et al. Linkage of type 2 diabetes to the glucokinase gene. Lancet 1992;339:1307-1310. [CrossRef][Medline]
  5. Vionnet N, Stoffel M, Takeda J, et al. Nonsense mutation in the glucokinase gene causes early-onset non-insulin-dependent diabetes mellitus. Nature 1992;356:721-722. [CrossRef][Medline]
  6. Stoffel M, Froguel P, Takeda J, et al. Human glucokinase gene: isolation, characterization, and identification of two missense mutations linked to early-onset non-insulin-dependent (type 2) diabetes mellitus. Proc Natl Acad Sci U S A 1992;89:7698-7702. [Free Full Text]
  7. Meglasson MD, Matschinsky FM. New perspectives on pancreatic islet glucokinase. Am J Physiol 1984;246:E1-E13. [Free Full Text]
  8. Matschinsky FM. Glucokinase as glucose sensor and metabolic signal generator in pancreatic beta-cells and hepatocytes. Diabetes 1990;39:647-652. [Abstract]
  9. Magnuson MA. Glucokinase gene structure: functional implications of molecular genetic studies. Diabetes 1990;39:523-527. [Abstract]
  10. Froguel P, Velho G, Cohen D, Passa P. Strategies for the collection of sibling-pair data for genetic studies in type 2 (non-insulin-dependent) diabetes mellitus. Diabetologia 1991;34:685-685. [Medline]
  11. WHO Expert Committee on Diabetes Mellitus: second report. WHO Tech Rep Ser 1980;646:1-80.
  12. Fajans SS. Scope and heterogeneous nature of MODY. Diabetes Care 1990;13:49-64. [Erratum, Diabetes Care 1990;13:910.] [Abstract]
  13. Tchobroutsky G. Blood glucose levels in diabetic and non-diabetic subjects. Diabetologia 1991;34:67-73. [CrossRef][Medline]
  14. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Plainview, N.Y.: Cold Spring Harbor Laboratory Press, 1989.
  15. Saiki RK, Gelfand DH, Stoffel S, et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 1988;239:487-491. [Free Full Text]
  16. Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 1989;5:874-879. [CrossRef][Medline]
  17. Sanger F, Coulson AR, Barrell BG, Smith AJH, Roe BA. Cloning in single-stranded bacteriophage as an aid to rapid DNA sequencing. J Mol Biol 1980;143:161-178. [CrossRef][Medline]
  18. Newton CR, Graham A, Heptinstall LE, et al. Analysis of any point mutation in DNA: the amplification refractory mutation system (ARMS). Nucleic Acids Res 1989;17:2503-2516. [Free Full Text]
  19. Lathrop GM, Lalouel JM. Easy calculations of lod scores and genetic risks on small computers. Am J Hum Genet 1984;36:460-465. [Medline]
  20. Kobberling J, Tillil H. Empirical risk figures for first degree relatives of non-insulin dependent diabetics. In: Kobberling J, Tattersall R, eds. The genetics of diabetes mellitus. Vol. 47 of Proceedings of the Serono Symposia. London: Academic Press, 1982:201-9.
  21. Ott J. Analysis of human genetic linkage. Rev. ed. Baltimore: Johns Hopkins University Press, 1991.
  22. Chiu KC, Province MA, Permutt MA. Glucokinase gene is genetic marker for NIDDM in American blacks. Diabetes 1992;41:843-849. [Abstract]
  23. Chiu KC, Province MA, Dowse GK, et al. A genetic marker at the glucokinase gene locus for type 2 (non-insulin-dependent) diabetes mellitus in Mauritian Creoles. Diabetologia 1992;35:632-638. [CrossRef][Medline]
  24. Velho G, Froguel P, Clement K, et al. Primary pancreatic beta-cell secretory defect caused by mutations in glucokinase gene in kindreds of maturity onset diabetes of the young. Lancet 1992;340:444-448. [CrossRef][Medline]
  25. Cooper DN, Krawczak M. The mutational spectrum of single base-pair substitutions causing human genetic disease: patterns and predictions. Hum Genet 1990;85:55-74. [Medline]
  26. Lestradet H, Deschamps I, Tichet J, Lestradet MO. Hyperglycemie chronique non insulinoprive de l'enfant. Arch Fr Pediatr 1989;46:19-23. [Medline]
  27. O'Rahilly S, Wainscoat JS, Turner RC. Type 2 (non-insulin-dependent) diabetes mellitus: new genetics for old nightmares. Diabetologia 1988;31:407-414. [CrossRef][Medline]
  28. Steiner DF, Tager HS, Chan SJ, Nanjo K, Sanke T, Rubenstein AH. Lessons learned from molecular biology of insulin-gene mutations. Diabetes Care 1990;13:600-609. [Abstract]
  29. Taylor SI, Cama A, Accili D, et al. Genetic basis of endocrine disease. 1. Molecular genetics of insulin resistant diabetes mellitus. J Clin Endocrinol Metab 1991;73:1158-1163. [Medline]
  30. Ballinger SW, Shoffner JM, Hedaya EV, et al. Maternally transmitted diabetes and deafness associated with a 10.4 kb mitochondrial DNA deletion. Nat Genet 1992;1:11-15. [CrossRef][Medline]

 

This Article
-Abstract

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation

This article has been cited by other articles:



HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2008 Massachusetts Medical Society. All rights reserved.