Background and Methods The nerve growth factor receptor is expressedin some neuroblastomas, in which its primary component is encodedby the TRK proto-oncogene. To determine the relation of theexpression of TRK messenger RNA in neuroblastomas to other clinicaland laboratory variables, we studied frozen tumor samples from77 patients. In addition, we tested two primary neuroblastomasthat expressed TRK for responsiveness to nerve growth factor.
Results TRK expression strongly correlated with favorable tumorstage (I, II, and IVS vs. III and IV), younger age (<1 yearvs. 1 year), normal N-myc copy number, and low level of N-mycexpression. N-myc amplification (indicated by a high copy number)correlated with advanced tumor stage, older age, an adrenalsite of the primary tumor, low level of expression of TRK, andhigh level of expression of N-myc. Analysis of five-year cumulative-survivalrates demonstrated an association of a very favorable outcomewith a high level of TRK expression (86 percent vs. 14 percent)and with normal N-myc copy number (84 percent vs. 0 percent).Univariate analysis showed that these two variables were themost powerful predictors of outcome (chi-square = 51.30, P<0.001;and chi-square = 93.61, P<0.001, respectively). TRK expressionstill had significant prognostic value when the analysis wasrestricted to tumors without N-myc amplification. In primarycultures of neuroblastoma cells expressing TRK, exposure tonerve growth factor induced early gene expression and neuriteoutgrowth, but deprivation of nerve growth factor led to neuronalcell death.
Conclusions A high level of expression of the TRK proto-oncogenein a neuroblastoma is strongly predictive of a favorable outcome.A tumor with a functional nerve growth factor receptor may bedependent on the neurotrophin nerve growth factor for survivaland may regress in its absence, allowing a new approach to thetreatment of certain patients with neuroblastoma. .
Neuroblastoma is one of the most common malignant tumors amongchildren, yet the prognosis of patients with advanced diseaseis still very poor. The tumor originates from the sympathoadrenallineage of the neural crest1. The ability to differentiate bothin vivo and in vitro is one of the most interesting characteristicsof neuroblastomas, and this differentiation may involve theinteraction between the neurotrophin nerve growth factor (NGF)and its receptor2,3,4,5,6,7,8,9,10,11,12. Morphologic differentiationinduced by NGF has been observed in a limited number of primarycultures of neuroblastoma,4,6 but most neuroblastoma cell linesare unresponsive to NGF5,8,10,11,12. In a previous study, wefound multiple defects of expression and function of a componentof the NGF receptor in neuroblastoma cell lines,11 but the roleof the NGF-receptor pathway in the pathogenesis of neuroblastomashas been uncertain.
There are two classes of NGF receptors that bind NGF with eitherhigh or low affinity13,14. The low-affinity NGF-receptor (LNGFR)gene encodes a transmembrane protein, which is glycosylatedso that it yields a protein of about 75 kd (p75LNGFR)15,16.However, no known biologic responses are mediated solely bythe LNGFR17. The high-affinity NGF receptor appears to be aheteromeric complex that includes p75LNGFR and p140 proto-TRK,the product of the proto-oncogene TRK (also known as TRKA)18,19.This transmembrane glycoprotein is a tyrosine kinase that isexpressed selectively in the developing nervous system20. Thebiologic responsiveness to NGF depends on interactions withp140proto-TRK, but at present it is unclear whether this proteinexerts full biologic activity alone or acts as part of a high-affinityreceptor21,22,23,24.
TRK is expressed in many primary neuroblastomas and is associatedinversely with amplification of the N-myc proto-oncogene25.We studied the expression of TRK and LNGFR and attempted torelate the expression of these genes to clinical and biologicvariables, to assess the importance of the expression of NGFreceptors in neuroblastomas. In addition, we tested the functionof the NGF receptor in vitro in primary neuroblastomas thatexpressed TRK. We found that TRK expression is a powerful prognosticmarker that identifies a favorable group of tumors. We alsofound that NGF induces terminal neuronal differentiation inthese cells, but that deprivation of NGF leads to neuronal celldeath.
Methods
Patients and Therapy
We studied tumors from 77 children with neuroblastomas thathad been diagnosed in Japan and the United States from 1982to 199125. Sixty-three patients were identified at Kyushu NeuroblastomaStudy Group institutions and cooperative hospitals in Japan;the tumors of 27 of these patients were found during a massscreening program for neuroblastoma26. Thirteen patients wereidentified at Washington University in St. Louis or at otherinstitutions of the Pediatric Oncology Group, and one was identifiedelsewhere25. The selection of tumors for study was based solelyon the availability of a sufficient amount of tumor tissue fromwhich to prepare DNA and messenger RNA (mRNA) for the analysesdescribed below.
All diagnoses of neuroblastoma were confirmed by histologicassessment of a tumor specimen obtained at surgery. The histologicfeatures of the tumors were classified as described previously27.There were 59 neuroblastomas and 18 ganglioneuroblastomas, allof which were considered neuroblastomas in these analyses. Thetumors were staged according to the system of Evans et al28.Twenty patients (13 identified by mass screening) had stageI tumors, 14 (9 identified by mass screening) had stage II tumors,15 (5 identified by mass screening) had stage III tumors, 16had stage IV tumors, and 12 had stage IVS tumors. In additionto the tumors from the 77 patients, ganglioneuromas from 5 patientswere included as differentiated tumors in the comparison ofgene expression with tumor histology, but these patients werenot included in the survival analysis.
Patients were treated according to previously described protocols29,30,31,32,33,34,35.Despite differences between the protocols for treating the Japanesepatients and those for treating the patients studied by thePediatric Oncology Group, the drugs and doses used in the protocolswere quite similar, and the stage-specific survival rates ofthe two groups did not differ significantly (data not shown).The median follow-up period after diagnosis was 36 months (range,8 to 116). None of the patients underwent bone marrow transplantation.
Tumor Specimens and Cell Lines
Sixty of the 77 neuroblastoma samples were obtained from untreatedpatients. Fifteen Japanese patients with advanced disease receivedone or two courses of chemotherapy before tumor removal. Twotumor samples were obtained from metastases (a lymph node anda liver nodule), and the rest were obtained from the primarytumors. The tumor tissues were immediately frozen and storedat -70 °C until used. Three human neuroblastoma cell lines-- SK-N-SH (NSH), SH-SY5Y (SY5Y), and NMB -- as well as a ratpheochromocytoma line, PC12, have been described previously36,37and were grown as described25.
Southern and Northern Blot Analyses
The Nu-myc copy number was determined by Southern blot analysis38,39.A normal N-myc copy number is defined as 1 copy per haploidgenome (i.e., 2 per cell); a copy number above 3 per haploidgenome was considered to indicate N-myc amplification, but mosttumors with such amplification had 50 to 100 copies or more38,39.Total RNA was extracted from 0.5 to 1.0 g of frozen tumor tissueor cultured cells40. Expression of TRK, LNGFR, S100, and N-mycmRNA was measured by Northern blot analysis, normalized to thelevel of expression of -actin, and quantitated in arbitrarydensity units25. For some analyses, the tumors were groupedinto those with a low level of expression (<100 density units)and those with a high level ( 100 density units).
The following probes were gifts: the TRK probe from Luis Parada,23the LNGFR probe from Moses Chao,15 and the N-myc probe fromJ. Michael Bishop38. Expression of S100- was used as a markerfor Schwann cells41. The S100- probe was prepared by polymerase-chain-reaction(PCR) amplification and subcloning, based on a published sequence42.PCR amplification with total human DNA as a template resultedin a 778-base-pair fragment (primers, 5'TCAAAGAGCAGGAGGTTGTG3'and 5'GACTTGAATCGCATGGGTCA3'). To assess the function of theNGF receptor in primary cultures, we measured the inductionof expression of the early-response genes FOS43,44,45 and NGFI-A46.All probes were labeled by means of the random-hexamer primertechnique47.
Primary Culture of Neuroblastoma
Tumor cells were dissociated from tumor tissue obtained at surgery6.Aliquots of cells in collagen-coated wells were divided intothree groups: a control group (in standard medium), an NGF-treatedgroup (with 100 ng of mouse NGF per milliliter), and an NGF-depletedgroup (with 40 units of anti-NGF antiserum per milliliter).The NGF and antiserum48 were provided by Eugene M. Johnson.The cells were grown at 37 °C, and the culture medium waschanged every two or three days. For the studies of expression,the cells were grown in standard medium for 36 hours, treatedwith NGF for 40 minutes, and then immediately harvested, frozen,and stored at -70 °C for analysis.
Statistical Analysis
Statistical analyses were performed at the Pediatric OncologyGroup Statistical Office with SAS software. Associations betweenpairs of categorical variables were assessed with Pearson'schi-square statistic. The continuous variables of groups werecompared by the Wilcoxon rank-sum test. Survival probabilitiesin various subgroups were estimated according to the methodof Kaplan and Meier49. Survival of groups was compared by log-ranktests,50 with adjustment for N-myc amplification by Cox regression51.
Results
Expression of TRK, LNGFR, and N-myc
Expression of TRK mRNA was detected in 70 of the 77 neuroblastomas(91 percent), and LNGFR was expressed in 67 (87 percent) (Figure 1).However, a high level of expression ( 100 density units)of TRK was observed in 82 percent (63 tumors), but comparablelevels of LNGFR expression were found only in 36 percent (28tumors). The median level of TRK expression in tumors in stagesI, II, and IVS was 1544 density units (46 tumors), whereas thatin tumors in stages III and IV was 402 density units (31 tumors)(P<0.001)(Figure 1A). Eleven tumors with N-myc amplification had an extremelylow median level of TRK expression (0 density units), as comparedwith tumors without amplification (1352 density units; P = 0.003).When tumors with N-myc amplification were excluded, there wasstill a significant difference between the two tumor-stage groupsin the level of TRK expression (P = 0.016).
Figure 1. Densitometric Analysis of Expression of TRK and LNGFR in mRNA in Tumor Samples from 77 Patients with Neuroblastomas, According to Tumor Stage and N-myc Copy Number.
The levels of expression of TRK and LNGFR were normalized to that of -actin and measured in arbitrary density units. Horizontal lines represent group means. Diamonds represent patients identified by mass screening; squares, patients from whom samples were obtained at recurrence; and circles, all other patients, including those who have died (solid circles).
The median level of LNGFR expression was 22 density units instage I, II and IVS tumors (46 tumors) and 7 density units instage III and IV tumors (31 tumors) (Figure 1B). The tendencyof stage I, II, and IVS tumors to have higher levels of LNGFRexpression only approached significance (P = 0.076). Tumorswith N-myc amplification showed low levels of LNGFR expression,as compared with tumors without amplification (median, 3 densityunits [11 tumors] vs. 15 density units [66 tumors]; P<0.001).The expression of TRK in the reference neuroblastoma cell linesNSH, SY5Y, and NMB was 21, 110, and 0 density units, respectively,and the expression of LNGFR was 7, 6, and 0 density units, respectively(data not shown). N-myc was expressed at very high levels inall tumors with N-myc amplification (median level in 11 tumorswith amplification vs. median in 66 without amplification, 940vs. 10 density units; P<0.001). However, a moderate levelof expression was also observed in some tumors without amplification,and the level of expression was independent of tumor stage.The pattern of expression of TRK, LNGFR, and N-myc in tumorsidentified by mass screening was not significantly differentfrom that in tumors diagnosed because of clinical symptoms.
Age, Tumor Histology, and Pattern of Gene Expression
We analyzed the relation between the patient's age, the histologicgrade of differentiation, and the expression of TRK, LNGFR,S100-, and N-myc. The expression of S100- was considered a markerof Schwann cells, which are found frequently in differentiatedganglioneuroblastomas and ganglioneuromas41. Among the tumorsfrom infants (patients less than one year old), histologicallyundifferentiated neuroblastomas accounted for 88 percent oftumors (42 of 48), although almost all such tumors are curable.The TRK proto-oncogene was expressed strongly in 94 percent(45) of these tumors, whereas LNGFR was expressed strongly inonly 33 percent (16 tumors). Nevertheless, there was no correlationbetween the histologic grade of differentiation and the levelof expression of TRK, LNGFR, S100-, and N-myc in the infants.
In contrast, the proportion of histologically differentiatedganglioneuromas and ganglioneuroblastomas was higher (50 percent,or 17 of 34 tumors) among patients more than one year of age.The level of expression of LNGFR and S100- was high among differentiatedtumors (P = 0.012 and P<0.001, respectively), whereas thelevel of N-myc was high among undifferentiated tumors (P = 0.019).Interestingly, the level of expression of TRK did not correlatesignificantly with the histologic grade of differentiation (P>0.1).The five ganglioneuromas were obtained from patients more thanone year of age, and all expressed both LNGFR and S100- strongly,but they did not express N-myc.
Gene Expression and Survival
The cumulative-survival curves in the groups with high and lowlevels of expression of TRK and LNGFR, as well as amplificationand expression of N-myc, are shown in Figure 2. The expressionof TRK correlated strongly with survival (Figure 2A) (P<0.001):the five-year cumulative-survival rate of the group with a highlevel of TRK expression was 86 percent, whereas that of thegroup with a low level of TRK expression was 14 percent. N-mycamplification correlated significantly with poor survival (P<0.001)(Figure 2B). Although survival was significantly better whenthe level of expression of LNGFR was high (Figure 2C) and thatof the expression of N-myc was low (Figure 2D), the prognosticpower of these biologic variables was not as great as that ofTRK expression or N-myc amplification (see below).
Figure 2. Cumulative-Survival Curves of Patients with Neuroblastoma, According to Expression of TRK, LNGFR, and N-myc mRNA and N-myc Amplification.
The Kaplan-Meier curves show the probability of survival in terms of the level of expression of TRK, LNGFR, and N-myc and the N-myc copy number. High levels of mRNA expression were defined as values 100 density units, and low levels as values <100. The survival curves were analyzed by the Mantel-Haenszel log-rank test.
We analyzed survival according to the pattern of expressionof both TRK and LNGFR. The group with high levels of expressionof both TRK and LNGFR had the best five-year survival rate (92percent), and the group with low levels of expression of bothgenes had the worst (9 percent). However, neither high nor lowlevels of expression of LNGFR significantly influenced survivalafter correction for the expression of TRK (data not shown).Figure 3 shows the effect of the combination of TRK expressionand N-myc amplification on cumulative survival. The group withhigh levels of TRK expression and no N-myc amplification (62patients) had a cumulative five-year survival of 87 percent.Four patients whose tumors had a normal N-myc copy number hada low level of expression of TRK, and their survival was significantlyworse than that of the group with a high level of TRK expression(P = 0.03) (Figure 3). All 11 patients with N-myc amplificationhad low levels of expression of TRK except 1 patient (not shownin Figure 3), who had high levels of TRK expression. The tumorof this patient was regressing at the time of biopsy, but arecurrence was fatal25,52; all 11 of these patients died withintwo years after diagnosis.
Figure 3. Cumulative Survival According to Expression of TRK mRNA and N-myc Amplification Combined.
A patient with stage IVS neuroblastoma whose tumor had a high level of expression of TRK and N-myc amplification died 11 months after diagnosis52 and is not represented in this figure. Survival was significantly better in the group with high levels of TRK expression and no N-myc amplification than in the group with low levels of TRK expression and no N-myc amplification (P = 0.03) or the group with low levels of TRK expression and N-myc amplification (P<0.001). Survival was significantly better in the group with low levels of TRK expression and no N-myc amplification than in the group with low levels of TRK expression and N-myc amplification (P = 0.005).
We analyzed the effect on survival of the expression of TRK,LNGFR, and S100-, as compared with the effect of the patient'sage, tumor stage, primary tumor site, and tumor histology, aswell as amplification and expression of N-myc (Table 1). Onthe basis of this univariate analysis, N-myc amplification andTRK expression were significant factors (chi-square = 93.61and 51.30, respectively; P<0.001 for each), as were stageand age (chi-square = 23.30 and 21.67, respectively; P<0.001for each); tumor site, N-myc expression, and LNGFR expressionwere not as significant (Table 1). When outcome was adjustedfor the effect of N-myc amplification, TRK expression was nolonger significant among all the patients studied, but it didremain significant among the patients without N-myc amplification(chi-square = 4.56; P = 0.03); stage and age remained significant(Table 1), but after adjustment for stage no other factors hadprognostic value.
Table 1. Univariate and Multivariate Analysis of Clinical and Laboratory Variables and Survival in 77 Patients with Neuroblastomas.
Expression and Function of NGF Receptor in Primary Tumors
The above studies indicated that most neuroblastomas from patientswith a favorable prognosis (particularly infants) had high levelsof expression of both TRK and LNGFR. To determine whether theNGF-receptor pathway was functional in these tumors, we establishedprimary cultures of neuroblastomas from two such patients. Patient1 was a 14-month-old girl with a posterior mediastinal mass,and Patient 2 was a 2-month-old girl with an intrapelvic tumor.
The levels of TRK expression and LNGFR expression in tumor tissuefrom Patient 1 were 411 and 1260 density units, respectively,and the levels in tissue from Patient 2 were 1307 and 580 densityunits, respectively. The adherent tumor cells from Patient 1in medium containing NGF developed substantial neurite extensionby day 6, which reached a maximum on day 13, and the differentiatedcells survived more than one month (data not shown). However,in medium depleted of NGF some adherent cells extended a fewshort neurites, but all cells ultimately died within two weeksin vitro.
The primary tumor cells from Patient 2 responded to NGF morequickly. The NGF-treated cells showed numerous neurites by day2, which grew further by day 7, and these cells survived morethan 100 days. In addition, NGF induced the expression of theearly-response genes, FOS and NGFI-A, in these cells (Figure 4).However, tumor cells cultured in standard medium or in NGF-depletedmedium began dying after day 4, and all had died by day 14.The tumor cells grown in NGF-depleted medium died more rapidlythan those grown in standard medium.
Figure 4. Induction of the Expression of FOS and NGFI-A by NGF Treatment of Primary Culture Cells from Patient 2.
The patient's cells were cultured in the standard medium for 1 1/2 days before they were treated with NGF (100 ng per milliliter, incubated for 40 minutes at 37 °C). PC12 cells and NSH cells were treated as positive and negative controls, respectively.
Discussion
Neuroblastomas are derived from the sympathoadrenal progenitorsof the neural crest. The expression of the components of theNGF receptor in these progenitors, as well as their responsivenessto NGF, is developmentally regulated. The earliest progenitorsexpress neither component,53,54 but subsequently NGF receptoris expressed on migrating neural-crest cells55. Identifiablefetal sympathetic ganglia and adrenal medullary cells bind NGFwith high and low affinity and presumably express both TRK andLNGFR20,55,56,57,58,59. These cells soon become dependent onNGF for their survival, and they differentiate in its presence.However, complete neuronal differentiation may require additionalfactors53,54. Deprivation of neurotrophic factor may lead toprogrammed cell death at this stage60,61. Finally, cells thatundergo morphologic differentiation become relatively independentof NGF for their survival and will not die rapidly if it iswithdrawn61,62,63.
Our studies indicate that the level of TRK expression is highin the majority of neuroblastomas, particularly in those ofinfants and patients in the earlier stages of disease. In addition,a high level of TRK expression correlates strongly with a favorableoutcome. However, the pattern of expression of LNGFR and itsprognostic importance are less clear. The heterogeneity of expressionof TRK and LNGFR in neuroblastomas is consistent with the patternof expression in sympathoadrenal precursors, and it may reflectarrested differentiation at these stages, as suggested by otherinvestigators using different developmental markers64,65.
We observed several clear patterns of expression of neural-crest-relatedgenes that correlated with distinct histologic patterns andclinical behaviors of the tumors. At the end of the spectrumcontaining the most immature tumors were neuroblastomas withN-myc amplification. These tumors had high levels of N-myc butlow levels or no expression of TRK, LNGFR, and S100-, and theywere the most undifferentiated tumors histologically. Thesetumors are most likely to become established cell lines in vitro,and they appear to be neither responsive to NGF nor dependenton it for survival. They may mimic the most immature sympathoadrenalprecursors53,54.
The next group was made up of tumors without N-myc amplificationthat expressed TRK, usually with LNGFR. Characteristically,neuroblastomas in infants were undifferentiated histologically,but these tumors had the highest levels of TRK expression, usuallywith moderate levels of LNGFR expression. S100- expression usuallywas low or absent, a finding consistent with the paucity ofSchwann cells in these tumors. The level of N-myc expressionfrequently was high, especially in tumors of infants. Thesetumors probably express functional NGF receptors, which wouldmake at least some of them both dependent on NGF and responsiveto it. These conclusions are supported by our in vitro studies,in which the tumor cells responded to NGF by inducing early-responsegenes and by terminal differentiation in the sustained presenceof NGF. Furthermore, the cells died if NGF was absent or antiserumto NGF was present in the medium, probably as a result of programmedcell death triggered by deprivation of this neurotrophic factor60.
The end of the spectrum containing the most-differentiated tumorsis represented by ganglioneuromas, which were found exclusivelyin patients more than one year of age. These tumors were characterizedby high levels of expression of LNGFR and S100-, reflectingthe substantial Schwann-cell component. N-myc expression wasvery low or absent, and TRK expression was variable, perhapsreflecting the heterogeneity in the number of ganglion cellsin these tumors. The finding of ganglioneuromas exclusivelyin patients more than one year old may indicate that differentiationin vivo is a slower process or that other neurotrophic factorsare required.
A variety of other clinical and biologic variables have beenproposed as prognostic factors for neuroblastoma, includingcellular DNA content or chromosome number (ploidy) as a favorablemarker66,67,68,69,70 and N-myc amplification as a marker ofpoor outcome38,39,70,71,72,73. Since the level of TRK expressionwas high in infants with early-stage tumors, this may representa biologic mechanism that would explain the favorable behaviorof hyperdiploid tumors. Conversely, the virtual absence of TRKexpression in tumors with N-myc amplification25 may render thesecells unresponsive whether or not NGF is present.
Assessment of TRK expression and of N-myc copy number may providecomplementary prognostic information, which in turn may be helpfulin determining the most appropriate duration and intensity oftreatment. More important, both of these factors may have arole in the pathogenesis of neuroblastoma. Cells expressingfunctional NGF receptor may be susceptible to either programmedcell death leading to tumor regression, especially in infants,or to differentiation leading to a benign ganglioneuroma, especiallyin older children. Future therapeutic approaches may be aimedat activating or antagonizing the NGF-receptor pathway to inducedifferentiation or regression in these tumors. Tumors with N-mycamplification may be particularly aggressive because very highlevels of N-myc give them a growth advantage and may also blocktheir differentiation into NGF-dependent or NGF-responsive cells.Such a blockade would require some alternative approach to therapy.
Supported in part by grants (CA-49712, CA-39771, and CA-05587[to Dr. Brodeur]) from the National Cancer Institute, by a grant(to Dr. Nakagawara) from the National Cancer Institute-JapaneseFoundation of Cancer Research Cooperative Cancer Research Program,and by funds from the Ronald McDonald Children's Charities (toDr. Brodeur).
We are indebted to Drs. Keiichi Ikeda, Sachiyo Suita, HiroshiOhgami, Hideko Tasaka, Sumio Miyazaki, Yoshifumi Sera, HiroshiAkiyama, and Kiyoshi Kawakami (Kyushu Neuroblastoma Study Groupinstitutions), Dr. Takashi Yokoyama (Hiroshima University Hospital),Dr. Akira Kuwano (Yamaguchi University Hospital), Dr. KazuhiroKume (Matsuyama Red Cross Hospital), Drs. Paul Bowman, RandallCraver, Joseph Dickerman, Donald Fernbach, Vita Land, RuprechtNitchke, and Teresa Vietti (Pediatric Oncology Group institutions),and Dr. Audrey Evans (Children's Hospital of Philadelphia) forcontributing neuroblastoma samples for these studies; to HelenMarshall for technical assistance; and to Peter S. White, JillL. Hiemstra, and Richard B. Schuessler for advice.
Source Information
From the Department of Pediatrics, Washington University School of Medicine, St. Louis (A.N., M.A.-N., N.J.S., C.G.A., G.M.B.), the Pediatric Oncology Group Statistical Office, Gainesville, Fla. (A.B.C.), and the Pediatric Oncology Group, St. Louis (G.M.B., A.B.C.).
Address reprint requests to Dr. Brodeur at the Department of Pediatrics, Washington University School of Medicine, 1 Children's Place, St. Louis, MO 63110.
References
Bolande RP. The neurocristopathies: a unifying concept of disease arising in neural crest maldevelopment. Hum Pathol 1974;5:409-429. [CrossRef]
Goldstein MN, Burdman JA, Journey LJ. Long-term tissue culture of neuroblastomas. II. Morphologic evidence for differentiation and maturation. J Natl Cancer Inst 1964;32:165-199.
Bill AH, Seibert ES, Beckwith JB, Hartmann JR. Nerve growth factor and nerve growth-stimulating activity in sera from normal and neuroblastoma patients. J Natl Cancer Inst 1969;43:1221-1230.
Waris T, Rechardt L, Waris P. Differentiation of neuroblastoma cells induced by nerve growth factor in vitro. Experientia 1973;29:1128-1129. [CrossRef][Medline]
Sonnenfeld KH, Ishii DN. Nerve growth factor effects and receptors in cultured human neuroblastoma cell lines. J Neurosci Res 1982;8:375-391. [CrossRef][Medline]
Tischler AS, Slayton VW, Costopoulos DS, Leape LL, DeLellis RA, Wolfe HJ. Nerve growth factor may function as a survival factor for human neuroblastoma cells in culture. Cancer 1984;54:1344-1347. [Medline]
Sonnenfeld KH, Ishii DN. Fast and slow nerve growth factor binding sites in human neuroblastoma and rat pheochromocytoma cell lines: relationship of sites to each other and to neurite formation. J Neurosci 1985;5:1717-1728. [Abstract]
Marchetti D, Perez-Polo JR. Nerve growth factor receptors in human neuroblastoma cells. J Neurochem 1987;49:475-486. [CrossRef][Medline]
Haskell BE, Stach RW, Werrbach-Perez K, Perez-Polo JR. Effect of retinoic acid on nerve growth factor receptors. Cell Tissue Res 1987;247:67-73. [CrossRef][Medline]
Matsushima H, Bogenmann E. Nerve growth factor (NGF) induces neuronal differentiation in neuroblastoma cells transfected with the NGF receptor cDNA. Mol Cell Biol 1990;10:5015-5020. [Free Full Text]
Azar CG, Scavarda NJ, Reynolds CP, Brodeur GM. Multiple defects of the nerve growth factor receptor in human neuroblastomas. Cell Growth Differ 1990;1:421-428. [Abstract]
Reddy UR, Venkatakrishnan G, Roy AK, et al. Characterization of two neuroblastoma cell lines expressing recombinant nerve growth factor receptors. J Neurochem 1991;56:67-74. [CrossRef][Medline]
Sutter A, Riopelle RJ, Harris-Warrick RM, Shooter EM. Nerve growth factor receptors: characterization of two distinct classes of binding sites on chick embryo sensory ganglia cells. J Biol Chem 1979;254:5972-5982. [Free Full Text]
Green SH, Greene LA. A single Mr 103,000 125I--nerve growth factor-affinity-labeled species represents both the low and high affinity forms of the nerve growth factor receptor. J Biol Chem 1986;261:15316-15326. [Free Full Text]
Chao MV, Bothwell MA, Ross AH, et al. Gene transfer and molecular cloning of the human NGF receptor. Science 1986;232:518-521. [Free Full Text]
Radeke MJ, Misko TP, Hsu C, Herzenberg LA, Shooter EM. Gene transfer and molecular cloning of the rat nerve growth factor receptor. Nature 1987;325:593-597. [CrossRef][Medline]
Hempstead BL, Patil N, Olson K, Chao MV. Molecular analysis of the nerve growth factor receptor. Cold Spring Harb Symp Quant Biol 1988;53:477-485.
Ragsdale C, Woodgett J. trking Neurotrophic receptors. Nature 1991;350:660-661. [CrossRef][Medline]
Bothwell M. Keeping track of neurotrophin receptors. Cell 1991;65:915-918. [CrossRef][Medline]
Martin-Zanca D, Barbacid M, Parada LF. Expression of the trk proto-oncogene is restricted to the sensory cranial and spinal ganglia of neural crest origin in mouse development. Genes Dev 1990;4:683-694. [Free Full Text]
Hempstead BL, Martin-Zanca D, Kaplan DR, Parada LF, Chao MV. High-affinity NGF binding requires coexpression of the trk proto-oncogene and the low-affinity NGF receptor. Nature 1991;350:678-683. [CrossRef][Medline]
Klein R, Jing S, Nanduri V, O'Rourke E, Barbacid M. The trk proto-oncogene encodes a receptor for nerve growth factor. Cell 1991;65:189-197. [CrossRef][Medline]
Kaplan DR, Martin-Zanca D, Parada LF. Tyrosine phosphorylation and tyrosine kinase activity of the trk proto-oncogene product induced by NGF. Nature 1991;350:158-160. [CrossRef][Medline]
Kaplan DR, Hempstead BL, Martin-Zanca D, Chao MV, Parada LF. The trk proto-oncogene product: a signal transducing receptor for nerve growth factor. Science 1991;252:554-558. [Free Full Text]
Nakagawara A, Arima M, Azar CG, Scavarda NJ, Brodeur GM. Inverse relationship between trk expression and N-myc amplification in human neuroblastomas. Cancer Res 1992;52:1364-1368. [Free Full Text]
Takeda T. History and current status of neuroblastoma screening in Japan. Med Pediatr Oncol 1989;17:361-363. [Medline]
Ota K, Shimizu K. Histological classification and atlas of tumours in infancy and childhood: a report from the Committee on the Histological Classification of Childhood Tumours of the Japanese Pathological Society. Tokyo, Japan: Kanahara Publisher, 1980.
Evans AE, D'Angio GJ, Randolph JA. A proposed staging for children with neuroblastoma: children's cancer study group A. Cancer 1971;27:374-378. [CrossRef][Medline]
Nakagawara A, Zaizen Y, Ikeda K, et al. Different genomic and metabolic patterns between mass screening-positive and mass screening-negative later-presenting neuroblastomas. Cancer 1991;68:2037-2044. [CrossRef][Medline]
Green AA, Hayes FA, Hustu HO. Sequential cyclophosphamide and doxorubicin for induction of complete remission in children with disseminated neuroblastoma. Cancer 1981;48:2310-2317. [Medline]
Ikeda K, Nakagawara A, Yano H, et al. Improved survival rates in children over 1 year of age with stage III or IV neuroblastoma following an intensive chemotherapeutic regimen. J Pediatr Surg 1989;24:189-193. [Medline]
Bowman LC, Castleberry RP, Altshuler G, et al. Therapy based on DNA index (DI) for infants with unresectable and disseminated neuroblastoma (NB): preliminary results of the Pediatric Oncology Group "Better Risk" study. Med Pediatr Oncol 1990;18:364-364.abstract
Castleberry RP, Kun LE, Shuster JJ, et al. Radiotherapy improves the outlook for patients older than 1 year with Pediatric Oncology Group stage C neuroblastoma. J Clin Oncol 1991;9:789-795. [Abstract]
Nitschke R, Smith EI, Altshuler G, et al. Postoperative treatment of nonmetastatic visible residual neuroblastoma: a Pediatric Oncology Group study. J Clin Oncol 1991;9:1181-1188. [Abstract]
Graham-Pole J, Casper J, Elfenbein G, et al. High-dose chemoradiotherapy supported by marrow infusions for advanced neuroblastoma: a Pediatric Oncology Group study. J Clin Oncol 1991;9:152-158. [Erratum, J Clin Oncol 1991;9:1094.] [Free Full Text]
Reynolds CP, Tomayko MM, Donner L, et al. Biological classification of cell lines derived from human extra-cranial neural tumors. In: Evans AE, D'Angio GJ, Knudson AG, Seeger RC, eds. Advances in neuroblastoma research 2: proceedings of the Fourth Symposium on Advances in Neuroblastoma Research, Philadelphia, May 14-16, 1987. Vol. 271 of Progress in clinical and biological research. New York: Alan R. Liss, 1988:291-306.
Greene LA, Tischler AS. Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc Natl Acad Sci U S A 1976;73:2424-2428. [Free Full Text]
Brodeur GM, Seeger RC, Schwab M, Varmus HE, Bishop JM. Amplification of N-myc in untreated human neuroblastomas correlates with advanced disease stage. Science 1984;224:1121-1124. [Free Full Text]
Seeger RC, Brodeur GM, Sather H, et al. Association of multiple copies of the N-myc oncogene with rapid progression of neuroblastomas. N Engl J Med 1985;313:1111-1116. [Abstract]
Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156-159. [Medline]
Shimada H, Aoyama C, Chiba T, Newton WA Jr. Prognostic subgroups for undifferentiated neuroblastoma: immunohistochemical study with anti-S-100 protein antibody. Hum Pathol 1985;16:471-476. [CrossRef][Medline]
Saiki RK, Gelfand DH, Stoffel S, et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 1988;239:487-491. [Free Full Text]
Greenberg ME, Greene LA, Ziff EB. Nerve growth factor and epidermal growth factor induce rapid transient changes in proto-oncogene transcription in PC12 cells. J Biol Chem 1985;260:14101-14110. [Free Full Text]
Curran T, Morgan JI. Superinduction of c-fos by nerve growth factor in the presence of peripherally active benzodiazepines. Science 1985;229:1265-1268. [Free Full Text]
Milbrandt J. Nerve growth factor rapidly induces c-fos mRNA in PC12 rat pheochromocytoma cells. Proc Natl Acad Sci U S A 1986;83:4789-4793. [Free Full Text]
Milbrandt J. A nerve growth factor-induced gene encodes a possible transcriptional regulatory factor. Science 1987;238:797-799. [Free Full Text]
Feinberg AP, Vogelstein B. Addendum to: A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 1984;137:266-267. [CrossRef][Medline]
Ruit KG, Elliott JL, Osborne PA, Yan Q, Snider WD. Selective dependence of mammalian dorsal root ganglion neurons on nerve growth factor during embryonic development. Neuron 1992;8:573-587. [CrossRef][Medline]
Kaplan EL, Meier P. Nonparametric estimation from incomplete observations. J Am Stat Assoc 1958;53:457-81.
Mantel N. Evaluation of survival data and two new rank order statistics arising in its consideration. Cancer Chemother Rep 1966;50:163-170. [Medline]
Cox DR. Regression models and life-tables. J R Stat Soc [B] 1972;34:187-220.
Nakagawara A, Sasazuki T, Akiyama H, et al. N-myc oncogene and stage IV-S neuroblastoma: preliminary observations on ten cases. Cancer 1990;65:1960-1967. [CrossRef][Medline]
Stemple DL, Mahanthappa NK, Anderson DJ. Basic FGF induces neuronal differentiation, cell division, and NGF dependence in chromaffin cells: a sequence of events in sympathetic development. Neuron 1988;1:517-525. [CrossRef][Medline]
Birren SJ, Anderson DJ. A v-myc-immortalized sympathoadrenal progenitor cell line in which neuronal differentiation is initiated by FGF but not NGF. Neuron 1990;4:189-201. [CrossRef][Medline]
Heuer JG, Fatemie-Nainie S, Wheeler EF, Bothwell M. Structure and developmental expression of the chicken NGF receptor. Dev Biol 1990;137:287-304. [CrossRef][Medline]
Yan Q, Johnson EM Jr. A quantitative study of the developmental expression of nerve growth factor (NGF) receptor in rats. Dev Biol 1987;121:139-148. [CrossRef][Medline]
Yan Q, Johnson EM Jr. An immunohistochemical study of the nerve growth factor receptor in developing rats. J Neurosci 1988;8:3481-3498. [Abstract]
Baker DL, Molenaar WM, Trojanowski JQ, et al. Nerve growth factor receptor expression in peripheral and central neuroectodermal tumors, other pediatric brain tumors, and during development of the adrenal gland. Am J Pathol 1991;139:115-122. [Abstract]
Martin DP, Schmidt RE, DiStefano PS, Lowry OH, Carter JG, Johnson EM Jr. Inhibitors of protein synthesis and RNA synthesis prevent neuronal death caused by nerve growth factor deprivation. J Cell Biol 1988;106:829-844. [Free Full Text]
Koike T, Tanaka S. Evidence that nerve growth factor dependence of sympathetic neurons for survival in vitro may be determined by levels of cytoplasmic free Ca2+. Proc Natl Acad Sci U S A 1991;88:3892-3896. [Free Full Text]
Levi-Montalcini R. The nerve growth factor 35 years later. Science 1987;237:1154-1162. [Free Full Text]
Eichler ME, Rich KM. Death of sensory ganglion neurons after acute withdrawal of nerve growth factor in dissociated cell cultures. Brain Res 1989;482:340-346. [CrossRef][Medline]
Tsokos M, Scarpa S, Ross RA, Triche TJ. Differentiation of human neuroblastoma recapitulates neural crest development: study of morphology, neurotransmitter enzymes, and extracellular matrix proteins. Am J Pathol 1987;128:484-496. [Abstract]
Cooper MJ, Hutchins GM, Cohen PS, Helman LJ, Mennie RJ, Israel MA. Human neuroblastoma tumor cell lines correspond to the arrested differentiation of chromaffin adrenal medullary neuroblasts. Cell Growth Differ 1990;1:149-159. [Abstract]
Look AT, Hayes FA, Nitschke R, McWilliams NB, Green AA. Cellular DNA content as a predictor of response to chemotherapy in infants with unresectable neuroblastoma. N Engl J Med 1984;311:231-235. [Abstract]
Hayashi Y, Hanada R, Yamamoto K, Bessho F. Chromosome findings and prognosis in neuroblastoma. Cancer Genet Cytogenet 1987;29:175-177. [Medline]
Kaneko Y, Kanda N, Maseki N, et al. Different karyotypic patterns in early and advanced stage neuroblastomas. Cancer Res 1987;47:311-318. [Free Full Text]
Taylor SR, Blatt J, Costantino JP, Roederer M, Murphy RF. Flow cytometric DNA analysis of neuroblastoma and ganglioneuroma: a 10-year retrospective study. Cancer 1988;62:749-754. [CrossRef][Medline]
Look AT, Hayes FA, Shuster JJ, et al. Clinical relevance of tumor cell ploidy and N-myc gene amplification in childhood neuroblastoma: a Pediatric Oncology Group study. J Clin Oncol 1991;9:581-591. [Abstract]
Bartram CR, Berthold F. Amplification and expression of the N-myc gene in neuroblastoma. Eur J Pediatr 1987;146:162-165. [CrossRef][Medline]
Nakagawara A, Ikeda K, Tsuda T, Higashi K. N-myc oncogene amplification and prognostic factors of neuroblastoma in children. J Pediatr Surg 1987;22:895-898. [Medline]
Slavc I, Ellenbogen R, Jung W-H, et al. myc Gene amplification and expression in primary human neuroblastoma. Cancer Res 1990;50:1459-1463. [Free Full Text]
Reiff, T., Tsarovina, K., Majdazari, A., Schmidt, M., del Pino, I., Rohrer, H.
(2010). Neuroblastoma Phox2b Variants Stimulate Proliferation and Dedifferentiation of Immature Sympathetic Neurons. J. Neurosci.
30: 905-915
[Abstract][Full Text]
Thiele, C. J., Li, Z., McKee, A. E.
(2009). On Trk--The TrkB Signal Transduction Pathway Is an Increasingly Important Target in Cancer Biology. Clin. Cancer Res.
15: 5962-5967
[Abstract][Full Text]
Vasudevan, S. A., Shang, X., Chang, S., Ge, N., Diaz-Miron, J. L., Russell, H. V., Hicks, M. J., Ludwig, A. D., Wesson, C. L., Burlingame, S. M., Kim, E. S., Khan, J., Yang, J., Nuchtern, J. G.
(2009). Neuroblastoma-derived secretory protein is a novel secreted factor overexpressed in neuroblastoma. Molecular Cancer Therapeutics
8: 2478-2489
[Abstract][Full Text]
Brodeur, G. M., Minturn, J. E., Ho, R., Simpson, A. M., Iyer, R., Varela, C. R., Light, J. E., Kolla, V., Evans, A. E.
(2009). Trk Receptor Expression and Inhibition in Neuroblastomas. Clin. Cancer Res.
15: 3244-3250
[Abstract][Full Text]
Li, Z., Beutel, G., Rhein, M., Meyer, J., Koenecke, C., Neumann, T., Yang, M., Krauter, J., von Neuhoff, N., Heuser, M., Diedrich, H., Gohring, G., Wilkens, L., Schlegelberger, B., Ganser, A., Baum, C.
(2009). High-affinity neurotrophin receptors and ligands promote leukemogenesis. Blood
113: 2028-2037
[Abstract][Full Text]
Caporali, A., Emanueli, C.
(2009). Cardiovascular Actions of Neurotrophins. Physiol. Rev.
89: 279-308
[Abstract][Full Text]
Yagyu, S., Gotoh, T., Iehara, T., Miyachi, M., Katsumi, Y., Tsubai-Shimizu, S., Kikuchi, K., Tamura, S., Tsuchiya, K., Imamura, T., Misawa-Furihata, A., Sugimoto, T., Sawada, T., Hosoi, H.
(2008). Circulating Methylated-DCR2 Gene in Serum as an Indicator of Prognosis and Therapeutic Efficacy in Patients with MYCN Nonamplified Neuroblastoma. Clin. Cancer Res.
14: 7011-7019
[Abstract][Full Text]
Oberthuer, A., Kaderali, L., Kahlert, Y., Hero, B., Westermann, F., Berthold, F., Brors, B., Eils, R., Fischer, M.
(2008). Subclassification and Individual Survival Time Prediction from Gene Expression Data of Neuroblastoma Patients by Using CASPAR. Clin. Cancer Res.
14: 6590-6601
[Abstract][Full Text]
Hsu, W.-M., Lee, H., Juan, H.-F., Shih, Y.-Y., Wang, B.-J., Pan, C.-Y., Jeng, Y.-M., Chang, H.-H., Lu, M.-Y., Lin, K.-H., Lai, H.-S., Chen, W.-J., Tsay, Y.-G., Liao, Y.-F., Hsieh, F.-J.
(2008). Identification of GRP75 as an Independent Favorable Prognostic Marker of Neuroblastoma by a Proteomics Analysis. Clin. Cancer Res.
14: 6237-6245
[Abstract][Full Text]
Munirajan, A. K., Ando, K., Mukai, A., Takahashi, M., Suenaga, Y., Ohira, M., Koda, T., Hirota, T., Ozaki, T., Nakagawara, A.
(2008). KIF1B{beta} Functions as a Haploinsufficient Tumor Suppressor Gene Mapped to Chromosome 1p36.2 by Inducing Apoptotic Cell Death. J. Biol. Chem.
283: 24426-24434
[Abstract][Full Text]
Molenaar, J. J., Ebus, M. E., Koster, J., Sluis, P. v., van Noesel, C. J.M., Versteeg, R., Caron, H. N.
(2008). Cyclin D1 and CDK4 Activity Contribute to the Undifferentiated Phenotype in Neuroblastoma. Cancer Res.
68: 2599-2609
[Abstract][Full Text]
Ikegaki, N., Gotoh, T., Kung, B., Riceberg, J. S., Kim, D. Y., Zhao, H., Rappaport, E. F., Hicks, S. L., Seeger, R. C., Tang, X. X.
(2007). De novo Identification of MIZ-1 (ZBTB17) Encoding a MYC-Interacting Zinc-Finger Protein as a New Favorable Neuroblastoma Gene. Clin. Cancer Res.
13: 6001-6009
[Abstract][Full Text]
Schramm, A., Vandesompele, J., Schulte, J. H., Dreesmann, S., Kaderali, L., Brors, B., Eils, R., Speleman, F., Eggert, A.
(2007). Translating Expression Profiling into a Clinically Feasible Test to Predict Neuroblastoma Outcome. Clin. Cancer Res.
13: 1459-1465
[Abstract][Full Text]
Oberthuer, A., Berthold, F., Warnat, P., Hero, B., Kahlert, Y., Spitz, R., Ernestus, K., Konig, R., Haas, S., Eils, R., Schwab, M., Brors, B., Westermann, F., Fischer, M.
(2006). Customized Oligonucleotide Microarray Gene Expression-Based Classification of Neuroblastoma Patients Outperforms Current Clinical Risk Stratification. JCO
24: 5070-5078
[Abstract][Full Text]
Asgharzadeh, S., Pique-Regi, R., Sposto, R., Wang, H., Yang, Y., Shimada, H., Matthay, K., Buckley, J., Ortega, A., Seeger, R. C.
(2006). Prognostic Significance of Gene Expression Profiles of Metastatic Neuroblastomas Lacking MYCN Gene Amplification.. JNCI J Natl Cancer Inst
98: 1193-1203
[Abstract][Full Text]
Nakamura, K., Martin, K. C., Jackson, J. K., Beppu, K., Woo, C.-W., Thiele, C. J.
(2006). Brain-Derived Neurotrophic Factor Activation of TrkB Induces Vascular Endothelial Growth Factor Expression via Hypoxia-Inducible Factor-1{alpha} in Neuroblastoma Cells.. Cancer Res.
66: 4249-4255
[Abstract][Full Text]
Haber, M., Smith, J., Bordow, S. B., Flemming, C., Cohn, S. L., London, W. B., Marshall, G. M., Norris, M. D.
(2006). Association of High-Level MRP1 Expression With Poor Clinical Outcome in a Large Prospective Study of Primary Neuroblastoma. JCO
24: 1546-1553
[Abstract][Full Text]
Tang, X. X., Zhao, H., Kung, B., Kim, D. Y., Hicks, S. L., Cohn, S. L., Cheung, N.-K., Seeger, R. C., Evans, A. E., Ikegaki, N.
(2006). The MYCN Enigma: Significance of MYCN Expression in Neuroblastoma.. Cancer Res.
66: 2826-2833
[Abstract][Full Text]
Ho, R., Minturn, J. E., Hishiki, T., Zhao, H., Wang, Q., Cnaan, A., Maris, J., Evans, A. E., Brodeur, G. M.
(2005). Proliferation of Human Neuroblastomas Mediated by the Epidermal Growth Factor Receptor. Cancer Res.
65: 9868-9875
[Abstract][Full Text]
George, R. E., London, W. B., Cohn, S. L., Maris, J. M., Kretschmar, C., Diller, L., Brodeur, G. M., Castleberry, R. P., Look, A. T.
(2005). Hyperdiploidy Plus Nonamplified MYCN Confers a Favorable Prognosis in Children 12 to 18 Months Old With Disseminated Neuroblastoma: A Pediatric Oncology Group Study. JCO
23: 6466-6473
[Abstract][Full Text]
Lavoie, J.-F., LeSauteur, L., Kohn, J., Wong, J., Furtoss, O., Thiele, C. J., Miller, F. D., Kaplan, D. R.
(2005). TrkA Induces Apoptosis of Neuroblastoma Cells and Does So via a p53-dependent Mechanism. J. Biol. Chem.
280: 29199-29207
[Abstract][Full Text]
Parran, D. K., Barker, A., Ehrich, M.
(2005). Effects of Thimerosal on NGF Signal Transduction and Cell Death in Neuroblastoma Cells. Toxicol Sci
86: 132-140
[Abstract][Full Text]
Osajima-Hakomori, Y., Miyake, I., Ohira, M., Nakagawara, A., Nakagawa, A., Sakai, R.
(2005). Biological Role of Anaplastic Lymphoma Kinase in Neuroblastoma. Am. J. Pathol.
167: 213-222
[Abstract][Full Text]
Aoyama, M., Ozaki, T., Inuzuka, H., Tomotsune, D., Hirato, J., Okamoto, Y., Tokita, H., Ohira, M., Nakagawara, A.
(2005). LMO3 Interacts with Neuronal Transcription Factor, HEN2, and Acts as an Oncogene in Neuroblastoma. Cancer Res.
65: 4587-4597
[Abstract][Full Text]
Terui, E., Matsunaga, T., Yoshida, H., Kouchi, K., Kuroda, H., Hishiki, T., Saito, T., Yamada, S.-i., Shirasawa, H., Ohnuma, N.
(2005). Shc Family Expression in Neuroblastoma: High Expression of shcC Is Associated with a Poor Prognosis in Advanced Neuroblastoma. Clin. Cancer Res.
11: 3280-3287
[Abstract][Full Text]
Sitek, B., Apostolov, O., Stuhler, K., Pfeiffer, K., Meyer, H. E., Eggert, A., Schramm, A.
(2005). Identification of Dynamic Proteome Changes Upon Ligand Activation of Trk-Receptors Using Two-dimensional Fluorescence Difference Gel Electrophoresis and Mass Spectrometry. Mol. Cell. Proteomics
4: 291-299
[Abstract][Full Text]
Hsu, W. M., Hsieh, F. J., Jeng, Y. M., Kuo, M. L., Chen, C. N., Lai, D. M., Hsieh, L. J., Wang, B. T., Tsao, P. N., Lee, H., Lin, M. T., Lai, H. S., Chen, W. J.
(2005). Calreticulin expression in neuroblastoma--a novel independent prognostic factor. Ann Oncol
16: 314-321
[Abstract][Full Text]
Abe, M., Ohira, M., Kaneda, A., Yagi, Y., Yamamoto, S., Kitano, Y., Takato, T., Nakagawara, A., Ushijima, T.
(2005). CpG Island Methylator Phenotype Is a Strong Determinant of Poor Prognosis in Neuroblastomas. Cancer Res.
65: 828-834
[Abstract][Full Text]
Hienonen, T, Sammalkorpi, H, Isohanni, P, Versteeg, R, Karikoski, R, Aaltonen, L A
(2005). A 17p11.2 germline deletion in a patient with Smith-Magenis syndrome and neuroblastoma. J. Med. Genet.
42: e3-e3
[Full Text]
Uccini, S., Mannarino, O., McDowell, H. P., Pauser, U., Vitali, R., Natali, P. G., Altavista, P., Andreano, T., Coco, S., Boldrini, R., Bosco, S., Clerico, A., Cozzi, D., Donfrancesco, A., Inserra, A., Kokai, G., Losty, P. D., Nicotra, M. R., Raschella, G., Tonini, G. P., Dominici, C.
(2005). Clinical and Molecular Evidence for c-kit Receptor as a Therapeutic Target in Neuroblastic Tumors. Clin. Cancer Res.
11: 380-389
[Abstract][Full Text]
Roberts, S. S., Mori, M., Pattee, P., Lapidus, J., Mathews, R., O'Malley, J. P., Hsieh, Y. C., Turner, M. A., Wang, Z., Tian, Q., Rodland, M. J., Reynolds, C. P., Seeger, R. C., Nagalla, S. R.
(2004). GABAergic System Gene Expression Predicts Clinical Outcome in Patients With Neuroblastoma. JCO
22: 4127-4134
[Abstract][Full Text]
Wei, J. S., Greer, B. T., Westermann, F., Steinberg, S. M., Son, C.-G., Chen, Q.-R., Whiteford, C. C., Bilke, S., Krasnoselsky, A. L., Cenacchi, N., Catchpoole, D., Berthold, F., Schwab, M., Khan, J.
(2004). Prediction of Clinical Outcome Using Gene Expression Profiling and Artificial Neural Networks for Patients with Neuroblastoma. Cancer Res.
64: 6883-6891
[Abstract][Full Text]
Tang, X. X., Robinson, M. E., Riceberg, J. S., Kim, D. Y., Kung, B., Titus, T. B., Hayashi, S., Flake, A. W., Carpentieri, D., Ikegaki, N.
(2004). Favorable Neuroblastoma Genes and Molecular Therapeutics of Neuroblastoma. Clin. Cancer Res.
10: 5837-5844
[Abstract][Full Text]
Hansford, L. M., Thomas, W. D., Keating, J. M., Burkhart, C. A., Peaston, A. E., Norris, M. D., Haber, M., Armati, P. J., Weiss, W. A., Marshall, G. M.
(2004). Mechanisms of embryonal tumor initiation: Distinct roles for MycN expression and MYCN amplification. Proc. Natl. Acad. Sci. USA
101: 12664-12669
[Abstract][Full Text]
Irshad, S., Pedley, R. B., Anderson, J., Latchman, D. S., Budhram-Mahadeo, V.
(2004). The Brn-3b Transcription Factor Regulates the Growth, Behavior, and Invasiveness of Human Neuroblastoma Cells in Vitro and in Vivo. J. Biol. Chem.
279: 21617-21627
[Abstract][Full Text]
Liu, Y., Encinas, M., Comella, J. X., Aldea, M., Gallego, C.
(2004). Basic Helix-Loop-Helix Proteins Bind to TrkB and p21Cip1 Promoters Linking Differentiation and Cell Cycle Arrest in Neuroblastoma Cells. Mol. Cell. Biol.
24: 2662-2672
[Abstract][Full Text]
Weber, A., Huesken, C., Bergmann, E., Kiess, W., Christiansen, N. M., Christiansen, H.
(2003). Coexpression of Insulin Receptor-Related Receptor and Insulin-Like Growth Factor 1 Receptor Correlates with Enhanced Apoptosis and Dedifferentiation in Human Neuroblastomas. Clin. Cancer Res.
9: 5683-5692
[Abstract][Full Text]
Tokiwa, K., Fumino, S., Ono, S., Iwai, N.
(2003). Results of Retroperitoneal Lymphadenectomy in the Treatment of Abdominal Neuroblastoma. Arch Surg
138: 711-715
[Abstract][Full Text]
Weinstein, J. L., Katzenstein, H. M., Cohn, S. L.
(2003). Advances in the Diagnosis and Treatment of Neuroblastoma. The Oncologist
8: 278-292
[Abstract][Full Text]
Saito-Ohara, F., Imoto, I., Inoue, J., Hosoi, H., Nakagawara, A., Sugimoto, T., Inazawa, J.
(2003). PPM1D Is a Potential Target for 17q Gain in Neuroblastoma. Cancer Res.
63: 1876-1883
[Abstract][Full Text]
Chlenski, A., Liu, S., Crawford, S. E., Volpert, O. V., DeVries, G. H., Evangelista, A., Yang, Q., Salwen, H. R., Farrer, R., Bray, J., Cohn, S. L.
(2002). SPARC Is a Key Schwannian-derived Inhibitor Controlling Neuroblastoma Tumor Angiogenesis. Cancer Res.
62: 7357-7363
[Abstract][Full Text]
Ho, R., Eggert, A., Hishiki, T., Minturn, J. E., Ikegaki, N., Foster, P., Camoratto, A. M., Evans, A. E., Brodeur, G. M.
(2002). Resistance to Chemotherapy Mediated by TrkB in Neuroblastomas. Cancer Res.
62: 6462-6466
[Abstract][Full Text]
Jaboin, J., Kim, C. J., Kaplan, D. R., Thiele, C. J.
(2002). Brain-derived Neurotrophic Factor Activation of TrkB Protects Neuroblastoma Cells from Chemotherapy-induced Apoptosis via Phosphatidylinositol 3'-Kinase Pathway. Cancer Res.
62: 6756-6763
[Abstract][Full Text]
Kitanaka, C., Kato, K., Ijiri, R., Sakurada, K., Tomiyama, A., Noguchi, K., Nagashima, Y., Nakagawara, A., Momoi, T., Toyoda, Y., Kigasawa, H., Nishi, T., Shirouzu, M., Yokoyama, S., Tanaka, Y., Kuchino, Y.
(2002). Increased Ras Expression and Caspase-Independent Neuroblastoma Cell Death: Possible Mechanism of Spontaneous Neuroblastoma Regression. JNCI J Natl Cancer Inst
94: 358-368
[Abstract][Full Text]
Eggert, A., Grotzer, M. A., Ikegaki, N., Liu, X.-g., Evans, A. E., Brodeur, G. M.
(2002). Expression of the Neurotrophin Receptor TrkA Down-Regulates Expression and Function of Angiogenic Stimulators in SH-SY5Y Neuroblastoma Cells. Cancer Res.
62: 1802-1808
[Abstract][Full Text]
Bown, N
(2001). Neuroblastoma tumour genetics: clinical and biological aspects. J. Clin. Pathol.
54: 897-910
[Abstract][Full Text]
Eggert, A., Grotzer, M. A., Ikegaki, N., Zhao, H., Cnaan, A., Brodeur, G. M., Evans, A. E.
(2001). Expression of the Neurotrophin Receptor TrkB Is Associated With Unfavorable Outcome in Wilms' Tumor. JCO
19: 689-696
[Abstract][Full Text]
Edsjö, A., Hallberg, B., Fagerström, S., Larsson, C., Axelson, H., Påhlman, S.
(2001). Differences in Early and Late Responses between Neurotrophin-stimulated trkA- and trkC-transfected SH-SY5Y Neuroblastoma Cells. Cell Growth Differ.
12: 39-50
[Abstract][Full Text]
Matthay, K. K.
(2000). MYCN Expression in Neuroblastoma: A Mixed Message?. JCO
18: 3591-3594
[Full Text]
Cohn, S. L., London, W. B., Huang, D., Katzenstein, H. M., Salwen, H. R., Reinhart, T., Madafiglio, J., Marshall, G. M., Norris, M. D., Haber, M.
(2000). MYCN Expression Is Not Prognostic of Adverse Outcome in Advanced-Stage Neuroblastoma With Nonamplified MYCN. JCO
18: 3604-3613
[Abstract][Full Text]
Huang, D., Rutkowski, J. L., Brodeur, G. M., Chou, P. M., Kwiatkowski, J. L., Babbo, A., Cohn, S. L.
(2000). Schwann Cell-conditioned Medium Inhibits Angiogenesis. Cancer Res.
60: 5966-5971
[Abstract][Full Text]
Matsunaga, T., Shirasawa, H., Hishiki, T., Yoshida, H., Kouchi, K., Ohtsuka, Y., Kawamura, K., Etoh, T., Ohnuma, N.
(2000). Enhanced Expression of N-myc Messenger RNA in Neuroblastomas Found by Mass Screening. Clin. Cancer Res.
6: 3199-3204
[Abstract][Full Text]
Eggert, A., Ikegaki, N., Kwiatkowski, J., Zhao, H., Brodeur, G. M., Himelstein, B. P.
(2000). High-Level Expression of Angiogenic Factors Is Associated with Advanced Tumor Stage in Human Neuroblastomas. Clin. Cancer Res.
6: 1900-1908
[Abstract][Full Text]
Sarkar, A. K., Nuchtern, J. G.
(2000). Lysis of MYCN-amplified Neuroblastoma Cells by MYCN Peptide-specific Cytotoxic T Lymphocytes. Cancer Res.
60: 1908-1913
[Abstract][Full Text]
Grotzer, M. A., Janss, A. J., Fung, K.-M., Biegel, J. A., Sutton, L. N., Rorke, L. B., Zhao, H., Cnaan, A., Phillips, P. C., Lee, V. M.-Y., Trojanowski, J. Q.
(2000). TrkC Expression Predicts Good Clinical Outcome in Primitive Neuroectodermal Brain Tumors. JCO
18: 1027-1027
[Abstract][Full Text]
Evans, A. E., Kisselbach, K. D., Yamashiro, D. J., Ikegaki, N., Camoratto, A. M., Dionne, C. A., Brodeur, G. M.
(1999). Antitumor Activity of CEP-751 (KT-6587) on Human Neuroblastoma and Medulloblastoma Xenografts. Clin. Cancer Res.
5: 3594-3602
[Abstract][Full Text]
Maris, J. M., Matthay, K. K.
(1999). Molecular Biology of Neuroblastoma. JCO
17: 2264-2264
[Abstract][Full Text]
Packer, R. J., Cogen, P., Vezina, G., Rorke, L. B.
(1999). Medulloblastoma: Clinical and biologic aspects. Neuro Oncology
1: 232-250
[Abstract]
Cohn, S. L.
(1999). Diagnosis and Classification of the Small Round-Cell Tumors of Childhood. Am. J. Pathol.
155: 11-15
[Full Text]
Bown, N., Cotterill, S., Lastowska, M., O'Neill, S., Pearson, A. D.J., Plantaz, D., Meddeb, M., Danglot, G., Brinkschmidt, C., Christiansen, H., Laureys, G., Speleman, F., Nicholson, J., Bernheim, A., Betts, D. R., Vandesompele, J., Van Roy, N.
(1999). Gain of Chromosome Arm 17q and Adverse Outcome in Patients with Neuroblastoma. NEJM
340: 1954-1961
[Abstract][Full Text]
Middlemas, D. S., Kihl, B. K., Zhou, J., Zhu, X.
(1999). Brain-derived Neurotrophic Factor Promotes Survival and Chemoprotection of Human Neuroblastoma Cells. J. Biol. Chem.
274: 16451-16460
[Abstract][Full Text]
Tang, X. X., Evans, A. E., Zhao, H., Cnaan, A., London, W., Cohn, S. L., Brodeur, G. M., Ikegaki, N.
(1999). High-Level Expression of EPHB6, EFNB2, and EFNB3 Is Associated with Low Tumor Stage and High TrkA Expression in Human Neuroblastomas. Clin. Cancer Res.
5: 1491-1496
[Abstract][Full Text]
McGregor, L. M., McCune, B. K., Graff, J. R., McDowell, P. R., Romans, K. E., Yancopoulos, G. D., Ball, D. W., Baylin, S. B., Nelkin, B. D.
(1999). Roles of trk family neurotrophin receptors in medullary thyroid carcinoma development and progression. Proc. Natl. Acad. Sci. USA
96: 4540-4545
[Abstract][Full Text]
Hiyama, E., Hiyama, K., Yokoyama, T., Fukuba, I., Yamaoka, H., Shay, J. W., Matsuura, Y.
(1999). Rapid Detection of MYCN Gene Amplification and Telomerase Expression in Neuroblastoma. Clin. Cancer Res.
5: 601-609
[Abstract][Full Text]
Ross, J. A., Davies, S. M.
(1999). Screening for Neuroblastoma: Progress and Pitfalls. Cancer Epidemiol. Biomarkers Prev.
8: 189-194
[Full Text]
Beglova, N., LeSauteur, L., Ekiel, I., Saragovi, H. U., Gehring, K.
(1998). Solution Structure and Internal Motion of a Bioactive Peptide Derived from Nerve Growth Factor. J. Biol. Chem.
273: 23652-23658
[Abstract][Full Text]
Missale, C., Codignola, A., Sigala, S., Finardi, A., Paez-Pereda, M., Sher, E., Spano, P.
(1998). Nerve growth factor abrogates the tumorigenicity of human small cell lung cancer cell lines. Proc. Natl. Acad. Sci. USA
95: 5366-5371
[Abstract][Full Text]
Chang, B. B., Persengiev, S. P., de Diego, J. G., Sacristan, M. P., Zanca, D. M., Kilpatrick, D. L.
(1998). Proximal Promoter Sequences Mediate Cell-specific and Elevated Expression of the Favorable Prognosis Marker TrkA in Human Neuroblastoma Cells. J. Biol. Chem.
273: 39-44
[Abstract][Full Text]
Poluha, W., Schonhoff, C. M., Harrington, K. S., Lachyankar, M. B., Crosbie, N. E., Bulseco, D. A., Ross, A. H.
(1997). A Novel, Nerve Growth Factor-activated Pathway Involving Nitric Oxide, p53, and p21WAF1 Regulates Neuronal Differentiation of PC12 Cells. J. Biol. Chem.
272: 24002-24007
[Abstract][Full Text]
Gaetano, C., Matsuo, T., Thiele, C. J.
(1997). Identification and Characterization of a Retinoic Acid-regulated Human Homologue of the unc-33-like Phosphoprotein Gene (hUlip) from Neuroblastoma Cells. J. Biol. Chem.
272: 12195-12201
[Abstract][Full Text]
Muragaki, Y., Chou, T. T., Kaplan, D. R., Trojanowski, J. Q., Lee, V. M.-Y.
(1997). Nerve Growth Factor Induces Apoptosis in Human Medulloblastoma Cell Lines that Express TrkA Receptors. J. Neurosci.
17: 530-542
[Abstract][Full Text]
Cortazzo, M. H., Kassis, E. S., Sproul, K. A., Schor, N. F.
(1996). Nerve Growth Factor (NGF)-Mediated Protection of Neural Crest Cells from Antimitotic Agent-Induced Apoptosis: The Role of the Low-Affinity NGF Receptor. J. Neurosci.
16: 3895-3899
[Abstract][Full Text]
Brodeur, G. M.
(1996). Schwann Cells as Antineuroblastoma Agents. NEJM
334: 1537-1539
[Full Text]
Norris, M. D., Bordow, S. B., Marshall, G. M., Haber, P. S., Cohn, S. L., Haber, M.
(1996). Expression of the Gene for Multidrug-Resistance-Associated Protein and Outcome in Patients with Neuroblastoma. NEJM
334: 231-238
[Abstract][Full Text]
Kovacina, K. S., Roth, R. A.
(1995). Characterization of the Endogenous Insulin Receptor-related Receptor in Neuroblastomas. J. Biol. Chem.
270: 1881-1887
[Abstract][Full Text]
Chou, T. T., Trojanowski, J. Q., Lee, V. M.-Y.
(2001). p38 Mitogen-activated Protein Kinase-independent Induction of gadd45 Expression in Nerve Growth Factor-induced Apoptosis in Medulloblastomas. J. Biol. Chem.
276: 41120-41127
[Abstract][Full Text]
Manohar, C. F., Short, M. L., Nguyen, A., Nguyen, N. N., Chagnovich, D., Yang, Q., Cohn, S. L.
(2002). HuD, a Neuronal-specific RNA-binding Protein, Increases the in Vivo Stability of MYCN RNA. J. Biol. Chem.
277: 1967-1973
[Abstract][Full Text]
Tang, X. X., Zhao, H., Robinson, M. E., Cohen, B., Cnaan, A., London, W., Cohn, S. L., Cheung, N.-K. V., Brodeur, G. M., Evans, A. E., Ikegaki, N.
(2000). Implications of EPHB6, EFNB2, and EFNB3 expressions in human neuroblastoma. Proc. Natl. Acad. Sci. USA
97: 10936-10941
[Abstract][Full Text]
1 year), normal N-myc copy number, and low level of N-myc expression. N-myc amplification (indicated by a high copy number) correlated with advanced tumor stage, older age, an adrenal site of the primary tumor, low level of expression of TRK, and high level of expression of N-myc. Analysis of five-year cumulative-survival rates demonstrated an association of a very favorable outcome with a high level of TRK expression (86 percent vs. 14 percent) and with normal N-myc copy number (84 percent vs. 0 percent). Univariate analysis showed that these two variables were the most powerful predictors of outcome (chi-square = 51.30, P<0.001; and chi-square = 93.61, P<0.001, respectively). TRK expression still had significant prognostic value when the analysis was restricted to tumors without N-myc amplification. In primary cultures of neuroblastoma cells expressing TRK, exposure to nerve growth factor induced early gene expression and neurite outgrowth, but deprivation of nerve growth factor led to neuronal cell death. 
-actin, and quantitated in arbitrary density units25. For some analyses, the tumors were grouped into those with a low level of expression (<100 density units) and those with a high level (
103,000 125I-
Previous
