The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
Original Article
PreviousPrevious
Volume 328:847-854 March 25, 1993 Number 12
NextNext

Association between High Levels of Expression of the TRK Gene and Favorable Outcome in Human Neuroblastoma
Akira Nakagawara, Miwako Arima-Nakagawara, Nancy J. Scavarda, Christopher G. Azar, Alan B. Cantor, and Garrett M. Brodeur

 

This Article
-Abstract

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation
ABSTRACT

Background and Methods The nerve growth factor receptor is expressed in some neuroblastomas, in which its primary component is encoded by the TRK proto-oncogene. To determine the relation of the expression of TRK messenger RNA in neuroblastomas to other clinical and laboratory variables, we studied frozen tumor samples from 77 patients. In addition, we tested two primary neuroblastomas that expressed TRK for responsiveness to nerve growth factor.

Results TRK expression strongly correlated with favorable tumor stage (I, II, and IVS vs. III and IV), younger age (<1 year vs. >= 1 year), normal N-myc copy number, and low level of N-myc expression. N-myc amplification (indicated by a high copy number) correlated with advanced tumor stage, older age, an adrenal site of the primary tumor, low level of expression of TRK, and high level of expression of N-myc. Analysis of five-year cumulative-survival rates demonstrated an association of a very favorable outcome with a high level of TRK expression (86 percent vs. 14 percent) and with normal N-myc copy number (84 percent vs. 0 percent). Univariate analysis showed that these two variables were the most powerful predictors of outcome (chi-square = 51.30, P<0.001; and chi-square = 93.61, P<0.001, respectively). TRK expression still had significant prognostic value when the analysis was restricted to tumors without N-myc amplification. In primary cultures of neuroblastoma cells expressing TRK, exposure to nerve growth factor induced early gene expression and neurite outgrowth, but deprivation of nerve growth factor led to neuronal cell death.

Conclusions A high level of expression of the TRK proto-oncogene in a neuroblastoma is strongly predictive of a favorable outcome. A tumor with a functional nerve growth factor receptor may be dependent on the neurotrophin nerve growth factor for survival and may regress in its absence, allowing a new approach to the treatment of certain patients with neuroblastoma. .


Neuroblastoma is one of the most common malignant tumors among children, yet the prognosis of patients with advanced disease is still very poor. The tumor originates from the sympathoadrenal lineage of the neural crest1. The ability to differentiate both in vivo and in vitro is one of the most interesting characteristics of neuroblastomas, and this differentiation may involve the interaction between the neurotrophin nerve growth factor (NGF) and its receptor2,3,4,5,6,7,8,9,10,11,12. Morphologic differentiation induced by NGF has been observed in a limited number of primary cultures of neuroblastoma,4,6 but most neuroblastoma cell lines are unresponsive to NGF5,8,10,11,12. In a previous study, we found multiple defects of expression and function of a component of the NGF receptor in neuroblastoma cell lines,11 but the role of the NGF-receptor pathway in the pathogenesis of neuroblastomas has been uncertain.

There are two classes of NGF receptors that bind NGF with either high or low affinity13,14. The low-affinity NGF-receptor (LNGFR) gene encodes a transmembrane protein, which is glycosylated so that it yields a protein of about 75 kd (p75LNGFR)15,16. However, no known biologic responses are mediated solely by the LNGFR17. The high-affinity NGF receptor appears to be a heteromeric complex that includes p75LNGFR and p140 proto-TRK, the product of the proto-oncogene TRK (also known as TRKA)18,19. This transmembrane glycoprotein is a tyrosine kinase that is expressed selectively in the developing nervous system20. The biologic responsiveness to NGF depends on interactions with p140proto-TRK, but at present it is unclear whether this protein exerts full biologic activity alone or acts as part of a high-affinity receptor21,22,23,24.

TRK is expressed in many primary neuroblastomas and is associated inversely with amplification of the N-myc proto-oncogene25. We studied the expression of TRK and LNGFR and attempted to relate the expression of these genes to clinical and biologic variables, to assess the importance of the expression of NGF receptors in neuroblastomas. In addition, we tested the function of the NGF receptor in vitro in primary neuroblastomas that expressed TRK. We found that TRK expression is a powerful prognostic marker that identifies a favorable group of tumors. We also found that NGF induces terminal neuronal differentiation in these cells, but that deprivation of NGF leads to neuronal cell death.

Methods

Patients and Therapy

We studied tumors from 77 children with neuroblastomas that had been diagnosed in Japan and the United States from 1982 to 199125. Sixty-three patients were identified at Kyushu Neuroblastoma Study Group institutions and cooperative hospitals in Japan; the tumors of 27 of these patients were found during a mass screening program for neuroblastoma26. Thirteen patients were identified at Washington University in St. Louis or at other institutions of the Pediatric Oncology Group, and one was identified elsewhere25. The selection of tumors for study was based solely on the availability of a sufficient amount of tumor tissue from which to prepare DNA and messenger RNA (mRNA) for the analyses described below.

All diagnoses of neuroblastoma were confirmed by histologic assessment of a tumor specimen obtained at surgery. The histologic features of the tumors were classified as described previously27. There were 59 neuroblastomas and 18 ganglioneuroblastomas, all of which were considered neuroblastomas in these analyses. The tumors were staged according to the system of Evans et al28. Twenty patients (13 identified by mass screening) had stage I tumors, 14 (9 identified by mass screening) had stage II tumors, 15 (5 identified by mass screening) had stage III tumors, 16 had stage IV tumors, and 12 had stage IVS tumors. In addition to the tumors from the 77 patients, ganglioneuromas from 5 patients were included as differentiated tumors in the comparison of gene expression with tumor histology, but these patients were not included in the survival analysis.

Patients were treated according to previously described protocols29,30,31,32,33,34,35. Despite differences between the protocols for treating the Japanese patients and those for treating the patients studied by the Pediatric Oncology Group, the drugs and doses used in the protocols were quite similar, and the stage-specific survival rates of the two groups did not differ significantly (data not shown). The median follow-up period after diagnosis was 36 months (range, 8 to 116). None of the patients underwent bone marrow transplantation.

Tumor Specimens and Cell Lines

Sixty of the 77 neuroblastoma samples were obtained from untreated patients. Fifteen Japanese patients with advanced disease received one or two courses of chemotherapy before tumor removal. Two tumor samples were obtained from metastases (a lymph node and a liver nodule), and the rest were obtained from the primary tumors. The tumor tissues were immediately frozen and stored at -70 °C until used. Three human neuroblastoma cell lines -- SK-N-SH (NSH), SH-SY5Y (SY5Y), and NMB -- as well as a rat pheochromocytoma line, PC12, have been described previously36,37 and were grown as described25.

Southern and Northern Blot Analyses

The Nu-myc copy number was determined by Southern blot analysis38,39. A normal N-myc copy number is defined as 1 copy per haploid genome (i.e., 2 per cell); a copy number above 3 per haploid genome was considered to indicate N-myc amplification, but most tumors with such amplification had 50 to 100 copies or more38,39. Total RNA was extracted from 0.5 to 1.0 g of frozen tumor tissue or cultured cells40. Expression of TRK, LNGFR, S100, and N-myc mRNA was measured by Northern blot analysis, normalized to the level of expression of {beta}-actin, and quantitated in arbitrary density units25. For some analyses, the tumors were grouped into those with a low level of expression (<100 density units) and those with a high level (>= 100 density units).

The following probes were gifts: the TRK probe from Luis Parada,23 the LNGFR probe from Moses Chao,15 and the N-myc probe from J. Michael Bishop38. Expression of S100-{beta} was used as a marker for Schwann cells41. The S100-{beta} probe was prepared by polymerase-chain-reaction (PCR) amplification and subcloning, based on a published sequence42. PCR amplification with total human DNA as a template resulted in a 778-base-pair fragment (primers, 5'TCAAAGAGCAGGAGGTTGTG3' and 5'GACTTGAATCGCATGGGTCA3'). To assess the function of the NGF receptor in primary cultures, we measured the induction of expression of the early-response genes FOS43,44,45 and NGFI-A46. All probes were labeled by means of the random-hexamer primer technique47.

Primary Culture of Neuroblastoma

Tumor cells were dissociated from tumor tissue obtained at surgery6. Aliquots of cells in collagen-coated wells were divided into three groups: a control group (in standard medium), an NGF-treated group (with 100 ng of mouse NGF per milliliter), and an NGF-depleted group (with 40 units of anti-NGF antiserum per milliliter). The NGF and antiserum48 were provided by Eugene M. Johnson. The cells were grown at 37 °C, and the culture medium was changed every two or three days. For the studies of expression, the cells were grown in standard medium for 36 hours, treated with NGF for 40 minutes, and then immediately harvested, frozen, and stored at -70 °C for analysis.

Statistical Analysis

Statistical analyses were performed at the Pediatric Oncology Group Statistical Office with SAS software. Associations between pairs of categorical variables were assessed with Pearson's chi-square statistic. The continuous variables of groups were compared by the Wilcoxon rank-sum test. Survival probabilities in various subgroups were estimated according to the method of Kaplan and Meier49. Survival of groups was compared by log-rank tests,50 with adjustment for N-myc amplification by Cox regression51.

Results

Expression of TRK, LNGFR, and N-myc

Expression of TRK mRNA was detected in 70 of the 77 neuroblastomas (91 percent), and LNGFR was expressed in 67 (87 percent) (Figure 1). However, a high level of expression (>= 100 density units) of TRK was observed in 82 percent (63 tumors), but comparable levels of LNGFR expression were found only in 36 percent (28 tumors). The median level of TRK expression in tumors in stages I, II, and IVS was 1544 density units (46 tumors), whereas that in tumors in stages III and IV was 402 density units (31 tumors)(P<0.001) (Figure 1A). Eleven tumors with N-myc amplification had an extremely low median level of TRK expression (0 density units), as compared with tumors without amplification (1352 density units; P = 0.003). When tumors with N-myc amplification were excluded, there was still a significant difference between the two tumor-stage groups in the level of TRK expression (P = 0.016).


View larger version (23K):
[in this window]
[in a new window]
 
Figure 1. Densitometric Analysis of Expression of TRK and LNGFR in mRNA in Tumor Samples from 77 Patients with Neuroblastomas, According to Tumor Stage and N-myc Copy Number.

The levels of expression of TRK and LNGFR were normalized to that of {beta}-actin and measured in arbitrary density units. Horizontal lines represent group means. Diamonds represent patients identified by mass screening; squares, patients from whom samples were obtained at recurrence; and circles, all other patients, including those who have died (solid circles).

 
The median level of LNGFR expression was 22 density units in stage I, II and IVS tumors (46 tumors) and 7 density units in stage III and IV tumors (31 tumors) (Figure 1B). The tendency of stage I, II, and IVS tumors to have higher levels of LNGFR expression only approached significance (P = 0.076). Tumors with N-myc amplification showed low levels of LNGFR expression, as compared with tumors without amplification (median, 3 density units [11 tumors] vs. 15 density units [66 tumors]; P<0.001). The expression of TRK in the reference neuroblastoma cell lines NSH, SY5Y, and NMB was 21, 110, and 0 density units, respectively, and the expression of LNGFR was 7, 6, and 0 density units, respectively (data not shown). N-myc was expressed at very high levels in all tumors with N-myc amplification (median level in 11 tumors with amplification vs. median in 66 without amplification, 940 vs. 10 density units; P<0.001). However, a moderate level of expression was also observed in some tumors without amplification, and the level of expression was independent of tumor stage. The pattern of expression of TRK, LNGFR, and N-myc in tumors identified by mass screening was not significantly different from that in tumors diagnosed because of clinical symptoms.

Age, Tumor Histology, and Pattern of Gene Expression

We analyzed the relation between the patient's age, the histologic grade of differentiation, and the expression of TRK, LNGFR, S100-{beta}, and N-myc. The expression of S100-{beta} was considered a marker of Schwann cells, which are found frequently in differentiated ganglioneuroblastomas and ganglioneuromas41. Among the tumors from infants (patients less than one year old), histologically undifferentiated neuroblastomas accounted for 88 percent of tumors (42 of 48), although almost all such tumors are curable. The TRK proto-oncogene was expressed strongly in 94 percent (45) of these tumors, whereas LNGFR was expressed strongly in only 33 percent (16 tumors). Nevertheless, there was no correlation between the histologic grade of differentiation and the level of expression of TRK, LNGFR, S100-{beta}, and N-myc in the infants.

In contrast, the proportion of histologically differentiated ganglioneuromas and ganglioneuroblastomas was higher (50 percent, or 17 of 34 tumors) among patients more than one year of age. The level of expression of LNGFR and S100-{beta} was high among differentiated tumors (P = 0.012 and P<0.001, respectively), whereas the level of N-myc was high among undifferentiated tumors (P = 0.019). Interestingly, the level of expression of TRK did not correlate significantly with the histologic grade of differentiation (P>0.1). The five ganglioneuromas were obtained from patients more than one year of age, and all expressed both LNGFR and S100-{beta} strongly, but they did not express N-myc.

Gene Expression and Survival

The cumulative-survival curves in the groups with high and low levels of expression of TRK and LNGFR, as well as amplification and expression of N-myc, are shown in Figure 2. The expression of TRK correlated strongly with survival (Figure 2A) (P<0.001): the five-year cumulative-survival rate of the group with a high level of TRK expression was 86 percent, whereas that of the group with a low level of TRK expression was 14 percent. N-myc amplification correlated significantly with poor survival (P<0.001) (Figure 2B). Although survival was significantly better when the level of expression of LNGFR was high (Figure 2C) and that of the expression of N-myc was low (Figure 2D), the prognostic power of these biologic variables was not as great as that of TRK expression or N-myc amplification (see below).


View larger version (35K):
[in this window]
[in a new window]
 
Figure 2. Cumulative-Survival Curves of Patients with Neuroblastoma, According to Expression of TRK, LNGFR, and N-myc mRNA and N-myc Amplification.

The Kaplan-Meier curves show the probability of survival in terms of the level of expression of TRK, LNGFR, and N-myc and the N-myc copy number. High levels of mRNA expression were defined as values >= 100 density units, and low levels as values <100. The survival curves were analyzed by the Mantel-Haenszel log-rank test.

 
We analyzed survival according to the pattern of expression of both TRK and LNGFR. The group with high levels of expression of both TRK and LNGFR had the best five-year survival rate (92 percent), and the group with low levels of expression of both genes had the worst (9 percent). However, neither high nor low levels of expression of LNGFR significantly influenced survival after correction for the expression of TRK (data not shown). Figure 3 shows the effect of the combination of TRK expression and N-myc amplification on cumulative survival. The group with high levels of TRK expression and no N-myc amplification (62 patients) had a cumulative five-year survival of 87 percent. Four patients whose tumors had a normal N-myc copy number had a low level of expression of TRK, and their survival was significantly worse than that of the group with a high level of TRK expression (P = 0.03) (Figure 3). All 11 patients with N-myc amplification had low levels of expression of TRK except 1 patient (not shown in Figure 3), who had high levels of TRK expression. The tumor of this patient was regressing at the time of biopsy, but a recurrence was fatal25,52; all 11 of these patients died within two years after diagnosis.


View larger version (23K):
[in this window]
[in a new window]
 
Figure 3. Cumulative Survival According to Expression of TRK mRNA and N-myc Amplification Combined.

A patient with stage IVS neuroblastoma whose tumor had a high level of expression of TRK and N-myc amplification died 11 months after diagnosis52 and is not represented in this figure. Survival was significantly better in the group with high levels of TRK expression and no N-myc amplification than in the group with low levels of TRK expression and no N-myc amplification (P = 0.03) or the group with low levels of TRK expression and N-myc amplification (P<0.001). Survival was significantly better in the group with low levels of TRK expression and no N-myc amplification than in the group with low levels of TRK expression and N-myc amplification (P = 0.005).

 
We analyzed the effect on survival of the expression of TRK, LNGFR, and S100-{beta}, as compared with the effect of the patient's age, tumor stage, primary tumor site, and tumor histology, as well as amplification and expression of N-myc (Table 1). On the basis of this univariate analysis, N-myc amplification and TRK expression were significant factors (chi-square = 93.61 and 51.30, respectively; P<0.001 for each), as were stage and age (chi-square = 23.30 and 21.67, respectively; P<0.001 for each); tumor site, N-myc expression, and LNGFR expression were not as significant (Table 1). When outcome was adjusted for the effect of N-myc amplification, TRK expression was no longer significant among all the patients studied, but it did remain significant among the patients without N-myc amplification (chi-square = 4.56; P = 0.03); stage and age remained significant (Table 1), but after adjustment for stage no other factors had prognostic value.

View this table:
[in this window]
[in a new window]
 
Table 1. Univariate and Multivariate Analysis of Clinical and Laboratory Variables and Survival in 77 Patients with Neuroblastomas.

 
Expression and Function of NGF Receptor in Primary Tumors

The above studies indicated that most neuroblastomas from patients with a favorable prognosis (particularly infants) had high levels of expression of both TRK and LNGFR. To determine whether the NGF-receptor pathway was functional in these tumors, we established primary cultures of neuroblastomas from two such patients. Patient 1 was a 14-month-old girl with a posterior mediastinal mass, and Patient 2 was a 2-month-old girl with an intrapelvic tumor.

The levels of TRK expression and LNGFR expression in tumor tissue from Patient 1 were 411 and 1260 density units, respectively, and the levels in tissue from Patient 2 were 1307 and 580 density units, respectively. The adherent tumor cells from Patient 1 in medium containing NGF developed substantial neurite extension by day 6, which reached a maximum on day 13, and the differentiated cells survived more than one month (data not shown). However, in medium depleted of NGF some adherent cells extended a few short neurites, but all cells ultimately died within two weeks in vitro.

The primary tumor cells from Patient 2 responded to NGF more quickly. The NGF-treated cells showed numerous neurites by day 2, which grew further by day 7, and these cells survived more than 100 days. In addition, NGF induced the expression of the early-response genes, FOS and NGFI-A, in these cells (Figure 4). However, tumor cells cultured in standard medium or in NGF-depleted medium began dying after day 4, and all had died by day 14. The tumor cells grown in NGF-depleted medium died more rapidly than those grown in standard medium.


View larger version (34K):
[in this window]
[in a new window]
 
Figure 4. Induction of the Expression of FOS and NGFI-A by NGF Treatment of Primary Culture Cells from Patient 2.

The patient's cells were cultured in the standard medium for 1 1/2 days before they were treated with NGF (100 ng per milliliter, incubated for 40 minutes at 37 °C). PC12 cells and NSH cells were treated as positive and negative controls, respectively.

 
Discussion

Neuroblastomas are derived from the sympathoadrenal progenitors of the neural crest. The expression of the components of the NGF receptor in these progenitors, as well as their responsiveness to NGF, is developmentally regulated. The earliest progenitors express neither component,53,54 but subsequently NGF receptor is expressed on migrating neural-crest cells55. Identifiable fetal sympathetic ganglia and adrenal medullary cells bind NGF with high and low affinity and presumably express both TRK and LNGFR20,55,56,57,58,59. These cells soon become dependent on NGF for their survival, and they differentiate in its presence. However, complete neuronal differentiation may require additional factors53,54. Deprivation of neurotrophic factor may lead to programmed cell death at this stage60,61. Finally, cells that undergo morphologic differentiation become relatively independent of NGF for their survival and will not die rapidly if it is withdrawn61,62,63.

Our studies indicate that the level of TRK expression is high in the majority of neuroblastomas, particularly in those of infants and patients in the earlier stages of disease. In addition, a high level of TRK expression correlates strongly with a favorable outcome. However, the pattern of expression of LNGFR and its prognostic importance are less clear. The heterogeneity of expression of TRK and LNGFR in neuroblastomas is consistent with the pattern of expression in sympathoadrenal precursors, and it may reflect arrested differentiation at these stages, as suggested by other investigators using different developmental markers64,65.

We observed several clear patterns of expression of neural-crest-related genes that correlated with distinct histologic patterns and clinical behaviors of the tumors. At the end of the spectrum containing the most immature tumors were neuroblastomas with N-myc amplification. These tumors had high levels of N-myc but low levels or no expression of TRK, LNGFR, and S100-{beta}, and they were the most undifferentiated tumors histologically. These tumors are most likely to become established cell lines in vitro, and they appear to be neither responsive to NGF nor dependent on it for survival. They may mimic the most immature sympathoadrenal precursors53,54.

The next group was made up of tumors without N-myc amplification that expressed TRK, usually with LNGFR. Characteristically, neuroblastomas in infants were undifferentiated histologically, but these tumors had the highest levels of TRK expression, usually with moderate levels of LNGFR expression. S100-{beta} expression usually was low or absent, a finding consistent with the paucity of Schwann cells in these tumors. The level of N-myc expression frequently was high, especially in tumors of infants. These tumors probably express functional NGF receptors, which would make at least some of them both dependent on NGF and responsive to it. These conclusions are supported by our in vitro studies, in which the tumor cells responded to NGF by inducing early-response genes and by terminal differentiation in the sustained presence of NGF. Furthermore, the cells died if NGF was absent or antiserum to NGF was present in the medium, probably as a result of programmed cell death triggered by deprivation of this neurotrophic factor60.

The end of the spectrum containing the most-differentiated tumors is represented by ganglioneuromas, which were found exclusively in patients more than one year of age. These tumors were characterized by high levels of expression of LNGFR and S100-{beta}, reflecting the substantial Schwann-cell component. N-myc expression was very low or absent, and TRK expression was variable, perhaps reflecting the heterogeneity in the number of ganglion cells in these tumors. The finding of ganglioneuromas exclusively in patients more than one year old may indicate that differentiation in vivo is a slower process or that other neurotrophic factors are required.

A variety of other clinical and biologic variables have been proposed as prognostic factors for neuroblastoma, including cellular DNA content or chromosome number (ploidy) as a favorable marker66,67,68,69,70 and N-myc amplification as a marker of poor outcome38,39,70,71,72,73. Since the level of TRK expression was high in infants with early-stage tumors, this may represent a biologic mechanism that would explain the favorable behavior of hyperdiploid tumors. Conversely, the virtual absence of TRK expression in tumors with N-myc amplification25 may render these cells unresponsive whether or not NGF is present.

Assessment of TRK expression and of N-myc copy number may provide complementary prognostic information, which in turn may be helpful in determining the most appropriate duration and intensity of treatment. More important, both of these factors may have a role in the pathogenesis of neuroblastoma. Cells expressing functional NGF receptor may be susceptible to either programmed cell death leading to tumor regression, especially in infants, or to differentiation leading to a benign ganglioneuroma, especially in older children. Future therapeutic approaches may be aimed at activating or antagonizing the NGF-receptor pathway to induce differentiation or regression in these tumors. Tumors with N-myc amplification may be particularly aggressive because very high levels of N-myc give them a growth advantage and may also block their differentiation into NGF-dependent or NGF-responsive cells. Such a blockade would require some alternative approach to therapy.

Supported in part by grants (CA-49712, CA-39771, and CA-05587 [to Dr. Brodeur]) from the National Cancer Institute, by a grant (to Dr. Nakagawara) from the National Cancer Institute-Japanese Foundation of Cancer Research Cooperative Cancer Research Program, and by funds from the Ronald McDonald Children's Charities (to Dr. Brodeur).

We are indebted to Drs. Keiichi Ikeda, Sachiyo Suita, Hiroshi Ohgami, Hideko Tasaka, Sumio Miyazaki, Yoshifumi Sera, Hiroshi Akiyama, and Kiyoshi Kawakami (Kyushu Neuroblastoma Study Group institutions), Dr. Takashi Yokoyama (Hiroshima University Hospital), Dr. Akira Kuwano (Yamaguchi University Hospital), Dr. Kazuhiro Kume (Matsuyama Red Cross Hospital), Drs. Paul Bowman, Randall Craver, Joseph Dickerman, Donald Fernbach, Vita Land, Ruprecht Nitchke, and Teresa Vietti (Pediatric Oncology Group institutions), and Dr. Audrey Evans (Children's Hospital of Philadelphia) for contributing neuroblastoma samples for these studies; to Helen Marshall for technical assistance; and to Peter S. White, Jill L. Hiemstra, and Richard B. Schuessler for advice.


Source Information

From the Department of Pediatrics, Washington University School of Medicine, St. Louis (A.N., M.A.-N., N.J.S., C.G.A., G.M.B.), the Pediatric Oncology Group Statistical Office, Gainesville, Fla. (A.B.C.), and the Pediatric Oncology Group, St. Louis (G.M.B., A.B.C.).

Address reprint requests to Dr. Brodeur at the Department of Pediatrics, Washington University School of Medicine, 1 Children's Place, St. Louis, MO 63110.

References

  1. Bolande RP. The neurocristopathies: a unifying concept of disease arising in neural crest maldevelopment. Hum Pathol 1974;5:409-429. [CrossRef]
  2. Goldstein MN, Burdman JA, Journey LJ. Long-term tissue culture of neuroblastomas. II. Morphologic evidence for differentiation and maturation. J Natl Cancer Inst 1964;32:165-199.
  3. Bill AH, Seibert ES, Beckwith JB, Hartmann JR. Nerve growth factor and nerve growth-stimulating activity in sera from normal and neuroblastoma patients. J Natl Cancer Inst 1969;43:1221-1230.
  4. Waris T, Rechardt L, Waris P. Differentiation of neuroblastoma cells induced by nerve growth factor in vitro. Experientia 1973;29:1128-1129. [CrossRef][Medline]
  5. Sonnenfeld KH, Ishii DN. Nerve growth factor effects and receptors in cultured human neuroblastoma cell lines. J Neurosci Res 1982;8:375-391. [CrossRef][Medline]
  6. Tischler AS, Slayton VW, Costopoulos DS, Leape LL, DeLellis RA, Wolfe HJ. Nerve growth factor may function as a survival factor for human neuroblastoma cells in culture. Cancer 1984;54:1344-1347. [Medline]
  7. Sonnenfeld KH, Ishii DN. Fast and slow nerve growth factor binding sites in human neuroblastoma and rat pheochromocytoma cell lines: relationship of sites to each other and to neurite formation. J Neurosci 1985;5:1717-1728. [Abstract]
  8. Marchetti D, Perez-Polo JR. Nerve growth factor receptors in human neuroblastoma cells. J Neurochem 1987;49:475-486. [CrossRef][Medline]
  9. Haskell BE, Stach RW, Werrbach-Perez K, Perez-Polo JR. Effect of retinoic acid on nerve growth factor receptors. Cell Tissue Res 1987;247:67-73. [CrossRef][Medline]
  10. Matsushima H, Bogenmann E. Nerve growth factor (NGF) induces neuronal differentiation in neuroblastoma cells transfected with the NGF receptor cDNA. Mol Cell Biol 1990;10:5015-5020. [Free Full Text]
  11. Azar CG, Scavarda NJ, Reynolds CP, Brodeur GM. Multiple defects of the nerve growth factor receptor in human neuroblastomas. Cell Growth Differ 1990;1:421-428. [Abstract]
  12. Reddy UR, Venkatakrishnan G, Roy AK, et al. Characterization of two neuroblastoma cell lines expressing recombinant nerve growth factor receptors. J Neurochem 1991;56:67-74. [CrossRef][Medline]
  13. Sutter A, Riopelle RJ, Harris-Warrick RM, Shooter EM. Nerve growth factor receptors: characterization of two distinct classes of binding sites on chick embryo sensory ganglia cells. J Biol Chem 1979;254:5972-5982. [Free Full Text]
  14. Green SH, Greene LA. A single Mr <= 103,000 125I-{beta}-nerve growth factor-affinity-labeled species represents both the low and high affinity forms of the nerve growth factor receptor. J Biol Chem 1986;261:15316-15326. [Free Full Text]
  15. Chao MV, Bothwell MA, Ross AH, et al. Gene transfer and molecular cloning of the human NGF receptor. Science 1986;232:518-521. [Free Full Text]
  16. Radeke MJ, Misko TP, Hsu C, Herzenberg LA, Shooter EM. Gene transfer and molecular cloning of the rat nerve growth factor receptor. Nature 1987;325:593-597. [CrossRef][Medline]
  17. Hempstead BL, Patil N, Olson K, Chao MV. Molecular analysis of the nerve growth factor receptor. Cold Spring Harb Symp Quant Biol 1988;53:477-485.
  18. Ragsdale C, Woodgett J. trking Neurotrophic receptors. Nature 1991;350:660-661. [CrossRef][Medline]
  19. Bothwell M. Keeping track of neurotrophin receptors. Cell 1991;65:915-918. [CrossRef][Medline]
  20. Martin-Zanca D, Barbacid M, Parada LF. Expression of the trk proto-oncogene is restricted to the sensory cranial and spinal ganglia of neural crest origin in mouse development. Genes Dev 1990;4:683-694. [Free Full Text]
  21. Hempstead BL, Martin-Zanca D, Kaplan DR, Parada LF, Chao MV. High-affinity NGF binding requires coexpression of the trk proto-oncogene and the low-affinity NGF receptor. Nature 1991;350:678-683. [CrossRef][Medline]
  22. Klein R, Jing S, Nanduri V, O'Rourke E, Barbacid M. The trk proto-oncogene encodes a receptor for nerve growth factor. Cell 1991;65:189-197. [CrossRef][Medline]
  23. Kaplan DR, Martin-Zanca D, Parada LF. Tyrosine phosphorylation and tyrosine kinase activity of the trk proto-oncogene product induced by NGF. Nature 1991;350:158-160. [CrossRef][Medline]
  24. Kaplan DR, Hempstead BL, Martin-Zanca D, Chao MV, Parada LF. The trk proto-oncogene product: a signal transducing receptor for nerve growth factor. Science 1991;252:554-558. [Free Full Text]
  25. Nakagawara A, Arima M, Azar CG, Scavarda NJ, Brodeur GM. Inverse relationship between trk expression and N-myc amplification in human neuroblastomas. Cancer Res 1992;52:1364-1368. [Free Full Text]
  26. Takeda T. History and current status of neuroblastoma screening in Japan. Med Pediatr Oncol 1989;17:361-363. [Medline]
  27. Ota K, Shimizu K. Histological classification and atlas of tumours in infancy and childhood: a report from the Committee on the Histological Classification of Childhood Tumours of the Japanese Pathological Society. Tokyo, Japan: Kanahara Publisher, 1980.
  28. Evans AE, D'Angio GJ, Randolph JA. A proposed staging for children with neuroblastoma: children's cancer study group A. Cancer 1971;27:374-378. [CrossRef][Medline]
  29. Nakagawara A, Zaizen Y, Ikeda K, et al. Different genomic and metabolic patterns between mass screening-positive and mass screening-negative later-presenting neuroblastomas. Cancer 1991;68:2037-2044. [CrossRef][Medline]
  30. Green AA, Hayes FA, Hustu HO. Sequential cyclophosphamide and doxorubicin for induction of complete remission in children with disseminated neuroblastoma. Cancer 1981;48:2310-2317. [Medline]
  31. Ikeda K, Nakagawara A, Yano H, et al. Improved survival rates in children over 1 year of age with stage III or IV neuroblastoma following an intensive chemotherapeutic regimen. J Pediatr Surg 1989;24:189-193. [Medline]
  32. Bowman LC, Castleberry RP, Altshuler G, et al. Therapy based on DNA index (DI) for infants with unresectable and disseminated neuroblastoma (NB): preliminary results of the Pediatric Oncology Group "Better Risk" study. Med Pediatr Oncol 1990;18:364-364.abstract 
  33. Castleberry RP, Kun LE, Shuster JJ, et al. Radiotherapy improves the outlook for patients older than 1 year with Pediatric Oncology Group stage C neuroblastoma. J Clin Oncol 1991;9:789-795. [Abstract]
  34. Nitschke R, Smith EI, Altshuler G, et al. Postoperative treatment of nonmetastatic visible residual neuroblastoma: a Pediatric Oncology Group study. J Clin Oncol 1991;9:1181-1188. [Abstract]
  35. Graham-Pole J, Casper J, Elfenbein G, et al. High-dose chemoradiotherapy supported by marrow infusions for advanced neuroblastoma: a Pediatric Oncology Group study. J Clin Oncol 1991;9:152-158. [Erratum, J Clin Oncol 1991;9:1094.] [Free Full Text]
  36. Reynolds CP, Tomayko MM, Donner L, et al. Biological classification of cell lines derived from human extra-cranial neural tumors. In: Evans AE, D'Angio GJ, Knudson AG, Seeger RC, eds. Advances in neuroblastoma research 2: proceedings of the Fourth Symposium on Advances in Neuroblastoma Research, Philadelphia, May 14-16, 1987. Vol. 271 of Progress in clinical and biological research. New York: Alan R. Liss, 1988:291-306.
  37. Greene LA, Tischler AS. Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor. Proc Natl Acad Sci U S A 1976;73:2424-2428. [Free Full Text]
  38. Brodeur GM, Seeger RC, Schwab M, Varmus HE, Bishop JM. Amplification of N-myc in untreated human neuroblastomas correlates with advanced disease stage. Science 1984;224:1121-1124. [Free Full Text]
  39. Seeger RC, Brodeur GM, Sather H, et al. Association of multiple copies of the N-myc oncogene with rapid progression of neuroblastomas. N Engl J Med 1985;313:1111-1116. [Abstract]
  40. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156-159. [Medline]
  41. Shimada H, Aoyama C, Chiba T, Newton WA Jr. Prognostic subgroups for undifferentiated neuroblastoma: immunohistochemical study with anti-S-100 protein antibody. Hum Pathol 1985;16:471-476. [CrossRef][Medline]
  42. Saiki RK, Gelfand DH, Stoffel S, et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 1988;239:487-491. [Free Full Text]
  43. Greenberg ME, Greene LA, Ziff EB. Nerve growth factor and epidermal growth factor induce rapid transient changes in proto-oncogene transcription in PC12 cells. J Biol Chem 1985;260:14101-14110. [Free Full Text]
  44. Curran T, Morgan JI. Superinduction of c-fos by nerve growth factor in the presence of peripherally active benzodiazepines. Science 1985;229:1265-1268. [Free Full Text]
  45. Milbrandt J. Nerve growth factor rapidly induces c-fos mRNA in PC12 rat pheochromocytoma cells. Proc Natl Acad Sci U S A 1986;83:4789-4793. [Free Full Text]
  46. Milbrandt J. A nerve growth factor-induced gene encodes a possible transcriptional regulatory factor. Science 1987;238:797-799. [Free Full Text]
  47. Feinberg AP, Vogelstein B. Addendum to: A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity. Anal Biochem 1984;137:266-267. [CrossRef][Medline]
  48. Ruit KG, Elliott JL, Osborne PA, Yan Q, Snider WD. Selective dependence of mammalian dorsal root ganglion neurons on nerve growth factor during embryonic development. Neuron 1992;8:573-587. [CrossRef][Medline]
  49. Kaplan EL, Meier P. Nonparametric estimation from incomplete observations. J Am Stat Assoc 1958;53:457-81.
  50. Mantel N. Evaluation of survival data and two new rank order statistics arising in its consideration. Cancer Chemother Rep 1966;50:163-170. [Medline]
  51. Cox DR. Regression models and life-tables. J R Stat Soc [B] 1972;34:187-220.
  52. Nakagawara A, Sasazuki T, Akiyama H, et al. N-myc oncogene and stage IV-S neuroblastoma: preliminary observations on ten cases. Cancer 1990;65:1960-1967. [CrossRef][Medline]
  53. Stemple DL, Mahanthappa NK, Anderson DJ. Basic FGF induces neuronal differentiation, cell division, and NGF dependence in chromaffin cells: a sequence of events in sympathetic development. Neuron 1988;1:517-525. [CrossRef][Medline]
  54. Birren SJ, Anderson DJ. A v-myc-immortalized sympathoadrenal progenitor cell line in which neuronal differentiation is initiated by FGF but not NGF. Neuron 1990;4:189-201. [CrossRef][Medline]
  55. Heuer JG, Fatemie-Nainie S, Wheeler EF, Bothwell M. Structure and developmental expression of the chicken NGF receptor. Dev Biol 1990;137:287-304. [CrossRef][Medline]
  56. Godfrey EW, Shooter EM. Nerve growth factor receptors on chick embryo sympathetic ganglion cells: binding characteristics and development. J Neurosci 1986;6:2543-2550. [Abstract]
  57. Yan Q, Johnson EM Jr. A quantitative study of the developmental expression of nerve growth factor (NGF) receptor in rats. Dev Biol 1987;121:139-148. [CrossRef][Medline]
  58. Yan Q, Johnson EM Jr. An immunohistochemical study of the nerve growth factor receptor in developing rats. J Neurosci 1988;8:3481-3498. [Abstract]
  59. Baker DL, Molenaar WM, Trojanowski JQ, et al. Nerve growth factor receptor expression in peripheral and central neuroectodermal tumors, other pediatric brain tumors, and during development of the adrenal gland. Am J Pathol 1991;139:115-122. [Abstract]
  60. Martin DP, Schmidt RE, DiStefano PS, Lowry OH, Carter JG, Johnson EM Jr. Inhibitors of protein synthesis and RNA synthesis prevent neuronal death caused by nerve growth factor deprivation. J Cell Biol 1988;106:829-844. [Free Full Text]
  61. Koike T, Tanaka S. Evidence that nerve growth factor dependence of sympathetic neurons for survival in vitro may be determined by levels of cytoplasmic free Ca2+. Proc Natl Acad Sci U S A 1991;88:3892-3896. [Free Full Text]
  62. Levi-Montalcini R. The nerve growth factor 35 years later. Science 1987;237:1154-1162. [Free Full Text]
  63. Eichler ME, Rich KM. Death of sensory ganglion neurons after acute withdrawal of nerve growth factor in dissociated cell cultures. Brain Res 1989;482:340-346. [CrossRef][Medline]
  64. Tsokos M, Scarpa S, Ross RA, Triche TJ. Differentiation of human neuroblastoma recapitulates neural crest development: study of morphology, neurotransmitter enzymes, and extracellular matrix proteins. Am J Pathol 1987;128:484-496. [Abstract]
  65. Cooper MJ, Hutchins GM, Cohen PS, Helman LJ, Mennie RJ, Israel MA. Human neuroblastoma tumor cell lines correspond to the arrested differentiation of chromaffin adrenal medullary neuroblasts. Cell Growth Differ 1990;1:149-159. [Abstract]
  66. Look AT, Hayes FA, Nitschke R, McWilliams NB, Green AA. Cellular DNA content as a predictor of response to chemotherapy in infants with unresectable neuroblastoma. N Engl J Med 1984;311:231-235. [Abstract]
  67. Hayashi Y, Hanada R, Yamamoto K, Bessho F. Chromosome findings and prognosis in neuroblastoma. Cancer Genet Cytogenet 1987;29:175-177. [Medline]
  68. Kaneko Y, Kanda N, Maseki N, et al. Different karyotypic patterns in early and advanced stage neuroblastomas. Cancer Res 1987;47:311-318. [Free Full Text]
  69. Taylor SR, Blatt J, Costantino JP, Roederer M, Murphy RF. Flow cytometric DNA analysis of neuroblastoma and ganglioneuroma: a 10-year retrospective study. Cancer 1988;62:749-754. [CrossRef][Medline]
  70. Look AT, Hayes FA, Shuster JJ, et al. Clinical relevance of tumor cell ploidy and N-myc gene amplification in childhood neuroblastoma: a Pediatric Oncology Group study. J Clin Oncol 1991;9:581-591. [Abstract]
  71. Bartram CR, Berthold F. Amplification and expression of the N-myc gene in neuroblastoma. Eur J Pediatr 1987;146:162-165. [CrossRef][Medline]
  72. Nakagawara A, Ikeda K, Tsuda T, Higashi K. N-myc oncogene amplification and prognostic factors of neuroblastoma in children. J Pediatr Surg 1987;22:895-898. [Medline]
  73. Slavc I, Ellenbogen R, Jung W-H, et al. myc Gene amplification and expression in primary human neuroblastoma. Cancer Res 1990;50:1459-1463. [Free Full Text]

 

This Article
-Abstract

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation

This article has been cited by other articles:



HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  TERMS OF USE  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2010 Massachusetts Medical Society. All rights reserved.