Strains of human immunodeficiency virus type 1 (HIV-1) withreduced sensitivity to zidovudine have been isolated from patientstreated with this drug for six months or more1. Resistance tozidovudine is associated with late-stage disease, low CD4 lymphocytecounts, longer antiretroviral therapy, and specific mutationsin the reverse transcriptase gene of HIV-12,3. The clinicalimportance of infections with resistant HIV-1 isolates is notwell understood. We describe a patient with symptomatic HIV-1infection who had primary infection with a virus resistant tozidovudine, according to both phenotypic and genotypic analyses.
Case Report
The patient was a 20-year-old homosexual man who had been ingood health until 10 days before hospitalization, when fatigue,fever (temperature reaching 38.5 °C), generalized lymphadenopathy,and mild sore throat developed. He indicated that he had testednegative for HIV-1 antibodies one year before while in the militaryand one month earlier at a local facility. He reported no previousexposure to zidovudine or other antiretroviral agents. The patientreported recent sexual contact with three male partners. Itwas subsequently determined that one partner was HIV-1-positiveand was receiving zidovudine.
On physical examination, the patient had cervical lymphadenopathy,a marked splenomegaly, diffuse erythema of his face and back,swelling of his lips, and giant urticaria on his arms and chest.Initial laboratory studies included a white-cell count of 23,600per cubic millimeter (23.6 x 109 per liter) with 14 percenttotal neutrophils, 10 percent band forms, 60 percent lymphocytes,20 percent monocytes, and 5 percent basophils. Eighty percentof the white cells were mononuclear, with marked atypical morphologicfeatures. The hematocrit was 0.41, the mean corpuscular volume84 microm3, and the platelet count 125 x 103 per cubic millimeter(125 x 109 per liter). The serum was positive for HIV-1 antibodieson enzyme-linked immunoassay, and the Western blot assay showedweakly reactive p24, p66, gp120, and gp160 bands. An assay forserum HIV-1 antigen was also positive. Serum zidovudine levelswere measured retrospectively in a base-line serum sample andwere found to be negative by radioimmunoassay.
Seven days later, the patient's white-cell count had risen to31,000 per cubic millimeter (31 x 109 per liter), with 76 percentlymphocytes (68 percent of them atypical). The absolute CD4lymphocyte count was 944 per cubic millimeter (0.944 x 109 perliter), with a helper-suppressor lymphocyte ratio of 0.09. Adiagnosis of probable acute retroviral infection was made. Treatmentwith zidovudine was started at a dose of 500 mg daily. The patientreturned to the clinic three months later with persistent low-gradefevers (to 38 °C). He had continued to take zidovudine buthad used only a two-month supply of medication over a three-monthperiod. His absolute CD4 cell count had fallen to 314 per cubicmillimeter (0.314 x 109 per liter), and additional bands (p17,p31, p51, and gp 41) were observed in the Western blot assay.He was started on a course of long-term zidovudine therapy (500mg daily). Eleven months after his first visit, the absoluteCD4 count was 300 per cubic millimeter (0.300 x 109 per liter),with a helper-suppressor lymphocyte ratio of 0.18. Didanosinetherapy was substituted for zidovudine. Fifteen months afterhis first visit, the patient's CD4 lymphocyte count was 457per cubic millimeter (0.457 x 109 per liter).
Methods
Sequential samples of serum and blood collected in tubes containingheparin were obtained from the patient for determination ofHIV-1 antigen and HIV-1 cultures of peripheral-blood mononuclearcells and plasma fractions. HIV-1 antigen determinations wereperformed with a commercially available enzyme immunoassay (AbbottLaboratories, North Chicago, Ill.). Peripheral-blood mononuclearcells and plasma were cultured for HIV-1 as described elsewhere,4with quantitation performed according to the consensus protocolsdeveloped by the Virology Committee of the AIDS Clinical TrialsGroup. Titers of infectious HIV-1 were expressed as tissue-culture-infectivedoses per million peripheral-blood mononuclear cells or permilliliter of plasma. Tests of susceptibility to zidovudinewere performed by a method of reverse transcriptase inhibitiondescribed elsewhere5,6. The results were expressed as 50 percentinhibitory concentrations (IC50) of zidovudine. In this assay,IC50 values of HIV-1 strains from patients not treated withzidovudine are less than 0.34 µmol per liter6. Isolateswith IC50 values greater than 1 µmol per liter are consideredhighly resistant to zidovudine. Molecular analyses of HIV-1strains obtained from the patient before and after the completionof four months of zidovudine therapy were performed accordingto methods published elsewhere7. Proviral DNA was amplifiedwith sense (5'GCCATGGTCGACGGAAGAAATCTGTTGACTCAG3') and antisense(5'TGACGTCGACTCATTGACAGTCCAGCT3') primers flanking an 850-bpsegment of codons 1 through 250 of the reverse transcriptasegene of HIV-1. Amplified DNA was cloned in Escherichia coliand sequenced with an automated DNA sequencer (Applied Biosystems,Foster City, Calif.).
Results
As shown in Table 1, blood specimens were collected before thestart of zidovudine therapy and sequentially during treatment.HIV-1 antigen was detected in the serum obtained before therapy.Subsequent serum samples showed increasing concentrations ofHIV-1 antigen over time. The HIV-1 titers in peripheral-bloodmononuclear cells were 167 tissue-culture-infective doses permillion cells before zidovudine therapy and did not change substantiallyduring follow-up. Plasma HIV-1 titers were 3172 tissue-culture-infectivedoses per milliliter at base line, and declined to 1 tissue-culture-infectivedose per milliliter after 17 weeks of zidovudine therapy. HIV-1isolates obtained before and after four months of zidovudinetherapy were analyzed for their susceptibility to zidovudine(Table 2). The IC50 of the isolate obtained before therapy was0.86 µmol per liter. The isolate obtained 17 weeks laterwas highly resistant to zidovudine, with an IC50 of 2.90 µmolper liter. Molecular studies demonstrated that the initial and17-week isolates contained a Thr-to-Tyr mutation at position215 but no other mutations known to contribute to zidovudineresistance (Table 2). Both HIV-1 isolates had a majority ofclones in which Tyr215 was present, but one clone containingPhe215 was detected for each isolate.
Table 2. Phenotypic and Genotypic Characteristics of HIV-1 Isolates Obtained from the Patient before and after Zidovudine Therapy.
Discussion
We describe a patient with primary HIV-1 infection caused bya virus already resistant to zidovudine. In addition to decreasedsusceptibility to zidovudine in vitro, the HIV-1 strain isolatedbefore the start of zidovudine therapy contained a mutationin position 215 of the reverse transcriptase gene. The presenceof the mutation at position 215 has been associated with resistanceto zidovudine,7,8,9,10,11 and the mutation has not been foundby direct probing or sequencing with the polymerase chain reactionin 98 isolates obtained from HIV-1-infected persons before zidovudinetherapy3,8,9,10,12. Our patient reported no previous use ofzidovudine, his serum was negative for the drug, and his meancorpuscular volume was normal at base line13. Because one ofhis sexual partners was receiving zidovudine (and thereforecould have been harboring a high percentage of resistant HIV-1variants), we suggest that he acquired a zidovudine-resistantvirus. Absolute evidence of primary HIV-1 infection (i.e., completelydocumented seroconversion in sequential serum samples) was lackingin the case of our patient; however, his clinical presentation,the appearance of new bands in Western blot assays of sequentialserum samples, and a normal CD4 lymphocyte count at base linein conjunction with the presence of serum antigenemia and plasmaviremia all strongly suggest that this was a primary HIV-1 infection.
Our patient harbored a large viral load, as indicated by thehigh titers of HIV-1 in his plasma before he received zidovudineand the persistence during therapy of plasma viremia, with unchangedtiters of infectious HIV-1 in peripheral-blood mononuclear cellsand increasing concentrations of serum HIV-1 antigen. Thesefindings contrast with earlier studies in patients with primaryHIV-1 infection that describe rapid spontaneous decreases inthe HIV-1 antigen concentration in serum and decreases in titersof infectious HIV-114,15. We postulate that the high viral loadand the prolonged acute retroviral syndrome in our patient weredirect consequences of infection with a zidovudine-resistantvirus.
This report shows that horizontal transmission of a zidovudine-resistantstrain of HIV-1 is possible. This may have a bearing on theclinical approach to newly infected persons, who could haveacquired a resistant strain of the virus. Large numbers of HIV-1-infectedpatients are now receiving long-term antiretroviral treatmentwith zidovudine, with an estimated 89 percent of those withlate-stage HIV-1 infection and 31 percent of those with early-stageinfection harboring some resistant clones 12 months after thestart of therapy2. Because the incidence of new HIV-1 infectionsin the United States has been estimated to be 40,000 annually,16it is likely that some will be caused by zidovudine-resistantviruses. HIV-1 isolates resistant to didanosine and zalcitabinehave also been identified,5,17 and therefore the possibilityof primary acquisition of viruses resistant to these compoundsshould also be considered in newly infected persons.
There are no guidelines for the treatment of primary HIV-1 infectionwith antiretroviral drugs. Tindall et al.18 recently described11 patients with primary HIV-1 infections who were treated with1000 mg of zidovudine daily for an average of 56 days (range,28 to 111).The study showed no apparent early clinical benefitassociated with the use of zidovudine in these patients as comparedwith a group of historical controls. Although HIV-1 antigendeterminations and cultures of peripheral-blood mononuclearcells and plasma fractions were included in the study, testsof the susceptibility of viral isolates to zidovudine were notperformed, and long-term follow-up was not included.
During the acute phase of HIV-1 infection there is a large viralburden, with elevated titers of highly cytopathic HIV-1 in theplasma and peripheral-blood mononuclear-cell fractions of infectedpersons14,15. It is possible that zidovudine therapy duringthe early phases of HIV-1 infection could lower the initialviral load and conceivably alter the natural history of progression.Alternatively, one could speculate that the administration ofzidovudine during this highly replicative phase of HIV-1 infectionmight select drug-resistant viruses, interfere with normal immuneresponses,19 and favor faster progression of the disease. Moreover,if the acute infection were caused by an isolate with decreasedsensitivity to zidovudine, treatment could result in the rapidemergence of a highly resistant virus, as suggested in the patientwe have described. Thus, the decision to treat primary HIV-1infection must await the results of carefully designed prospectivetrials that incorporate susceptibility studies of HIV-1 isolates.
Supported by grants (AM13083 and AI27761) from the NationalInstitutes of Health and by grants from the Minnesota MedicalFoundation. The opinions expressed herein are those of the authorsand do not necessarily reflect those of the Department of theArmy, the Department of the Navy, or the Department of Defense.
We are indebted to Eric Sanders-Buell for assistance in sequencingthe reverse transcriptase clones, to Carolyn Beatty for measuringzidovudine levels, to Teri Pattison for assistance in the preparationof the manuscript, and to Ralph Heussner for editorial advice.
Source Information
From the Departments of Laboratory Medicine and Pathology, Medicine, and Pediatrics, University of Minnesota Medical School, and the AIDS Clinical Trials Unit, Minneapolis (A.E., K.J.S., H.H.B.); the Naval Medical Research Institute and Division of Retrovirology, Walter Reed Army Institute of Research, Washington, D.(D.L.M.); the Henry M. Jackson Foundation Research Laboratory, Rockville, Md. (F.E.M.); Group Health Inc., Riverside Medical Center, Minneapolis (D.G.S.); and St. Paul Ramsey Medical Center, St. Paul, Minn. (K.H.). Presented at the 32nd Interscience Conference on Antimicrobial Agents and Chemotherapy, Anaheim, Calif., October 13, 1992.
Address reprint requests to Dr. Balfour at Box 437 UMHC, Harvard St. at E. River Rd., Minneapolis, MN 55455.
References
Larder BA, Darby G, Richman DD. HIV with reduced sensitivity to zidovudine (AZT) isolated during prolonged therapy. Science 1989;243:1731-1734. [Free Full Text]
Richman DD, Grimes JM, Lagakos SW. Effect of stage of disease and drug dose on zidovudine susceptibilities of isolates of human immunodeficiency virus. J Acquir Immune Defic Syndr 1990;3:743-746.
Larder BA, Kemp SD. Multiple mutations in HIV-1 reverse transcriptase confer high-level resistance to zidovudine (AZT). Science 1989;246:1155-1158. [Free Full Text]
Erice A, Sannerud KJ, Leske VL, Aeppli D, Balfour HH Jr. Sensitive microculture method for isolation of human immunodeficiency virus type 1 from blood leukocytes. J Clin Microbiol 1992;30:444-448. [Free Full Text]
St Clair MH, Martin JL, Tudor-Williams G, et al. Resistance to ddI and sensitivity to AZT induced by a mutation in HIV-1 reverse transcriptase. Science 1991;253:1557-1559. [Free Full Text]
Tudor-Williams G, St Clair MH, McKinney RE, et al. HIV-1 sensitivity to zidovudine and clinical outcome in children. Lancet 1992;339:15-19. [CrossRef][Medline]
Mayers DL, McCutchan FE, Sanders-Buell EE, et al. Characterization of HIV isolates arising after prolonged zidovudine therapy. J Acquir Immune Defic Syndr 1992;5:749-759.
Richman DD, Guatelli JC, Grimes J, Tsiatis A, Gingeras T. Detection of mutations associated with zidovudine resistance in human immunodeficiency virus by use of the polymerase chain reaction. J Infect Dis 1991;164:1075-1081. [Medline]
Boucher CA, O'Sullivan E, Mulder JW, et al. Ordered appearance of zidovudine resistance mutations during treatment of 18 human immunodeficiency virus-positive subjects. J Infect Dis 1992;165:105-110. [Medline]
Jung M, Agut H, Candotti D, Ingrand D, Katlama C, Huraux JM. Susceptibility of HIV-1 isolates to zidovudine: correlation between widely applicable culture test and PCR analysis. J Acquir Immune Defic Syndr 1992;5:359-364.
Japour AJ, Chatis PA, Eigenrauch HA, Crumpacker CS. Detection of human immunodeficiency virus type 1 clinical isolates with reduced sensitivity to zidovudine and dideoxyinosine by RNA . RNA hybridization. Proc Natl Acad Sci U S A 1991;88:3092-3096. [Free Full Text]
Fitzgibbon JE, Howell RM, Schwartzer TA, Gocke DJ, Dubin DT. In vivo prevalence of azidothymidine (AZT) resistance mutations in an AIDS patient before and after AZT therapy. AIDS Res Hum Retroviruses 1991;7:265-269. [Medline]
Lim L, Grimes J, Volberding P, Lagakos S, Krogstad D, Sadler B. Compliance with study medication in a randomized trial of zidovudine (ACTG 019). In: Abstracts of the Sixth International Conference on AIDS, San Francisco, June 20-24, 1990. Vol. 3. San Francisco: University of California, 1990:285. abstract.
Clark SJ, Saag MS, Decker WD, et al. High titers of cytopathic virus in plasma of patients with symptomatic primary HIV-1 infection. N Engl J Med 1991;324:954-960. [Abstract]
Daar ES, Moudgil T, Meyer RD, Ho DD. Transient high levels of viremia in patients with primary human immunodeficiency virus type 1 infection. N Engl J Med 1991;324:961-964. [Abstract]
Estimates of HIV prevalence and projected AIDS cases: summary of a workshop, October 31-November 1, 1989. MMWR Morb Mortal Wkly Rep 1990;39:110-2, 117. [Medline]
Fitzgibbon JE, Howell RM, Haberzettl CA, Sperber SJ, Gocke DJ, Dubin DT. Human immunodeficiency virus type 1 pol gene mutations which cause decreased susceptibility to 2',3'-dideoxycytidine. Antimicrob Agents Chemother 1992;36:153-157. [Free Full Text]
Tindall B, Gaines H, Imrie A, et al. Zidovudine in the management of primary HIV-1 infection. AIDS 1991;5:477-484. [Medline]
Heagy W, Crumpacker C, Lopez PA, Finberg RW. Inhibition of immune functions by antiviral drugs. J Clin Invest 1991;87:1916-1924.
Primary Infection with Zidovudine-Resistant HIV
Hermans P., Sprecher S., Clumeck N., Masquelier B., Lemoigne E., Pellegrin I., Douard D., Sandler B., Fleury H. J.A., Erice A., Balfour H. H.
Extract |
Full Text
N Engl J Med 1993;
329:1123-1124, Oct 7, 1993.
Correspondence
This article has been cited by other articles:
Sagir, A., Oette, M., Kaiser, R., Daumer, M., Fatkenheuer, G., Rockstroh, J. K., Knechten, H., Schmutz, G., Hower, M., Emmelkamp, J., Pfister, H., Haussinger, D., on behalf of the RESINA Study Team,
(2007). Trends of prevalence of primary HIV drug resistance in Germany. J Antimicrob Chemother
60: 843-848
[Abstract][Full Text]
Taiwo, B. O., Murphy, R.
(2007). Transmitted Resistance: An Overview and Its Potential Relevance to the Management of HIV-Infected Persons in Resource-Limited Settings. J Int Assoc Physicians AIDS Care (Chic Ill)
6: 188-197
[Abstract]
Booth, C. L., Geretti, A. M.
(2007). Prevalence and determinants of transmitted antiretroviral drug resistance in HIV-1 infection. J Antimicrob Chemother
59: 1047-1056
[Abstract][Full Text]
de Mendoza, C., Rodriguez, C., Garcia, F., Eiros, J. M., Ruiz, L., Caballero, E., Aguilera, A., Leiva, P., Colomina, J., Gutierrez, F., del Romero, J., Aguero, J., Soriano, V., on behalf of the Spanish HIV Seroconverter Study G,
(2007). Prevalence of X4 tropic viruses in patients recently infected with HIV-1 and lack of association with transmission of drug resistance. J Antimicrob Chemother
59: 698-704
[Abstract][Full Text]
Booth, C. L., Garcia-Diaz, A. M., Youle, M. S., Johnson, M. A., Phillips, A., Geretti, A. M.
(2007). Prevalence and predictors of antiretroviral drug resistance in newly diagnosed HIV-1 infection. J Antimicrob Chemother
59: 517-524
[Abstract][Full Text]
Garcia-Lerma, J. G., MacInnes, H., Bennett, D., Weinstock, H., Heneine, W.
(2004). Transmitted Human Immunodeficiency Virus Type 1 Carrying the D67N or K219Q/E Mutation Evolves Rapidly to Zidovudine Resistance In Vitro and Shows a High Replicative Fitness in the Presence of Zidovudine. J. Virol.
78: 7545-7552
[Abstract][Full Text]
Clavel, F., Hance, A. J.
(2004). HIV Drug Resistance. NEJM
350: 1023-1035
[Full Text]
Havens, P. L., Committee on Pediatric AIDS,
(2003). Postexposure Prophylaxis in Children and Adolescents for Nonoccupational Exposure to Human Immunodeficiency Virus. Pediatrics
111: 1475-1489
[Abstract][Full Text]
Little, S. J., Holte, S., Routy, J.-P., Daar, E. S., Markowitz, M., Collier, A. C., Koup, R. A., Mellors, J. W., Connick, E., Conway, B., Kilby, M., Wang, L., Whitcomb, J. M., Hellmann, N. S., Richman, D. D.
(2002). Antiretroviral-Drug Resistance among Patients Recently Infected with HIV. NEJM
347: 385-394
[Abstract][Full Text]
Kuritzkes, D. R.
(2001). A fossil record of zidovudine resistance in transmitted isolates of HIV-1. Proc. Natl. Acad. Sci. USA
98: 13485-13487
[Full Text]
Garcia-Lerma, J. G., Nidtha, S., Blumoff, K., Weinstock, H., Heneine, W.
(2001). Increased ability for selection of zidovudine resistance in a distinct class of wild-type HIV-1 from drug-naive persons. Proc. Natl. Acad. Sci. USA
10.1073/pnas.241300698v1
[Abstract][Full Text]
Sharma, R.
(2000). Antiretroviral Resistance: Mechanisms, Detection and Clinical Implications. Journal of Pharmacy Practice
13: 442-456
[Abstract]
Brown, A. J. L., Precious, H. M., Whitcomb, J. M., Wong, J. K., Quigg, M., Huang, W., Daar, E. S., D'Aquila, R. T., Keiser, P. H., Connick, E., Hellmann, N. S., Petropoulos, C. J., Richman, D. D., Little, S. J.
(2000). Reduced Susceptibility of Human Immunodeficiency Virus Type 1 (HIV-1) from Patients with Primary HIV Infection to Nonnucleoside Reverse Transcriptase Inhibitors Is Associated with Variation at Novel Amino Acid Sites. J. Virol.
74: 10269-10273
[Abstract][Full Text]
Beltrami, E. M., Williams, I. T., Shapiro, C. N., Chamberland, M. E.
(2000). Risk and Management of Blood-Borne Infections in Health Care Workers. Clin. Microbiol. Rev.
13: 385-407
[Abstract][Full Text]
Van Rompay, K. K. A., Miller, M. D., Marthas, M. L., Margot, N. A., Dailey, P. J., Canfield, D. R., Tarara, R. P., Cherrington, J. M., Aguirre, N. L., Bischofberger, N., Pedersen, N. C.
(2000). Prophylactic and Therapeutic Benefits of Short-Term 9-[2-(R)-(Phosphonomethoxy)Propyl]Adenine (PMPA) Administration to Newborn Macaques following Oral Inoculation with Simian Immunodeficiency Virus with Reduced Susceptibility to PMPA. J. Virol.
74: 1767-1774
[Abstract][Full Text]
Henry, K.
(2000). The Case for More Cautious, Patient-Focused Antiretroviral Therapy. ANN INTERN MED
132: 306-311
[Abstract][Full Text]
Boden, D., Hurley, A., Zhang, L., Cao, Y., Guo, Y., Jones, E., Tsay, J., Ip, J., Farthing, C., Limoli, K., Parkin, N., Markowitz, M.
(1999). HIV-1 Drug Resistance in Newly Infected Individuals. JAMA
282: 1135-1141
[Abstract][Full Text]
Little, S. J., Daar, E. S., D'Aquila, R. T., Keiser, P. H., Connick, E., Whitcomb, J. M., Hellmann, N. S., Petropoulos, C. J., Sutton, L., Pitt, J. A., Rosenberg, E. S., Koup, R. A., Walker, B. D., Richman, D. D.
(1999). Reduced Antiretroviral Drug Susceptibility Among Patients With Primary HIV Infection. JAMA
282: 1142-1149
[Abstract][Full Text]
Pomerantz, R. J.
(1999). Primary HIV-1 Resistance: A New Phase in the Epidemic?. JAMA
282: 1177-1179
[Full Text]
Little, S. J., McLean, A. R., Spina, C. A., Richman, D. D., Havlir, D. V.
(1999). Viral Dynamics of Acute HIV-1 Infection. JEM
190: 841-850
[Abstract][Full Text]
Kashuba, A. D. M., Dyer, J. R., Kramer, L. M., Raasch, R. H., Eron, J. J., Cohen, M. S.
(1999). Antiretroviral-Drug Concentrations in Semen: Implications for Sexual Transmission of Human Immunodeficiency Virus Type 1. Antimicrob. Agents Chemother.
43: 1817-1826
[Full Text]
García Lerma, J. G., Schinazi, R. F., Juodawlkis, A. S., Soriano, V., Lin, Y., Tatti, K., Rimland, D., Folks, T. M., Heneine, W.
(1999). A Rapid Non-Culture-Based Assay for Clinical Monitoring of Phenotypic Resistance of Human Immunodeficiency Virus Type 1 to Lamivudine (3TC). Antimicrob. Agents Chemother.
43: 264-270
[Abstract][Full Text]
Hecht, F. M., Grant, R. M., Petropoulos, C. J., Dillon, B., Chesney, M. A., Tian, H., Hellmann, N. S., Bandrapalli, N. I., Digilio, L., Branson, B., Kahn, J. O.
(1998). Sexual Transmission of an HIV-1 Variant Resistant to Multiple Reverse-Transcriptase and Protease Inhibitors. NEJM
339: 307-311
[Full Text]
Cohen, O. J., Fauci, A. S.
(1998). Transmission of Multidrug-Resistant Human Immunodeficiency Virus -- The Wake-Up Call. NEJM
339: 341-343
[Full Text]
Wainberg, M. A., Friedland, G.
(1998). Public Health Implications of Antiretroviral Therapy and HIV Drug Resistance. JAMA
279: 1977-1983
[Abstract][Full Text]
Hirsch, M. S., Conway, B., D'Aquila, R. T., Johnson, V. A., Brun-Vezinet, F., Clotet, B., Demeter, L. M., Hammer, S. M., Jacobsen, D. M., Kuritzkes, D. R., Loveday, C., Mellors, J. W., Vella, S., Richman, D. D., for the International AIDS Society-USA Panel,
(1998). Antiretroviral Drug Resistance Testing in Adults With HIV Infection: Implications for Clinical Management. JAMA
279: 1984-1991
[Abstract][Full Text]
Mayers, D. L.
(1998). Drug-Resistant HIV-1: The Virus Strikes Back. JAMA
279: 2000-2002
[Full Text]
Bartlett, J. A.
(1998). Strategies of Antiretroviral Therapy in Adults. The Oncologist
3: 111-118
[Abstract][Full Text]
Quinn, T. C.
(1997). Acute Primary HIV Infection. JAMA
278: 58-62
[Abstract]
Sinicco, A, Fora, R, Raiteri, R, Sciandra, M, Bechis, G, Calvo, M M, Gioannini, P
(1997). Is the clinical course of HIV-1 changing? Cohort study. BMJ
314: 1232-1232
[Abstract][Full Text]
Brown, A. J. L.
(1997). Analysis of HIV-1 env gene sequences reveals evidence for a low effective number in the viral population. Proc. Natl. Acad. Sci. USA
94: 1862-1865
[Abstract][Full Text]
Hu, D. J., Dondero, T. J., Rayfield, M. A., George, J. R., Schochetman, G., Jaffe, H. W., Luo, C.-C., Kalish, M. L., Weniger, B. G., Pau, C.-P., Schable, C. A., Curran, J. W.
(1996). The Emerging Genetic Diversity of HIV: The Importance of Global Surveillance for Diagnostics, Research, and Prevention. JAMA
275: 210-216
[Abstract]
Forseter, G., Wormser, G. P., Joline, C.
(1995). Is Zidovudine a Prophylactic Treatment for Health Care Workers?-Reply. Arch Intern Med
155: 1816-1817
[Abstract]
(1995). Antiretroviral Drug Resistance: Clinical Significance and Implications for HIV Pathogenesis. AIDS Clin Care
1995: 1-1
[Full Text]
Fitzgibbon, J. E., Gaur, S., Frenkel, L. D., Laraque, F., Edlin, B. R., Dubin, D. T.
(1993). Transmission from One Child to Another of Human Immunodeficiency Virus Type 1 with a Zidovudine-Resistance Mutation. NEJM
329: 1835-1841
[Abstract][Full Text]
Hermans, P., Sprecher, S., Clumeck, N., Masquelier, B., Lemoigne, E., Pellegrin, I., Douard, D., Sandler, B., Fleury, H. J.A., Erice, A., Balfour, H. H.
(1993). Primary Infection with Zidovudine-Resistant HIV. NEJM
329: 1123-1124
[Full Text]
Bartlett, J. G.
(1993). Zidovudine Now or Later?. NEJM
329: 351-352
[Full Text]
Vermund, S. H.
(1993). Rising HIV-Related Mortality in Young Americans. JAMA
269: 3034-3035
[Abstract]
Hirsch, M. S., D'Aquila, R. T.
(1993). Therapy for Human Immunodeficiency Virus Infection. NEJM
328: 1686-1695
[Full Text]
(1993). Zidovudine-Resistant HIV Strains Can Be Contagious. Journal Watch Dermatology
1993: 12-12
[Full Text]
Johnston, M., Hoth, D.
(1993). Present status and future prospects for HIV therapies. Science
260: 1286-1293
[Abstract]
(1993). ZIDOVUDINE-RESISTANT HIV STRAINS CAN BE CONTAGIOUS. JWatch General
1993: 3-3
[Full Text]
Soeiro, R.
(1993). A Tale of Two Mutants. NEJM
328: 1192-1193
[Full Text]
Garcia-Lerma, J. G., Nidtha, S., Blumoff, K., Weinstock, H., Heneine, W.
(2001). From the Cover: Increased ability for selection of zidovudine resistance in a distinct class of wild-type HIV-1 from drug-naive persons. Proc. Natl. Acad. Sci. USA
98: 13907-13912
[Abstract][Full Text]