The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
Original Article
Brief Report
PreviousPrevious
Volume 328:1163-1165 April 22, 1993 Number 16
NextNext

Primary Infection with Zidovudine-Resistant Human Immunodeficiency Virus Type 1
Alejo Erice, Douglas L. Mayers, David G. Strike, Kim J. Sannerud, Francine E. McCutchan, Keith Henry, and Henry H. Balfour

 

Commentary
-Letters

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation
Strains of human immunodeficiency virus type 1 (HIV-1) with reduced sensitivity to zidovudine have been isolated from patients treated with this drug for six months or more1. Resistance to zidovudine is associated with late-stage disease, low CD4 lymphocyte counts, longer antiretroviral therapy, and specific mutations in the reverse transcriptase gene of HIV-12,3. The clinical importance of infections with resistant HIV-1 isolates is not well understood. We describe a patient with symptomatic HIV-1 infection who had primary infection with a virus resistant to zidovudine, according to both phenotypic and genotypic analyses.

Case Report

The patient was a 20-year-old homosexual man who had been in good health until 10 days before hospitalization, when fatigue, fever (temperature reaching 38.5 °C), generalized lymphadenopathy, and mild sore throat developed. He indicated that he had tested negative for HIV-1 antibodies one year before while in the military and one month earlier at a local facility. He reported no previous exposure to zidovudine or other antiretroviral agents. The patient reported recent sexual contact with three male partners. It was subsequently determined that one partner was HIV-1-positive and was receiving zidovudine.

On physical examination, the patient had cervical lymphadenopathy, a marked splenomegaly, diffuse erythema of his face and back, swelling of his lips, and giant urticaria on his arms and chest. Initial laboratory studies included a white-cell count of 23,600 per cubic millimeter (23.6 x 109 per liter) with 14 percent total neutrophils, 10 percent band forms, 60 percent lymphocytes, 20 percent monocytes, and 5 percent basophils. Eighty percent of the white cells were mononuclear, with marked atypical morphologic features. The hematocrit was 0.41, the mean corpuscular volume 84 microm3, and the platelet count 125 x 103 per cubic millimeter (125 x 109 per liter). The serum was positive for HIV-1 antibodies on enzyme-linked immunoassay, and the Western blot assay showed weakly reactive p24, p66, gp120, and gp160 bands. An assay for serum HIV-1 antigen was also positive. Serum zidovudine levels were measured retrospectively in a base-line serum sample and were found to be negative by radioimmunoassay.

Seven days later, the patient's white-cell count had risen to 31,000 per cubic millimeter (31 x 109 per liter), with 76 percent lymphocytes (68 percent of them atypical). The absolute CD4 lymphocyte count was 944 per cubic millimeter (0.944 x 109 per liter), with a helper-suppressor lymphocyte ratio of 0.09. A diagnosis of probable acute retroviral infection was made. Treatment with zidovudine was started at a dose of 500 mg daily. The patient returned to the clinic three months later with persistent low-grade fevers (to 38 °C). He had continued to take zidovudine but had used only a two-month supply of medication over a three-month period. His absolute CD4 cell count had fallen to 314 per cubic millimeter (0.314 x 109 per liter), and additional bands (p17, p31, p51, and gp 41) were observed in the Western blot assay. He was started on a course of long-term zidovudine therapy (500 mg daily). Eleven months after his first visit, the absolute CD4 count was 300 per cubic millimeter (0.300 x 109 per liter), with a helper-suppressor lymphocyte ratio of 0.18. Didanosine therapy was substituted for zidovudine. Fifteen months after his first visit, the patient's CD4 lymphocyte count was 457 per cubic millimeter (0.457 x 109 per liter).

Methods

Sequential samples of serum and blood collected in tubes containing heparin were obtained from the patient for determination of HIV-1 antigen and HIV-1 cultures of peripheral-blood mononuclear cells and plasma fractions. HIV-1 antigen determinations were performed with a commercially available enzyme immunoassay (Abbott Laboratories, North Chicago, Ill.). Peripheral-blood mononuclear cells and plasma were cultured for HIV-1 as described elsewhere,4 with quantitation performed according to the consensus protocols developed by the Virology Committee of the AIDS Clinical Trials Group. Titers of infectious HIV-1 were expressed as tissue-culture-infective doses per million peripheral-blood mononuclear cells or per milliliter of plasma. Tests of susceptibility to zidovudine were performed by a method of reverse transcriptase inhibition described elsewhere5,6. The results were expressed as 50 percent inhibitory concentrations (IC50) of zidovudine. In this assay, IC50 values of HIV-1 strains from patients not treated with zidovudine are less than 0.34 µmol per liter6. Isolates with IC50 values greater than 1 µmol per liter are considered highly resistant to zidovudine. Molecular analyses of HIV-1 strains obtained from the patient before and after the completion of four months of zidovudine therapy were performed according to methods published elsewhere7. Proviral DNA was amplified with sense (5'GCCATGGTCGACGGAAGAAATCTGTTGACTCAG3') and antisense (5'TGACGTCGACTCATTGACAGTCCAGCT3') primers flanking an 850-bp segment of codons 1 through 250 of the reverse transcriptase gene of HIV-1. Amplified DNA was cloned in Escherichia coli and sequenced with an automated DNA sequencer (Applied Biosystems, Foster City, Calif.).

Results

As shown in Table 1, blood specimens were collected before the start of zidovudine therapy and sequentially during treatment. HIV-1 antigen was detected in the serum obtained before therapy. Subsequent serum samples showed increasing concentrations of HIV-1 antigen over time. The HIV-1 titers in peripheral-blood mononuclear cells were 167 tissue-culture-infective doses per million cells before zidovudine therapy and did not change substantially during follow-up. Plasma HIV-1 titers were 3172 tissue-culture-infective doses per milliliter at base line, and declined to 1 tissue-culture-infective dose per milliliter after 17 weeks of zidovudine therapy. HIV-1 isolates obtained before and after four months of zidovudine therapy were analyzed for their susceptibility to zidovudine (Table 2). The IC50 of the isolate obtained before therapy was 0.86 µmol per liter. The isolate obtained 17 weeks later was highly resistant to zidovudine, with an IC50 of 2.90 µmol per liter. Molecular studies demonstrated that the initial and 17-week isolates contained a Thr-to-Tyr mutation at position 215 but no other mutations known to contribute to zidovudine resistance (Table 2). Both HIV-1 isolates had a majority of clones in which Tyr215 was present, but one clone containing Phe215 was detected for each isolate.

View this table:
[in this window]
[in a new window]
 
Table 1. Viral Studies in a Patient with Symptomatic HIV-1 Infection.

 
View this table:
[in this window]
[in a new window]
 
Table 2. Phenotypic and Genotypic Characteristics of HIV-1 Isolates Obtained from the Patient before and after Zidovudine Therapy.

 
Discussion

We describe a patient with primary HIV-1 infection caused by a virus already resistant to zidovudine. In addition to decreased susceptibility to zidovudine in vitro, the HIV-1 strain isolated before the start of zidovudine therapy contained a mutation in position 215 of the reverse transcriptase gene. The presence of the mutation at position 215 has been associated with resistance to zidovudine,7,8,9,10,11 and the mutation has not been found by direct probing or sequencing with the polymerase chain reaction in 98 isolates obtained from HIV-1-infected persons before zidovudine therapy3,8,9,10,12. Our patient reported no previous use of zidovudine, his serum was negative for the drug, and his mean corpuscular volume was normal at base line13. Because one of his sexual partners was receiving zidovudine (and therefore could have been harboring a high percentage of resistant HIV-1 variants), we suggest that he acquired a zidovudine-resistant virus. Absolute evidence of primary HIV-1 infection (i.e., completely documented seroconversion in sequential serum samples) was lacking in the case of our patient; however, his clinical presentation, the appearance of new bands in Western blot assays of sequential serum samples, and a normal CD4 lymphocyte count at base line in conjunction with the presence of serum antigenemia and plasma viremia all strongly suggest that this was a primary HIV-1 infection.

Our patient harbored a large viral load, as indicated by the high titers of HIV-1 in his plasma before he received zidovudine and the persistence during therapy of plasma viremia, with unchanged titers of infectious HIV-1 in peripheral-blood mononuclear cells and increasing concentrations of serum HIV-1 antigen. These findings contrast with earlier studies in patients with primary HIV-1 infection that describe rapid spontaneous decreases in the HIV-1 antigen concentration in serum and decreases in titers of infectious HIV-114,15. We postulate that the high viral load and the prolonged acute retroviral syndrome in our patient were direct consequences of infection with a zidovudine-resistant virus.

This report shows that horizontal transmission of a zidovudine-resistant strain of HIV-1 is possible. This may have a bearing on the clinical approach to newly infected persons, who could have acquired a resistant strain of the virus. Large numbers of HIV-1-infected patients are now receiving long-term antiretroviral treatment with zidovudine, with an estimated 89 percent of those with late-stage HIV-1 infection and 31 percent of those with early-stage infection harboring some resistant clones 12 months after the start of therapy2. Because the incidence of new HIV-1 infections in the United States has been estimated to be 40,000 annually,16 it is likely that some will be caused by zidovudine-resistant viruses. HIV-1 isolates resistant to didanosine and zalcitabine have also been identified,5,17 and therefore the possibility of primary acquisition of viruses resistant to these compounds should also be considered in newly infected persons.

There are no guidelines for the treatment of primary HIV-1 infection with antiretroviral drugs. Tindall et al.18 recently described 11 patients with primary HIV-1 infections who were treated with 1000 mg of zidovudine daily for an average of 56 days (range, 28 to 111).The study showed no apparent early clinical benefit associated with the use of zidovudine in these patients as compared with a group of historical controls. Although HIV-1 antigen determinations and cultures of peripheral-blood mononuclear cells and plasma fractions were included in the study, tests of the susceptibility of viral isolates to zidovudine were not performed, and long-term follow-up was not included.

During the acute phase of HIV-1 infection there is a large viral burden, with elevated titers of highly cytopathic HIV-1 in the plasma and peripheral-blood mononuclear-cell fractions of infected persons14,15. It is possible that zidovudine therapy during the early phases of HIV-1 infection could lower the initial viral load and conceivably alter the natural history of progression. Alternatively, one could speculate that the administration of zidovudine during this highly replicative phase of HIV-1 infection might select drug-resistant viruses, interfere with normal immune responses,19 and favor faster progression of the disease. Moreover, if the acute infection were caused by an isolate with decreased sensitivity to zidovudine, treatment could result in the rapid emergence of a highly resistant virus, as suggested in the patient we have described. Thus, the decision to treat primary HIV-1 infection must await the results of carefully designed prospective trials that incorporate susceptibility studies of HIV-1 isolates.

Supported by grants (AM13083 and AI27761) from the National Institutes of Health and by grants from the Minnesota Medical Foundation. The opinions expressed herein are those of the authors and do not necessarily reflect those of the Department of the Army, the Department of the Navy, or the Department of Defense.

We are indebted to Eric Sanders-Buell for assistance in sequencing the reverse transcriptase clones, to Carolyn Beatty for measuring zidovudine levels, to Teri Pattison for assistance in the preparation of the manuscript, and to Ralph Heussner for editorial advice.


Source Information

From the Departments of Laboratory Medicine and Pathology, Medicine, and Pediatrics, University of Minnesota Medical School, and the AIDS Clinical Trials Unit, Minneapolis (A.E., K.J.S., H.H.B.); the Naval Medical Research Institute and Division of Retrovirology, Walter Reed Army Institute of Research, Washington, D.{beta}(D.L.M.); the Henry M. Jackson Foundation Research Laboratory, Rockville, Md. (F.E.M.); Group Health Inc., Riverside Medical Center, Minneapolis (D.G.S.); and St. Paul Ramsey Medical Center, St. Paul, Minn. (K.H.). Presented at the 32nd Interscience Conference on Antimicrobial Agents and Chemotherapy, Anaheim, Calif., October 13, 1992.

Address reprint requests to Dr. Balfour at Box 437 UMHC, Harvard St. at E. River Rd., Minneapolis, MN 55455.

References

  1. Larder BA, Darby G, Richman DD. HIV with reduced sensitivity to zidovudine (AZT) isolated during prolonged therapy. Science 1989;243:1731-1734. [Free Full Text]
  2. Richman DD, Grimes JM, Lagakos SW. Effect of stage of disease and drug dose on zidovudine susceptibilities of isolates of human immunodeficiency virus. J Acquir Immune Defic Syndr 1990;3:743-746.
  3. Larder BA, Kemp SD. Multiple mutations in HIV-1 reverse transcriptase confer high-level resistance to zidovudine (AZT). Science 1989;246:1155-1158. [Free Full Text]
  4. Erice A, Sannerud KJ, Leske VL, Aeppli D, Balfour HH Jr. Sensitive microculture method for isolation of human immunodeficiency virus type 1 from blood leukocytes. J Clin Microbiol 1992;30:444-448. [Free Full Text]
  5. St Clair MH, Martin JL, Tudor-Williams G, et al. Resistance to ddI and sensitivity to AZT induced by a mutation in HIV-1 reverse transcriptase. Science 1991;253:1557-1559. [Free Full Text]
  6. Tudor-Williams G, St Clair MH, McKinney RE, et al. HIV-1 sensitivity to zidovudine and clinical outcome in children. Lancet 1992;339:15-19. [CrossRef][Medline]
  7. Mayers DL, McCutchan FE, Sanders-Buell EE, et al. Characterization of HIV isolates arising after prolonged zidovudine therapy. J Acquir Immune Defic Syndr 1992;5:749-759.
  8. Richman DD, Guatelli JC, Grimes J, Tsiatis A, Gingeras T. Detection of mutations associated with zidovudine resistance in human immunodeficiency virus by use of the polymerase chain reaction. J Infect Dis 1991;164:1075-1081. [Medline]
  9. Boucher CA, O'Sullivan E, Mulder JW, et al. Ordered appearance of zidovudine resistance mutations during treatment of 18 human immunodeficiency virus-positive subjects. J Infect Dis 1992;165:105-110. [Medline]
  10. Jung M, Agut H, Candotti D, Ingrand D, Katlama C, Huraux JM. Susceptibility of HIV-1 isolates to zidovudine: correlation between widely applicable culture test and PCR analysis. J Acquir Immune Defic Syndr 1992;5:359-364.
  11. Japour AJ, Chatis PA, Eigenrauch HA, Crumpacker CS. Detection of human immunodeficiency virus type 1 clinical isolates with reduced sensitivity to zidovudine and dideoxyinosine by RNA . RNA hybridization. Proc Natl Acad Sci U S A 1991;88:3092-3096. [Free Full Text]
  12. Fitzgibbon JE, Howell RM, Schwartzer TA, Gocke DJ, Dubin DT. In vivo prevalence of azidothymidine (AZT) resistance mutations in an AIDS patient before and after AZT therapy. AIDS Res Hum Retroviruses 1991;7:265-269. [Medline]
  13. Lim L, Grimes J, Volberding P, Lagakos S, Krogstad D, Sadler B. Compliance with study medication in a randomized trial of zidovudine (ACTG 019). In: Abstracts of the Sixth International Conference on AIDS, San Francisco, June 20-24, 1990. Vol. 3. San Francisco: University of California, 1990:285. abstract.
  14. Clark SJ, Saag MS, Decker WD, et al. High titers of cytopathic virus in plasma of patients with symptomatic primary HIV-1 infection. N Engl J Med 1991;324:954-960. [Abstract]
  15. Daar ES, Moudgil T, Meyer RD, Ho DD. Transient high levels of viremia in patients with primary human immunodeficiency virus type 1 infection. N Engl J Med 1991;324:961-964. [Abstract]
  16. Estimates of HIV prevalence and projected AIDS cases: summary of a workshop, October 31-November 1, 1989. MMWR Morb Mortal Wkly Rep 1990;39:110-2, 117. [Medline]
  17. Fitzgibbon JE, Howell RM, Haberzettl CA, Sperber SJ, Gocke DJ, Dubin DT. Human immunodeficiency virus type 1 pol gene mutations which cause decreased susceptibility to 2',3'-dideoxycytidine. Antimicrob Agents Chemother 1992;36:153-157. [Free Full Text]
  18. Tindall B, Gaines H, Imrie A, et al. Zidovudine in the management of primary HIV-1 infection. AIDS 1991;5:477-484. [Medline]
  19. Heagy W, Crumpacker C, Lopez PA, Finberg RW. Inhibition of immune functions by antiviral drugs. J Clin Invest 1991;87:1916-1924.

 

Commentary
-Letters

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation

Related Letters:

Primary Infection with Zidovudine-Resistant HIV
Hermans P., Sprecher S., Clumeck N., Masquelier B., Lemoigne E., Pellegrin I., Douard D., Sandler B., Fleury H. J.A., Erice A., Balfour H. H.
Extract | Full Text  
N Engl J Med 1993; 329:1123-1124, Oct 7, 1993. Correspondence

This article has been cited by other articles:



HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  TERMS OF USE  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved.