|
| |||||||||||||||||||||||||||||||
Background and Methods The lesions of cutaneous mastocytosis are characterized by dermal infiltrates of mast cells and may appear hyperpigmented because of the presence of increased levels of epidermal melanin. Mast-cell growth factor, the ligand for the product of the c-kit proto-oncogene, stimulates the proliferation of mast cells and increases the production of melanin by melanocytes. We therefore looked for the expression of the mast-cell growth factor gene in the skin of patients with cutaneous mastocytosis using immunohistochemical techniques and the polymerase chain reaction.
Results In the skin of normal subjects and those with unrelated diseases, immunoreactive mast-cell growth factor was associated with keratinocytes and scattered dermal cells, a pattern consistent with cell-bound mast-cell growth factor. In skin samples containing lesions and in clinically normal skin from patients with mastocytosis, however, mast-cell growth factor was also found free in the dermis and in the extracellular spaces between keratinocytes, suggesting the presence of a soluble form of this protein. Messenger RNA (mRNA) that can encode soluble mast-cell growth factor was present in the skin of patients as well as in that of normal control subjects. No sequence abnormalities were detected in mRNA for mast-cell growth factor from one patient.
Conclusions The altered distribution of mast-cell growth factor in the skin of patients with cutaneous mastocytosis is consistent with abnormal production of the soluble form of this factor. This abnormality is probably due to increased proteolytic processing, since it was not explained by differences in the splicing or sequence of mast-cell growth factor mRNA in the patients. Soluble mast-cell growth factor may cause the characteristic accumulation of mast cells and the hyperpigmentation of skin found in cutaneous mastocytosis. These findings suggest that some forms of mastocytosis represent reactive hyperplasia rather than mast-cell neoplasia.
Cutaneous mastocytosis may consist of a solitary mastocytoma, multiple lesions, or diffuse involvement of the skin. One form, urticaria pigmentosa, is characterized by multiple discrete hyperpigmented lesions. As the name urticaria pigmentosa implies, the cutaneous lesions of mastocytosis may be pigmented and may show Darier's sign, which consists of urtication due to mast-cell degranulation after stroking. Infants with cutaneous mastocytosis often have bullous lesions because tissue edema causes the skin to separate at the dermal-epidermal junction, which is relatively poorly developed in early life.
Less commonly, mastocytosis affects the bone marrow or gastrointestinal tract, alone or in addition to producing cutaneous lesions. Rarely, it is associated with hematologic disorders, including mast-cell leukemia2. The cause of the mast-cell accumulations has not been identified for any type of mastocytosis, and it is not yet known whether any of the common forms represent a primary neoplasia of mast cells or a reactive hyperplasia.
Mast-cell growth factor is a cytokine and is the ligand for the protein product of the c-kit proto-oncogene. It is also known as stem-cell factor, steel factor, and kit-ligand3,4,5,6,7,8,9,10. Mast-cell growth factor stimulates the growth and differentiation of murine mast cells in vitro3,4,5,6,7,10,11. It also affects mast cells in vivo; for example, injection of the soluble protein into the dermis of rodents causes the accumulation of these cells7,12. In addition, mast-cell growth factor stimulates the proliferation of melanocytes and the production of melanin in humans13 (and unpublished data).
Mast-cell growth factor exists in a form bound to the cell membrane or in a soluble form, and both may have different biologic activities in vivo5,6,9,11,14,15,16,17,18. Normally, the soluble form is produced from the cell-bound form by proteolytic cleavage at a protease-sensitive site adjacent to the cell membrane5,6,14,15,16,18. The protease-sensitive site is encoded by a region of the gene known as exon 6, which may be represented in the final messenger RNA (mRNA) or may be deleted by alternative splicing of the primary gene transcript (Figure 1). Thus, production of the soluble form is normally dependent on both the presence of full-length mRNA for mast-cell growth factor and the activity of a protease. Mutations that alter or delete the transmembrane or cytoplasmic portions of mast-cell growth factor, however, may also generate a soluble form of the molecule17.
|
Case Reports
Patient 1
A female infant had diffuse erythema at delivery that was most prominent on the anterior aspect of the trunk. At nine days of age, her skin had a thickened, doughy appearance, with erythematous macules and papules measuring 2 to 4 mm in diameter that urticated on stroking, and tense bullae measuring 1 cm in diameter on the left hand and foot. By one month of age, bullae ranging in size from 5 mm to 5 cm were arising spontaneously in crops and covered 15 percent of the skin surface. Hepatosplenomegaly and systemic signs were absent, and the results of routine blood work were normal, as were plasma histamine levels. Despite therapy with diphenhydramine hydrochloride, 30 percent of the skin surface was covered with bullae by the time the infant was nine weeks of age (Figure 2). A biopsy of the skin showed mastocytosis. Therapy was changed to hydroxyzine hydrochloride and cromolyn sodium. The erythema decreased and the bullous component of the rash stabilized by the time the baby was three months of age; growth and development were within normal limits.
|
A 49-year-old woman presented with multiple pigmented macules that developed wheals after being stroked. Prominent pigmentation of basal keratinocytes and a slight increase in the number of mast cells in the dermis were detected in a biopsy of a pigmented macule, consistent with a diagnosis of urticaria pigmentosa.
Patient 3
A 31-year-old man had an eruption that had persisted unchanged for 20 years. Physical examination revealed numerous reddish brown macules measuring 3 to 4 mm in diameter (Figure 3). Darier's sign was elicited, and the affected skin had a superficial perivascular infiltrate of mast cells.
|
Immunohistochemical Studies
The primary antibody used for immunohistochemical studies was a monoclonal rat IgG2a raised against murine mast-cell growth factor3. The antibody cross-reacts with recombinant human mast-cell growth factor and does not interfere with the binding of the growth factor to c-kit, as demonstrated in a mitogenic assay with normal human melanocytes and human mast-cell growth factor (data not shown). Therefore, we assume the antibody can bind to mast-cell growth factor that is bound to the receptor c-kit at the surface of the cell. Diagnostic biopsy specimens were subjected to standard histologic processing and paraffin embedding. For immunohistochemical studies, the sections were cut and stained with antibody against mast-cell growth factor (1.6 mg per milliliter), which was detected by the use of the avidin-biotin peroxidase complex (Vector Laboratories, Burlingame, Calif.), with 3-amino-9-ethylcarbazole used as a chromogen. Negative controls omitted the primary antibody or substituted an isotype-matched rat monoclonal antibody of irrelevant specificity. Other controls included sections of two seborrheic keratoses and a basal-cell carcinoma from Patient 2, a sample of clinically normal skin from Patient 3, 20 samples of normal skin and skin irradiated with ultraviolet B obtained from plastic-surgery specimens, and biopsy specimens from unrelated patients that were randomly selected from recent accessions to the Yale University Dermatopathology Service, including samples of skin affected by seborrheic keratoses (eight lesions), basal-cell carcinoma (eight lesions), and urticaria (six lesions).
Cell Culture and RNA Samples
Fibroblasts, keratinocytes, and melanocytes were grown from cultures of newborn-foreskin cells as described previously19.
Blister roofs were used to obtain RNA from the infant (Patient 1). The total sample weighed 10 mg and consisted almost exclusively of epidermal cells. For Patients 2 and 3, 3-mm punch-biopsy specimens were taken of a pigmented flat lesion, and separate specimens were taken from adjacent, clinically uninvolved skin. Epidermis was separated from dermis (approximately 3 mg each for Patients 2 and 3), and total epidermal RNA was extracted as previously described20,21. The dermis from each biopsy specimen from Patient 3 (one of clinically normal skin and one of a lesion) was minced with scalpel blades. Total RNA was extracted from dermis and cultured cells as described by Chomczynski and Sacchi21. The RNA for control amplifications was isolated from epidermis and dermis separated from 3-mm punch-biopsy specimens taken ex vivo from normal skin that had not been exposed to sun obtained from plastic-surgery specimens (mammaplasties).
Reverse Transcription
Complementary DNAs (cDNAs) were transcribed from total RNA with avian myeloblastosis virus reverse transcriptase, with random hexamers used as primers (2 pmol per microl, Pharmacia LKB, Piscataway, N.J.), as described previously20.
Oligonucleotide Primers
Six oligonucleotides were synthesized that correspond to specific sequences in cDNA for human mast-cell growth factor (Figure 1): oligonucleotide I, 5'GGGCTGGATCGCAGCGC3'; oligonucleotide II, 5'TGCCAAGTCATTGTTGG3'; oligonucleotide III, 5'CTCCACAAGGTCATCCAC3'; oligonucleotide IV, 5'CTTCAACATTAAGTCCTGAG3'; oligonucleotide V, 5'GTGTAGGCTGGAGTCTCC3'; and oligonucleotide VI, 5'CAGTGTTGATACAAGCCACA3'. Oligonucleotides I and III amplify a product of 367 base pairs (bp) that hybridizes with oligonucleotide II. Oligonucleotides IV and VI amplify a a 359-bp product when exon 6 is present and a 275-bp product when exon 6 is absent. Both products hybridize with oligonucleotide V.
DNA Amplification
We used the following conditions for the amplifications of mast-cell growth factor: 40 cycles each of denaturation at 95 °C for one minute, annealing at 47 °C for one minute for oligonucleotides I and III and at 55 °C for one minute for oligonucleotides IV and VI, and extension at 72 °C for two minutes. To prevent false positive results, pipettes with filtered tips (Scientific Products, Baxter, McGaw Park, Ill.) were used, and cDNA synthesis and preparations for the amplification reactions were carried out in a laboratory separate from the site of amplification, electrophoresis, and blotting. Control mixtures without the template were used with each amplification.
Gel Electrophoresis and Southern Blotting of PRC Products
Twenty microls of each reaction mixture was separated in 1.5 percent agarose gel in 1 x TRIS-borate-EDTA buffer (90 mM TRIS-borate and 2 mM EDTA22) at 6 V per centimeter. The gels were denatured twice in 0.5 M sodium hydroxide and 1.5 M sodium chloride for 15 minutes and then neutralized twice in 1.0 M TRIS-hydrochloric acid, at a pH of 5.0, and 2.0 M sodium chloride for 15 minutes. The amplification products were transferred to nylon membrane in 20 x saline sodium citrate buffer (SSC [1 x SSC = 0.15 M sodium chloride and 0.015 M sodium citrate]) and cross-linked to the dried membrane by ultraviolet-B irradiation for one minute (100 mJ per square centimeter).
Probe Labeling and Hybridization
The probes were end-labeled by polynucleotide kinase with [
]32P-ATP, according to standard methods22. After prehybridization, the blots were hybridized with the radiolabeled probe overnight at 47 °C in 5 x Denhardt's solution (1 x Denhardt's solution = 0.02 percent Ficoll, 0.02 percent polyvinylpyrrolidone, and 0.02 percent bovine serum albumin [fraction V]), 5 x SSC, and 0.5 percent sodium dodecyl sulfate22. The blots were washed twice for 10 minutes in a solution of 2 x SSC and 0.1 percent sodium dodecyl sulfate at room temperature and then washed once for 10 minutes in a solution of 5 x SSC and 0.1 percent sodium dodecyl sulfate at 47 °C. Autoradiography was performed with Kodak XAR film (Eastman Kodak, Rochester, N.Y.) at -70 °C.
Subcloning and Sequencing
The products of PCR amplification were subcloned with a TA cloning kit (Invitrogen, San Diego, Calif.). Sequencing was performed according to the dideoxy-chain-termination method with a Sequenase kit, version 2.0 (United States Biochemical, Cleveland).
Results
The pattern of immunoreactive mast-cell growth factor detected in skin from three patients with cutaneous mastocytosis and from normal subjects is shown in Figure 4. In normal skin, antibodies against mast-cell growth factor stained the keratinocytes in a diffuse, granular pattern consistent with that of intracellular and membrane-bound mast-cell growth factor (Figure 4A and Figure 4B). Dense immunoperoxidase staining of mast-cell growth factor was also seen in a small number of dermal cells distributed in a fashion suggestive of fibroblasts, dermal dendritic cells, or resident mast cells. Occasional granules of immunoreactive material were present in the dermis, usually close to densely stained cells. Immunoreactive mast-cell growth factor was not detected in the extracellular spaces between keratinocytes in any of the 42 control samples examined.
|
Transcripts of the mast-cell growth factor gene were detectable in epidermis from all types of skin samples examined (Figure 5). The samples studied included epidermis from lesions of all three patients, clinically uninvolved skin from Patients 2 and 3, and epidermis from normal controls. Transcripts of mast-cell growth factor were present in cultured keratinocytes but not in cultured melanocytes (Figure 5, lane 8), suggesting that keratinocytes are the primary type of cell capable of making this growth factor in human epidermis.
|
|
To investigate the possibility that a mutation of the gene for mast-cell growth factor was responsible for the soluble form of the factor in patients with mastocytosis, we subcloned and sequenced five independently derived PCR products from the skin of Patient 3. There was no abnormality in the exon sequences of the mast-cell growth factor gene between oligonucleotides IV and VI (Figure 1) in those subclones. This region includes areas in which mutations might cause the production of mitogenically active, soluble mast-cell growth factor17. Because there was no relevant abnormality in the gene of Patient 3, the soluble mast-cell growth factor in this patient appears to be a result of abnormalities occurring after transcription and splicing of the gene's mRNA.
Discussion
These studies indicate that mast-cell growth factor is produced in human skin. There are marked changes in its distribution in the skin of some patients with cutaneous mastocytosis. The changes include focal decreases in mast-cell growth factor associated with keratinocytes and the abnormal presence of the soluble form of the factor in extracellular spaces. Increased levels are also found free in the dermis and are associated with the dermal mast cells. Since mast cells are not known to produce mast-cell growth factor but are known to express abundant c-kit protein, the receptor for mast-cell growth factor,5 it appears likely that the soluble form of the factor is produced by some other type of cell and is present on mast cells bound to c-kit. Taken together, our findings indicate that the metabolism of mast-cell growth factor is altered in some patients with mastocytosis.
These studies demonstrate that normal epidermal keratinocytes produce mast-cell growth factor because keratinocytes are associated with immunoreactive mast-cell growth factor protein and contain full-length mRNA for the growth factor. The decrease in keratinocyte-associated mast-cell growth factor and the presence of the factor between keratinocytes in cutaneous mastocytosis suggest that keratinocytes secrete mast-cell growth factor in mastocytosis. Dermal fibroblasts and dermal dendritic cells are also a potential source of soluble mast-cell growth factor. Whether the soluble form found in the dermis and the mast-cell growth factor associated with the dermal mast cells in cutaneous mastocytosis are derived primarily from dermal fibroblasts, dermal dendritic cells, or keratinocytes, or whether they come from all these cells or another source, remains to be determined experimentally.
The soluble mast-cell growth factor seen in cutaneous mastocytosis could theoretically be due to an abnormality at any level of metabolism. It could come from a gene encoding an abnormal protein or from aberrant regulation of the splicing of the mRNA for mast-cell growth factor. Sequencing of gene products of mast-cell growth factor from one of our patients indicated that the soluble form of the factor and cutaneous mastocytosis can occur without alterations in the portion of the gene encoding the relevant structural elements. In addition, although only the full-length mRNA was detected in the dermis of Patient 3, the fact that exon 6 is well represented in mRNAs from both epidermis and dermis in normal control subjects suggests that cutaneous mastocytosis is not simply the result of altered regulation of the splicing for mast-cell growth factor mRNA, leading to preferential expression of exon 6. Our data indicate that the soluble form of the factor is more likely the result of changes in metabolism occurring after mRNA transcription and splicing rather than the result of changes in the sequence or regulation of the gene itself.
The alteration of the metabolism of mast-cell growth factor in cutaneous mastocytosis might be induced by the mast cells themselves, representing a novel mechanism of neoplasia. However, the observation of extracellular mast-cell growth factor in clinically uninvolved skin and in other lesions from our patients suggests that abnormal collections of mast cells are not necessary for alterations in metabolism and thus that the primary defect in some forms of cutaneous mastocytosis is not in the mast cells but in the metabolism of mast-cell growth factor. Therefore, our findings support the hypothesis that the increased number of mast cells in this disease represents a hyperplastic response rather than a neoplastic process.
Regardless of the specific primary defect present in affected patients, our studies suggest a model for the pathogenesis of some forms of cutaneous mastocytosis. The presence of immunoreactive mast-cell growth factor in the skin, the strong association of the soluble form of the factor with cutaneous mastocytosis, and the known biologic functions of the growth factor suggest that altered cutaneous metabolism of mast-cell growth factor causes the abnormal proliferation of mast cells, resulting in the accumulation of these cells and leading to the signs and symptoms of this disease. This model does not conflict with our observation of altered mast-cell growth factor metabolism in clinically inapparent sites in these patients, since other factors may be involved in the pathogenesis of lesions. In addition, since mast-cell growth factor stimulates the production of melanin by melanocytes (unpublished data), this model could explain the increased melanin pigment in the epidermis in lesions of urticaria pigmentosa.
Supported in part by grants from the National Institutes of Health (1 R29AR40514-01 and 5 R29CA44542-03).
We are indebted to Carol Ember, Lesley Orlowski, Gerry Riley, Judit Stenn, M.D., David Weinstein, and Thomas Duffy, M.D., for their contributions.
Source Information
From the Department of Dermatology (B.J.L., G.S.M., L.T., T.G.D., R.H.) and the Section of Dermatopathology (B.J.L., L.T.), Yale University School of Medicine, New Haven, Conn., and the Departments of Molecular Biology (D.M.A.) and Experimental Hematology (D.E.W.), Immunex Corporation, Seattle.
Address reprint requests to Dr. Longley at Yale University School of Medicine, Department of Dermatology, 333 Cedar St., P.O. Box 3333, LCI 500, New Haven, CT 06510.
References
| |||||||||||||||||||||||||||||||
This article has been cited by other articles:
HOME | SUBSCRIBE | SEARCH | CURRENT ISSUE | PAST ISSUES | COLLECTIONS | PRIVACY | HELP | beta.nejm.org Comments and questions? Please contact us. The New England Journal of Medicine is owned, published, and copyrighted © 2008 Massachusetts Medical Society. All rights reserved. |