FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 328:1302-1307 May 6, 1993 Number 18 Next

Abstract Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

ABSTRACT

Background and Methods The lesions of cutaneous mastocytosis are characterized by dermal infiltrates of mast cells and may appear hyperpigmented because of the presence of increased levels of epidermal melanin. Mast-cell growth factor, the ligand for the product of the c-kit proto-oncogene, stimulates the proliferation of mast cells and increases the production of melanin by melanocytes. We therefore looked for the expression of the mast-cell growth factor gene in the skin of patients with cutaneous mastocytosis using immunohistochemical techniques and the polymerase chain reaction.

Results In the skin of normal subjects and those with unrelated diseases, immunoreactive mast-cell growth factor was associated with keratinocytes and scattered dermal cells, a pattern consistent with cell-bound mast-cell growth factor. In skin samples containing lesions and in clinically normal skin from patients with mastocytosis, however, mast-cell growth factor was also found free in the dermis and in the extracellular spaces between keratinocytes, suggesting the presence of a soluble form of this protein. Messenger RNA (mRNA) that can encode soluble mast-cell growth factor was present in the skin of patients as well as in that of normal control subjects. No sequence abnormalities were detected in mRNA for mast-cell growth factor from one patient.

Conclusions The altered distribution of mast-cell growth factor in the skin of patients with cutaneous mastocytosis is consistent with abnormal production of the soluble form of this factor. This abnormality is probably due to increased proteolytic processing, since it was not explained by differences in the splicing or sequence of mast-cell growth factor mRNA in the patients. Soluble mast-cell growth factor may cause the characteristic accumulation of mast cells and the hyperpigmentation of skin found in cutaneous mastocytosis. These findings suggest that some forms of mastocytosis represent reactive hyperplasia rather than mast-cell neoplasia.

Cutaneous mastocytosis may consist of a solitary mastocytoma, multiple lesions, or diffuse involvement of the skin. One form, urticaria pigmentosa, is characterized by multiple discrete hyperpigmented lesions. As the name urticaria pigmentosa implies, the cutaneous lesions of mastocytosis may be pigmented and may show Darier's sign, which consists of urtication due to mast-cell degranulation after stroking. Infants with cutaneous mastocytosis often have bullous lesions because tissue edema causes the skin to separate at the dermal-epidermal junction, which is relatively poorly developed in early life.

Less commonly, mastocytosis affects the bone marrow or gastrointestinal tract, alone or in addition to producing cutaneous lesions. Rarely, it is associated with hematologic disorders, including mast-cell leukemia². The cause of the mast-cell accumulations has not been identified for any type of mastocytosis, and it is not yet known whether any of the common forms represent a primary neoplasia of mast cells or a reactive hyperplasia.

Mast-cell growth factor is a cytokine and is the ligand for the protein product of the c-kit proto-oncogene. It is also known as stem-cell factor, steel factor, and kit-ligand^{3,4,5,6,7,8,9,10}. Mast-cell growth factor stimulates the growth and differentiation of murine mast cells in vitro^{3,4,5,6,7,10,11}. It also affects mast cells in vivo; for example, injection of the soluble protein into the dermis of rodents causes the accumulation of these cells^7,12. In addition, mast-cell growth factor stimulates the proliferation of melanocytes and the production of melanin in humans¹³ (and unpublished data).

Mast-cell growth factor exists in a form bound to the cell membrane or in a soluble form, and both may have different biologic activities in vivo^{5,6,9,11,14,15,16,17,18}. Normally, the soluble form is produced from the cell-bound form by proteolytic cleavage at a protease-sensitive site adjacent to the cell membrane^{5,6,14,15,16,18}. The protease-sensitive site is encoded by a region of the gene known as exon 6, which may be represented in the final messenger RNA (mRNA) or may be deleted by alternative splicing of the primary gene transcript (Figure 1). Thus, production of the soluble form is normally dependent on both the presence of full-length mRNA for mast-cell growth factor and the activity of a protease. Mutations that alter or delete the transmembrane or cytoplasmic portions of mast-cell growth factor, however, may also generate a soluble form of the molecule¹⁷.

View larger version (6K): [in this window] [in a new window]   Figure 1. Organization of the Products of the Mast-Cell Growth Factor Gene. Mast-cell growth factor mRNA is shown as a solid horizontal line. The thick vertical lines delineate the regions coded by the eight exons, which are indicated by Arabic numerals. The fine vertical lines indicate the limits of the regions coding for the mast-cell growth factor protein as well as the internal domains. The protein, indicated by the boxes, consists of a leader (L), which is removed from the mature protein; an extracellular domain (empty boxes); a hydrophobic transmembrane domain (TM); and a polar cytoplasmic domain (CY). The putative protease-sensitive site is shown near the transmembrane region (hatched area). The locations of the six oligonucleotides used in the study are indicated by the arrows and Roman numerals.

 
To investigate the possible role of mast-cell growth factor in mastocytosis, we used a monoclonal antibody specific for this factor to identify the protein, and the polymerase chain reaction (PCR), a nucleic-acid-amplification technique, to identify mRNA specific for mast-cell growth factor in the skin of three patients with cutaneous mastocytosis.

Case Reports

Patient 1

A female infant had diffuse erythema at delivery that was most prominent on the anterior aspect of the trunk. At nine days of age, her skin had a thickened, doughy appearance, with erythematous macules and papules measuring 2 to 4 mm in diameter that urticated on stroking, and tense bullae measuring 1 cm in diameter on the left hand and foot. By one month of age, bullae ranging in size from 5 mm to 5 cm were arising spontaneously in crops and covered 15 percent of the skin surface. Hepatosplenomegaly and systemic signs were absent, and the results of routine blood work were normal, as were plasma histamine levels. Despite therapy with diphenhydramine hydrochloride, 30 percent of the skin surface was covered with bullae by the time the infant was nine weeks of age (Figure 2). A biopsy of the skin showed mastocytosis. Therapy was changed to hydroxyzine hydrochloride and cromolyn sodium. The erythema decreased and the bullous component of the rash stabilized by the time the baby was three months of age; growth and development were within normal limits.

View larger version (55K): [in this window] [in a new window]   Figure 2. Bullous Mastocytosis in a Nine-Week-Old Girl (Patient 1). There is diffuse thickening of the skin, with bullae over 30 percent of the surface.

 
Patient 2

A 49-year-old woman presented with multiple pigmented macules that developed wheals after being stroked. Prominent pigmentation of basal keratinocytes and a slight increase in the number of mast cells in the dermis were detected in a biopsy of a pigmented macule, consistent with a diagnosis of urticaria pigmentosa.

Patient 3

A 31-year-old man had an eruption that had persisted unchanged for 20 years. Physical examination revealed numerous reddish brown macules measuring 3 to 4 mm in diameter (Figure 3). Darier's sign was elicited, and the affected skin had a superficial perivascular infiltrate of mast cells.

View larger version (72K): [in this window] [in a new window]   Figure 3. Urticaria Pigmentosa in a 31-Year-Old Man (Patient 3). There are thousands of reddish-brown macules, which urticate on stroking.

 
Methods

Immunohistochemical Studies

The primary antibody used for immunohistochemical studies was a monoclonal rat IgG2a raised against murine mast-cell growth factor³. The antibody cross-reacts with recombinant human mast-cell growth factor and does not interfere with the binding of the growth factor to c-kit, as demonstrated in a mitogenic assay with normal human melanocytes and human mast-cell growth factor (data not shown). Therefore, we assume the antibody can bind to mast-cell growth factor that is bound to the receptor c-kit at the surface of the cell. Diagnostic biopsy specimens were subjected to standard histologic processing and paraffin embedding. For immunohistochemical studies, the sections were cut and stained with antibody against mast-cell growth factor (1.6 mg per milliliter), which was detected by the use of the avidin-biotin peroxidase complex (Vector Laboratories, Burlingame, Calif.), with 3-amino-9-ethylcarbazole used as a chromogen. Negative controls omitted the primary antibody or substituted an isotype-matched rat monoclonal antibody of irrelevant specificity. Other controls included sections of two seborrheic keratoses and a basal-cell carcinoma from Patient 2, a sample of clinically normal skin from Patient 3, 20 samples of normal skin and skin irradiated with ultraviolet B obtained from plastic-surgery specimens, and biopsy specimens from unrelated patients that were randomly selected from recent accessions to the Yale University Dermatopathology Service, including samples of skin affected by seborrheic keratoses (eight lesions), basal-cell carcinoma (eight lesions), and urticaria (six lesions).

Cell Culture and RNA Samples

Fibroblasts, keratinocytes, and melanocytes were grown from cultures of newborn-foreskin cells as described previously¹⁹.

Blister roofs were used to obtain RNA from the infant (Patient 1). The total sample weighed 10 mg and consisted almost exclusively of epidermal cells. For Patients 2 and 3, 3-mm punch-biopsy specimens were taken of a pigmented flat lesion, and separate specimens were taken from adjacent, clinically uninvolved skin. Epidermis was separated from dermis (approximately 3 mg each for Patients 2 and 3), and total epidermal RNA was extracted as previously described^20,21. The dermis from each biopsy specimen from Patient 3 (one of clinically normal skin and one of a lesion) was minced with scalpel blades. Total RNA was extracted from dermis and cultured cells as described by Chomczynski and Sacchi²¹. The RNA for control amplifications was isolated from epidermis and dermis separated from 3-mm punch-biopsy specimens taken ex vivo from normal skin that had not been exposed to sun obtained from plastic-surgery specimens (mammaplasties).

Reverse Transcription

Complementary DNAs (cDNAs) were transcribed from total RNA with avian myeloblastosis virus reverse transcriptase, with random hexamers used as primers (2 pmol per microl, Pharmacia LKB, Piscataway, N.J.), as described previously²⁰.

Oligonucleotide Primers

Six oligonucleotides were synthesized that correspond to specific sequences in cDNA for human mast-cell growth factor (Figure 1): oligonucleotide I, 5'GGGCTGGATCGCAGCGC3'; oligonucleotide II, 5'TGCCAAGTCATTGTTGG3'; oligonucleotide III, 5'CTCCACAAGGTCATCCAC3'; oligonucleotide IV, 5'CTTCAACATTAAGTCCTGAG3'; oligonucleotide V, 5'GTGTAGGCTGGAGTCTCC3'; and oligonucleotide VI, 5'CAGTGTTGATACAAGCCACA3'. Oligonucleotides I and III amplify a product of 367 base pairs (bp) that hybridizes with oligonucleotide II. Oligonucleotides IV and VI amplify a a 359-bp product when exon 6 is present and a 275-bp product when exon 6 is absent. Both products hybridize with oligonucleotide V.

DNA Amplification

We used the following conditions for the amplifications of mast-cell growth factor: 40 cycles each of denaturation at 95 °C for one minute, annealing at 47 °C for one minute for oligonucleotides I and III and at 55 °C for one minute for oligonucleotides IV and VI, and extension at 72 °C for two minutes. To prevent false positive results, pipettes with filtered tips (Scientific Products, Baxter, McGaw Park, Ill.) were used, and cDNA synthesis and preparations for the amplification reactions were carried out in a laboratory separate from the site of amplification, electrophoresis, and blotting. Control mixtures without the template were used with each amplification.

Gel Electrophoresis and Southern Blotting of PRC Products

Twenty microls of each reaction mixture was separated in 1.5 percent agarose gel in 1 x TRIS-borate-EDTA buffer (90 mM TRIS-borate and 2 mM EDTA²²) at 6 V per centimeter. The gels were denatured twice in 0.5 M sodium hydroxide and 1.5 M sodium chloride for 15 minutes and then neutralized twice in 1.0 M TRIS-hydrochloric acid, at a pH of 5.0, and 2.0 M sodium chloride for 15 minutes. The amplification products were transferred to nylon membrane in 20 x saline sodium citrate buffer (SSC [1 x SSC = 0.15 M sodium chloride and 0.015 M sodium citrate]) and cross-linked to the dried membrane by ultraviolet-B irradiation for one minute (100 mJ per square centimeter).

Probe Labeling and Hybridization

The probes were end-labeled by polynucleotide kinase with []³²P-ATP, according to standard methods²². After prehybridization, the blots were hybridized with the radiolabeled probe overnight at 47 °C in 5 x Denhardt's solution (1 x Denhardt's solution = 0.02 percent Ficoll, 0.02 percent polyvinylpyrrolidone, and 0.02 percent bovine serum albumin [fraction V]), 5 x SSC, and 0.5 percent sodium dodecyl sulfate²². The blots were washed twice for 10 minutes in a solution of 2 x SSC and 0.1 percent sodium dodecyl sulfate at room temperature and then washed once for 10 minutes in a solution of 5 x SSC and 0.1 percent sodium dodecyl sulfate at 47 °C. Autoradiography was performed with Kodak XAR film (Eastman Kodak, Rochester, N.Y.) at -70 °C.

Subcloning and Sequencing

The products of PCR amplification were subcloned with a TA cloning kit (Invitrogen, San Diego, Calif.). Sequencing was performed according to the dideoxy-chain-termination method with a Sequenase kit, version 2.0 (United States Biochemical, Cleveland).

Results

The pattern of immunoreactive mast-cell growth factor detected in skin from three patients with cutaneous mastocytosis and from normal subjects is shown in Figure 4. In normal skin, antibodies against mast-cell growth factor stained the keratinocytes in a diffuse, granular pattern consistent with that of intracellular and membrane-bound mast-cell growth factor (Figure 4A and Figure 4B). Dense immunoperoxidase staining of mast-cell growth factor was also seen in a small number of dermal cells distributed in a fashion suggestive of fibroblasts, dermal dendritic cells, or resident mast cells. Occasional granules of immunoreactive material were present in the dermis, usually close to densely stained cells. Immunoreactive mast-cell growth factor was not detected in the extracellular spaces between keratinocytes in any of the 42 control samples examined.

View larger version (116K): [in this window] [in a new window]   Figure 4. Samples of Skin from a Normal Subject (Panel A and Panel B), a Patient with Bullous Mastocytosis (Panel C), and a Patient with Urticaria Pigmentosa (Panel D). In Panel A, normal skin that had not been exposed to the sun was subjected to immunoperoxidase staining with antibody against mast-cell growth factor. The immunoreactive mast-cell growth factor protein, which stained red, is arranged in a diffuse pattern associated with keratinocytes, but is not seen in the extracellular spaces (arrowheads). Scattered dermal interstitial cells contain abundant mast-cell growth factor (arrow), and there are hints of the factor in endothelial cells (curved arrow). Panel B shows a serial section of the tissue block from which the section shown in Panel A was taken, in which the primary rat antibody against mast-cell growth factor was replaced by an isotype-matched rat monoclonal antibody of irrelevant specificity. No red staining is evident; only the blue counterstain can be seen. In Panel C, skin from a patient with bullous mastocytosis (Patient 1) was subjected to immunoperoxidase staining with antibody against mast-cell growth factor. Staining of the lesion reveals decreased levels of keratinocyte-associated mast-cell growth factor and increased levels of immunoreactive protein in the extracellular spaces between keratinocytes (small arrows), as compared with the levels in skin samples from normal subjects. Mast-cell growth factor protein is seen in the dermis, associated with interstitial cells and mast cells (large arrows), and as a granular, red reaction product apparently not associated with cells. Panel D shows a biopsy specimen of clinically normal skin from a patient with urticaria pigmentosa (Patient 3). Immunoreactive mast-cell growth factor is present between keratinocytes in the extracellular spaces (arrows). The number of mast cells is within normal limits.

 
Immunoreactive mast-cell growth factor was present in a different pattern in the skin of patients with cutaneous mastocytosis. In marked contrast to the skin from normal subjects, the skin lesions of patients with mastocytosis showed abundant immunoreactive mast-cell growth factor that was present focally outlining keratinocytes in the extracellular spaces and free in the tissue of the papillary dermis (Figure 4C). Mast-cell growth factor was also associated with the dermal mast cells, whose numbers were increased. In the areas in which extracellular mast-cell growth factor was detected, the keratinocytes themselves often showed decreased staining. Extracellular mast-cell growth factor was also identified focally in the epidermis of additional skin-biopsy specimens taken from Patient 2: two seborrheic keratoses and a basal-cell carcinoma. The specimen of clinically normal skin from Patient 3 also showed the extracellular pattern of mast-cell growth factor staining in the epidermis (Figure 4D).

Transcripts of the mast-cell growth factor gene were detectable in epidermis from all types of skin samples examined (Figure 5). The samples studied included epidermis from lesions of all three patients, clinically uninvolved skin from Patients 2 and 3, and epidermis from normal controls. Transcripts of mast-cell growth factor were present in cultured keratinocytes but not in cultured melanocytes (Figure 5, lane 8), suggesting that keratinocytes are the primary type of cell capable of making this growth factor in human epidermis.

View larger version (43K): [in this window] [in a new window]   Figure 5. Identification of Keratinocytes as a Major Source of Mast-Cell Growth Factor mRNA in Human Epidermis. The presence of a band at 367 bp indicates the presence of mRNA specific for mast-cell growth factor. The bands shown in the various lanes were generated from the following samples: lane 1, control plasmid containing full-length cloned cDNA from human mast-cell growth factor14; lane 2, normal epidermis from a plastic-surgery specimen; lane 3, blister roofs from Patient 1; lane 4, clinically uninvolved epidermis from Patient 2; lane 5, clinically involved epidermis from Patient 2; lane 6, uninvolved epidermis from Patient 3; lane 7, involved epidermis from Patient 3; lane 8, cultured melanocytes; and lane 9, cultured normal human keratinocytes. The bands represent PCR amplification of a 367-bp product from cDNAs generated with oligonucleotides I and III as the primers and hybridized with 32P-labeled oligonucleotide II (Figure 1 shows the location of the oligonucleotide primers). The patients' samples were amplified at different times, probed on separate occasions, and exposed for different lengths of time, so these data should not be considered quantitative.

 
For a better understanding of the metabolism of mast-cell growth factor in the skin, we sought to identify copies of exon 6 in the mRNA for the factor. This is the gene segment encoding the extracellular, protease-sensitive site in mast-cell growth factor. In these studies we used a second set of PCR-amplification primers that allowed us to distinguish full-length mRNAs for mast-cell growth factor, which include copies of exon 6, from those that do not. Our results, shown in Figure 6, indicate that mRNAs from both the epidermis and dermis of Patient 3 and from skin from normal controls include exon 6. These in vivo findings are further supported by the observation that full-length mRNAs for mast-cell growth factor are the predominant form in keratinocytes and dermal fibroblasts cultured from normal subjects (data not shown). Thus, the protein product of these mRNAs could be solubilized by protease cleavage¹⁵. These findings have two implications: first, since the full-length transcript is well represented in epidermis and dermis from normal subjects, the lack of the soluble form of the factor in normal skin cannot be explained by a lack of the appropriately spliced mRNA; second, the presence of mRNA for mast-cell growth factor in cultured dermal fibroblasts, combined with the distribution of immunoreactive mast-cell growth factor in the dermis, identifies dermal fibroblasts as another source of the factor in human skin.

View larger version (50K): [in this window] [in a new window]   Figure 6. Detection of Exon 6 in Transcripts of Mast-Cell Growth Factor in Skin Samples from Normal Subjects and from Patients with Cutaneous Mastocytosis. PCR amplification with oligonucleotides IV and VI as primers yields a 359-bp product when exon 6 is present and a 275-bp product when exon 6 has been removed by alternative splicing (Figure 1 shows the location of the oligonucleotide primers). The bands were detected by hybridization with 32P-labeled oligonucleotide V. The numbered lanes contain samples from the following sources: lane 1, control plasmid containing full-length cloned human mast-cell growth factor cDNA14; lane 2, control plasmid containing cloned cDNA from human mast-cell growth factor with exon 6 deleted14; lane 3, normal epidermis from control subjects, which shows reaction products of both sizes, indicating that both types of mast-cell growth factor mRNA are present; lane 4, normal dermis from control subjects, which also shows reaction products of both sizes; lane 5, clinically involved epidermis from Patient 3, showing a pattern similar to that of epidermis from control subjects; and lane 6, dermis from a clinically involved section of skin from Patient 3. Only the larger mRNA for mast-cell growth factor is detected.

 
A shorter mRNA for mast-cell growth factor, lacking exon 6, was also present in all epidermal samples (Figure 6, lanes 3 and 4). The shorter form was detected in samples derived from normal dermis but not in the one sample derived from the dermis of Patient 3 (Figure 6, lane 6). Although strict quantitative comparisons were not made, it is our impression that the amounts of full-length mRNA do not differ by orders of magnitude between skin samples from the patients and those from normal controls.

To investigate the possibility that a mutation of the gene for mast-cell growth factor was responsible for the soluble form of the factor in patients with mastocytosis, we subcloned and sequenced five independently derived PCR products from the skin of Patient 3. There was no abnormality in the exon sequences of the mast-cell growth factor gene between oligonucleotides IV and VI (Figure 1) in those subclones. This region includes areas in which mutations might cause the production of mitogenically active, soluble mast-cell growth factor¹⁷. Because there was no relevant abnormality in the gene of Patient 3, the soluble mast-cell growth factor in this patient appears to be a result of abnormalities occurring after transcription and splicing of the gene's mRNA.

Discussion

These studies indicate that mast-cell growth factor is produced in human skin. There are marked changes in its distribution in the skin of some patients with cutaneous mastocytosis. The changes include focal decreases in mast-cell growth factor associated with keratinocytes and the abnormal presence of the soluble form of the factor in extracellular spaces. Increased levels are also found free in the dermis and are associated with the dermal mast cells. Since mast cells are not known to produce mast-cell growth factor but are known to express abundant c-kit protein, the receptor for mast-cell growth factor,⁵ it appears likely that the soluble form of the factor is produced by some other type of cell and is present on mast cells bound to c-kit. Taken together, our findings indicate that the metabolism of mast-cell growth factor is altered in some patients with mastocytosis.

These studies demonstrate that normal epidermal keratinocytes produce mast-cell growth factor because keratinocytes are associated with immunoreactive mast-cell growth factor protein and contain full-length mRNA for the growth factor. The decrease in keratinocyte-associated mast-cell growth factor and the presence of the factor between keratinocytes in cutaneous mastocytosis suggest that keratinocytes secrete mast-cell growth factor in mastocytosis. Dermal fibroblasts and dermal dendritic cells are also a potential source of soluble mast-cell growth factor. Whether the soluble form found in the dermis and the mast-cell growth factor associated with the dermal mast cells in cutaneous mastocytosis are derived primarily from dermal fibroblasts, dermal dendritic cells, or keratinocytes, or whether they come from all these cells or another source, remains to be determined experimentally.

The soluble mast-cell growth factor seen in cutaneous mastocytosis could theoretically be due to an abnormality at any level of metabolism. It could come from a gene encoding an abnormal protein or from aberrant regulation of the splicing of the mRNA for mast-cell growth factor. Sequencing of gene products of mast-cell growth factor from one of our patients indicated that the soluble form of the factor and cutaneous mastocytosis can occur without alterations in the portion of the gene encoding the relevant structural elements. In addition, although only the full-length mRNA was detected in the dermis of Patient 3, the fact that exon 6 is well represented in mRNAs from both epidermis and dermis in normal control subjects suggests that cutaneous mastocytosis is not simply the result of altered regulation of the splicing for mast-cell growth factor mRNA, leading to preferential expression of exon 6. Our data indicate that the soluble form of the factor is more likely the result of changes in metabolism occurring after mRNA transcription and splicing rather than the result of changes in the sequence or regulation of the gene itself.

The alteration of the metabolism of mast-cell growth factor in cutaneous mastocytosis might be induced by the mast cells themselves, representing a novel mechanism of neoplasia. However, the observation of extracellular mast-cell growth factor in clinically uninvolved skin and in other lesions from our patients suggests that abnormal collections of mast cells are not necessary for alterations in metabolism and thus that the primary defect in some forms of cutaneous mastocytosis is not in the mast cells but in the metabolism of mast-cell growth factor. Therefore, our findings support the hypothesis that the increased number of mast cells in this disease represents a hyperplastic response rather than a neoplastic process.

Regardless of the specific primary defect present in affected patients, our studies suggest a model for the pathogenesis of some forms of cutaneous mastocytosis. The presence of immunoreactive mast-cell growth factor in the skin, the strong association of the soluble form of the factor with cutaneous mastocytosis, and the known biologic functions of the growth factor suggest that altered cutaneous metabolism of mast-cell growth factor causes the abnormal proliferation of mast cells, resulting in the accumulation of these cells and leading to the signs and symptoms of this disease. This model does not conflict with our observation of altered mast-cell growth factor metabolism in clinically inapparent sites in these patients, since other factors may be involved in the pathogenesis of lesions. In addition, since mast-cell growth factor stimulates the production of melanin by melanocytes (unpublished data), this model could explain the increased melanin pigment in the epidermis in lesions of urticaria pigmentosa.

Supported in part by grants from the National Institutes of Health (1 R29AR40514-01 and 5 R29CA44542-03).

We are indebted to Carol Ember, Lesley Orlowski, Gerry Riley, Judit Stenn, M.D., David Weinstein, and Thomas Duffy, M.D., for their contributions.

Source Information

From the Department of Dermatology (B.J.L., G.S.M., L.T., T.G.D., R.H.) and the Section of Dermatopathology (B.J.L., L.T.), Yale University School of Medicine, New Haven, Conn., and the Departments of Molecular Biology (D.M.A.) and Experimental Hematology (D.E.W.), Immunex Corporation, Seattle.

Address reprint requests to Dr. Longley at Yale University School of Medicine, Department of Dermatology, 333 Cedar St., P.O. Box 3333, LCI 500, New Haven, CT 06510.

References

1. Soter NA. The skin in mastocytosis. J Invest Dermatol 1991;96:Suppl:32S-39S. [Medline]
2. Metcalfe DD. Classification and diagnosis of mastocytosis: current status. J Invest Dermatol 1991;96:Suppl:2S-4S. [CrossRef][Medline]
3. Williams DE, Eisenman J, Baird A, et al. Identification of a ligand for the c-kit proto-oncogene. Cell 1990;63:167-174. [CrossRef][Medline]
4. Copeland NG, Gilbert DJ, Cho BC, et al. Mast cell growth factor maps near the steel locus on mouse chromosome 10 and is deleted in a number of steel alleles. Cell 1990;63:175-183. [CrossRef][Medline]
5. Anderson DM, Lyman SD, Baird A, et al. Molecular cloning of mast cell growth factor, a hematopoietin that is active in both membrane bound and soluble forms. Cell 1990;63:235-243. [Erratum, Cell 1990;63:1112a.] [CrossRef][Medline]
6. Zsebo KM, Wypych J, McNiece IK, et al. Identification, purification, and biological characterization of hematopoietic stem cell factor from Buffalo rat liver-conditioned medium. Cell 1990;63:195-201. [CrossRef][Medline]
7. Zsebo KM, Williams DA, Geissler EN, et al. Stem cell factor is encoded at the Sl locus of the mouse and is the ligand for the c-kit tyrosine kinase receptor. Cell 1990;63:213-224. [CrossRef][Medline]
8. Martin FH, Suggs SV, Langley KE, et al. Primary structure and functional expression of rat and human stem cell factor DNAs. Cell 1990;63:203-211. [CrossRef][Medline]
9. Flanagan JG, Leder P. The kit ligand: a cell surface molecule altered in steel mutant fibroblasts. Cell 1990;63:185-194. [CrossRef][Medline]
10. Huang E, Nocka K, Beier DR, et al. The hematopoietic growth factor KL is encoded at the S1 locus and is the ligand of the c-kit receptor, the gene product of the W locus. Cell 1990;63:225-233. [CrossRef][Medline]
11. Onoue H, Ebi Y, Nakayama H, Ru XM, Kitamura Y, Fujita J. Suppressive effect of S1/S1^d mouse embryo-derived fibroblast cell lines on diffusible factor-dependent proliferation of mast cells. Blood 1989;74:1557-1562. [Free Full Text]
12. Tsai M, Shih L-S, Newlands GFJ, et al. The rat c-kit ligand, stem cell factor, induces the development of connective tissue-type and mucosal mast cells in vivo: analysis by anatomical distribution, histochemistry, and protease phenotype. J Exp Med 1991;174:125-131. [Free Full Text]
13. Funasaka Y, Boulton T, Cobb M, et al. c-Kit-kinase induces a cascade of protein tyrosine phosphorylation in normal human melanocytes in response to mast cell growth factor and stimulates mitogen-activated protein kinase but is down-regulated in melanomas. Mol Biol Cell 1992;3:197-209. [Abstract]
14. Anderson DM, Williams DE, Tushinski R, et al. Alternate splicing of mRNAs encoding human mast cell growth factor and localization of the gene to chromosome 12q22-q24. Cell Growth Differ 1991;2:373-378. [Abstract]
15. Lu HS, Clogston CL, Wypych J, et al. Amino acid sequence and post-translational modification of stem cell factor isolated from buffalo rat liver cell-conditioned medium. J Biol Chem 1991;266:8102-8107. [Free Full Text]
16. Flanagan JG, Chan DC, Leder P. Transmembrane form of the kit ligand growth factor is determined by alternative splicing and is missing in the S1^d mutant. Cell 1991;64:1025-1035. [CrossRef][Medline]
17. Brannan CI, Lyman SD, Williams DE, et al. Steel-Dickie mutation encodes a c-kit ligand lacking transmembrane and cytoplasmic domains. Proc Natl Acad Sci U S A 1991;88:4671-4674. [Free Full Text]
18. Huang EJ, Nocka KH, Buck J, Besmer P. Differential expression and processing of two cell associated forms of the kit-ligand: KL-1 and KL-2. Mol Biol Cell 1992;3:349-362. [Abstract]
19. Halaban R, Langdon R, Birchall N, et al. Basic fibroblast growth factor from human keratinocytes is a natural mitogen for melanocytes. J Cell Biol 1988;107:1611-1619. [Free Full Text]
20. Longley J, Ding TG, Cuono C, et al. Isolation, detection, and amplification of intact mRNA from dermatome strips, epidermal sheets, and sorted epidermal cells. J Invest Dermatol 1991;97:974-979. [CrossRef][Medline]
21. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156-159. [Medline]
22. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y.: Cold Spring Harbor Press, 1989.

Abstract Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

This article has been cited by other articles:

• Rodriguez-Carino, C., Fondevila, D., Segales, J., Rabanal, R. M. (2009). Expression of KIT Receptor in Feline Cutaneous Mast Cell Tumors. Vet Pathol 46: 878-883 [Abstract] [Full Text]  
• Metcalfe, D. D. (2008). Mast cells and mastocytosis. Blood 112: 946-956 [Abstract] [Full Text]  
• Link, D. C., Wun, T. (2007). Myeloid disorders. ASH-SAP 2007: 143-171 [Full Text]  
• Hachiya, A., Kobayashi, A., Yoshida, Y., Kitahara, T., Takema, Y., Imokawa, G. (2004). Biphasic Expression of Two Paracrine Melanogenic Cytokines, Stem Cell Factor and Endothelin-1, in Ultraviolet B-Induced Human Melanogenesis. Am. J. Pathol. 165: 2099-2109 [Abstract] [Full Text]  
• Slominski, A., Tobin, D. J., Shibahara, S., Wortsman, J. (2004). Melanin Pigmentation in Mammalian Skin and Its Hormonal Regulation. Physiol. Rev. 84: 1155-1228 [Abstract] [Full Text]  
• Kambe, N., Hiramatsu, H., Shimonaka, M., Fujino, H., Nishikomori, R., Heike, T., Ito, M., Kobayashi, K., Ueyama, Y., Matsuyoshi, N., Miyachi, Y., Nakahata, T. (2004). Development of both human connective tissue-type and mucosal-type mast cells in mice from hematopoietic stem cells with identical distribution pattern to human body. Blood 103: 860-867 [Abstract] [Full Text]  
• Morii, E., Oboki, K., Jippo, T., Kitamura, Y. (2003). Additive effect of mouse genetic background and mutation of MITF gene on decrease of skin mast cells. Blood 101: 1344-1350 [Abstract] [Full Text]  
• de Paulis, A., Minopoli, G., Arbustini, E., de Crescenzo, G., Dal Piaz, F., Pucci, P., Russo, T., Marone, G. (1999). Stem Cell Factor Is Localized in, Released from, and Cleaved by Human Mast Cells. J. Immunol. 163: 2799-2808 [Abstract] [Full Text]  
• Aldenborg, F., Peeker, R., Fall, M., Olofsson, A., Enerback, L. (1998). Metaplastic Transformation of Urinary Bladder Epithelium : Effect on Mast Cell Recruitment, Distribution, and PhenotypeExpression. Am. J. Pathol. 153: 149-157 [Abstract] [Full Text]  
• Kunisada, T., Lu, S.-Z., Yoshida, H., Nishikawa, S., Nishikawa, S.-i., Mizoguchi, M., Hayashi, S.-i., Tyrrell, L., Williams, D. A., Wang, X., Jack Longley, B. (1998). Murine Cutaneous Mastocytosis and Epidermal Melanocytosis Induced by Keratinocyte Expression of Transgenic Stem Cell Factor. JEM 187: 1565-1573 [Abstract] [Full Text]  
• Patella, V., Marino, I., Arbustini, E., Lamparter-Schummert, B., Verga, L., Adt, M., Marone, G. (1998). Stem Cell Factor in Mast Cells and Increased Mast Cell Density in Idiopathic and Ischemic Cardiomyopathy. Circulation 97: 971-978 [Abstract] [Full Text]  
• Leung, D. Y. M., Diaz, L. A., DeLeo, V., Soter, N. A. (1997). Allergic and Immunologic Skin Disorders. JAMA 278: 1914-1923 [Abstract]  
• Longley, B. J., Tyrrell, L., Ma, Y., Williams, D. A., Halaban, R., Langley, K., Lu, H. S., Schechter, N. M. (1997). Chymase cleavage of stem cell factor yields a bioactive, soluble product. Proc. Natl. Acad. Sci. USA 94: 9017-9021 [Abstract] [Full Text]  
• Broudy, V. C. (1997). Stem Cell Factor and Hematopoiesis. Blood 90: 1345-1364 [Full Text]  
• Lerner, L. H., Bailey, E. M. (1996). Case 18-1996- A newborn boy with multiple hemorrhagic vesicles, lymphadenopathy, and respiratory distress. NEJM 334: 1591-1597 [Full Text]  
• Bedell, M A, Brannan, C I, Evans, E P, Copeland, N G, Jenkins, N A, Donovan, P J (1995). DNA rearrangements located over 100 kb 5' of the Steel (Sl)-coding region in Steel-panda and Steel-contrasted mice deregulate Sl expression and cause female sterility by disrupting ovarian follicle development.. Genes Dev. 9: 455-470 [Abstract]  
• Bankl, H. C., Radaszkiewicz, T., Klappacher, G. W., Glogar, D., Sperr, W. R., Großschmidt, K., Bankl, H., Lechner, K., Valent, P. (1995). Increase and Redistribution of Cardiac Mast Cells in Auricular Thrombosis : Possible Role of kit Ligand. Circulation 91: 275-283 [Abstract] [Full Text]  
• (1993). Mast-Cell Growth Factor in Cutaneous Mastocytosis. Journal Watch Dermatology 1993: 10-10 [Full Text]  
• Imokawa, G., Kobayasi, T., Miyagishi, M. (2000). Intracellular Signaling Mechanisms Leading to Synergistic Effects of Endothelin-1 and Stem Cell Factor on Proliferation of Cultured Human Melanocytes. CROSS-TALK VIA TRANS-ACTIVATION OF THE TYROSINE KINASE c-KIT RECEPTOR. J. Biol. Chem. 275: 33321-33328 [Abstract] [Full Text]