| |||||||||||||||||||||||
Renal unresponsiveness to vasopressin clearly underlies the pathogenesis of nephrogenic diabetes insipidus. The action of vasopressin is mediated by two different receptors3. The vasoconstrictive actions result from the activation of vasopressin V1 receptors, causing an increase in intracellular concentrations of inositol trisphosphate and calcium. The resorption of water by the distal convoluted tubule and collecting duct of the nephron is mediated by vasopressin binding to vasopressin V2 receptors, with generation of intracellular cyclic AMP (cAMP).
Patients with nephrogenic diabetes insipidus have a defect in the V2-receptor signaling pathway, but their V1-receptor signaling is normal4. Such a defect could theoretically occur anywhere in the signaling cascade, from the receptor to the molecules that are substrates for cAMP-dependent protein kinase. The patients have a normal increase in urinary cAMP excretion after the administration of parathyroid hormone5 and a normal increase in plasma cAMP levels after epinephrine infusion,6 indicating that there is no general impairment in the generation of cAMP. Studies of the response of urinary cAMP to vasopressin have been difficult to interpret because the response in normal subjects is small and variable, making it difficult to detect subnormal responses, but such studies have suggested that a defect occurs in the cascade before adenylate cyclase, perhaps in the receptor molecule itself6,7. Further evidence implicating a defective V2 receptor in nephrogenic diabetes insipidus has come from genetic-linkage studies. These studies showed close linkage of nephrogenic diabetes insipidus to chromosome Xq28,8,9 a finding consistent with the X-linked inheritance pattern of the disease. In another study, hybrid rodent cell lines carrying the q28 region of the human X chromosome were shown to express functional V2 receptors not possessed by the parental cells10.
Recently, the complementary DNA (cDNA) sequence for the V2 receptor was cloned11,12. When the cDNA was used as a probe, the V2-receptor gene was localized to Xq28,11 strongly suggesting that the receptor itself may be the site of the defect in X-linked nephrogenic diabetes insipidus. We report a mutation in the V2-receptor gene in the affected members of a family with the disorder. This defect disrupts 40 percent of the receptor sequence at the carboxyl terminal, thus producing renal resistance to vasopressin.
Methods
Patients
The proband (Subject III-2, Figure 1) was the child of Lithuanian immigrants, born after a pregnancy complicated by hydramnios. His birth weight was 3.4 kg. He was breast-fed and did well for the first five months, but had progressive growth failure as formula and solid foods were substituted for breast milk. When he was first referred for consultation at the age of 13 months, his mother was well aware of his need for large amounts of water. At this time the infant was dehydrated and wasted and had hypernatremia and severe hyposmotic polyuria unresponsive to exogenous vasopressin or desmopressin. The mother (Subject II-1) was an only child, and there was no family history of nephrogenic diabetes insipidus. The child was treated with a high-calorie diet with low solute concentrations, a liberal water intake, and a thiazide diuretic, to which he responded with decreased plasma hypertonicity, improved urinary concentrating ability, a moderate reduction in urine volume, and rapid weight gain. The mother subsequently gave birth to fraternal male twins (Subjects III-3 and III-4); one twin had polyuria (Subject III-3, Figure 1). When 10 weeks old, the affected boy was found to have an increased plasma vasopressin concentration (12.2 pg per milliliter [11.0 pmol per liter]) when the plasma osmolality was 298 mOsm per kilogram. Although treatment was instituted at that time, this child's growth during the first eight years of life was inferior to that of his twin.
|
|
Genomic DNA was isolated from the blood of patients and control subjects as previously described15. Southern blot analysis was performed with DNA (20 µg per lane) digested with the restriction endonuclease HindIII, BamHI, or XbaI11. The blots were probed with a 32P-labeled 428-bp (base pair) fragment of human V2-receptor cDNA. The sequences of oligonucleotide primers used for the polymerase chain reaction (PCR)16 were 5'CTTGGGCCTTCTCGCTCCTTCTCAGCCTGC3' and 5'CGTCATCCTCACAGTCTTGGCCACAGC3', which give rise to a 332-bp fragment coding for a region extending from the fourth to the sixth transmembrane domains of the V2 receptor. The PCR was carried out with 1 µg of genomic DNA, 500 nmol of each oligonucleotide per liter, 200 µmol of each nucleotide triphosphate per liter, 1.5 mmol of magnesium chloride per liter, and 2.5 U of Taq DNA polymerase in standard PCR buffer (Perkin-Elmer Cetus) in a final volume of 100 microl. The reactions were performed with a thermocycler (Perkin-Elmer Cetus). After initial heating of the reaction mixture to 94 °C for 5 minutes, 30 cycles of two-step amplification were performed, with annealing and extension together at 72 °C for 1 minute and then melting at 94 °C for 45 seconds; the final annealing and extension step lasted 3 minutes. This reaction yielded a single band of DNA of the appropriate size, which was purified with a commercially available silicon-based resin (Magic PCR Preps, Promega). The PCR product was then either treated with T4 DNA polymerase and T4 polynucleotide kinase (New England Biolabs) to generate blunt, phosphorylated ends for subcloning into the HincII site of M13mp18, or digested overnight with the restriction endonuclease EarI. Sequencing of single-stranded endonuclease DNA was performed on multiple subclones11.
Results
Southern blot analysis with a 428-bp probe extending from the regions coding for the third to the fifth membrane-spanning domains of the V2 receptor revealed no evidence of major gene deletions or rearrangements (data not shown). To identify more subtle mutations, DNA was amplified by PCR for subcloning and sequencing. The DNA of the proband (Subject III-2) contained an additional cytosine residue inserted into the codon for isoleucine-228 (Figure 3, upper panel). This mutation was confirmed by sequencing multiple subclones of the PCR product from this patient in both directions. The DNA of the affected twin (Subject III-3) had the same mutation; the mother had a mixture of mutant and normal sequences that was consistent with her carrier status. Sequencing of DNA from seven normal subjects revealed no similar mutation.
|
The insertion of the additional cytosine residue generated the DNA sequence 5'CTCTTC3', a recognition site for the restriction endonuclease EarI. Digesting DNA from this portion of the gene with EarI could therefore be used as an independent method to detect this mutation. Figure 1 shows the results of this analysis. The 332-bp PCR fragment was generated from the DNA of three generations of maternal relatives and several unrelated normal subjects. The PCR product was then subjected to digestion with EarI, and the fragments were separated by polyacrylamide-gel electrophoresis. The normal DNA sequence in this region contains an EarI recognition site 42 bp from the upstream PCR oligonucleotide primer. Thus, in normal subjects a DNA fragment of 290 bp resulted from this digestion, and this pattern was found in the unaffected male members of the proband's family. The introduction of the additional cytosine residue created a second recognition site, so that the mutant 291-bp fragment was cleaved into fragments of 160 bp and 131 bp, as in both affected sons. The DNA fragments of the mother and the maternal grandmother consisted of a mixture of the normal 290-bp fragment and the mutant fragments of 160 bp and 131 bp, confirming their status as heterozygous carriers of the mutant gene.
Discussion
Our results strongly suggest that the mutation within the vasopressin V2-receptor gene reported here is the cause of nephrogenic diabetes insipidus in the family studied. Given the genetic linkage of the disorder to chromosome Xq28, the chromosomal localization of the V2 gene to this same locus, and the fact that the biochemical abnormalities in this disease are consistent with impairment of the V2-receptor signaling pathway, there was ample reason to suspect a defect in this gene. The vasopressin V2 receptor belongs to a family of G protein-coupled receptors that transmit their signals by interacting with one or more membrane-associated proteins that bind guanosine triphosphate17. These receptors share a number of features, including seven distinct membrane-spanning domains. We found a mutation within the V2-receptor gene in two brothers with nephrogenic diabetes insipidus and observed both mutant and normal alleles in their mother, an obligate carrier, and their maternal grandmother. Since the frame shift resulting from this mutation would disrupt a large part of the receptor molecule known to be important in transmembrane signaling,17 there is little doubt that the protein product of the mutant gene, if expressed, would be inactive, resulting in a state consistent with the complete vasopressin resistance in the proband of this kindred. Mutant 
-adrenergic receptors with similar premature truncations do not bind ligand or stimulate adenylate cyclase18. The partial resistance to vasopressin in the mother presumably resulted from random inactivation of the X chromosome containing the normal V2-receptor allele in a sufficient proportion of renal tubular cells to compromise normal responsiveness to arginine vasopressin.
End-organ resistance to hormones that is due to receptor mutations has been demonstrated for several classes of hormone receptors, including steroid hormone receptors in vitamin D-resistant rickets,19 tyrosine kinase hormone receptors in severe insulin resistance,20 and thyroid hormone receptors in thyroid hormone resistance21. We describe an example of hormone resistance resulting from a mutation in a G protein-coupled receptor. The opsins found in retinal photoreceptor cells are also members of the G protein-coupled receptor family17. A mutation encoding a premature termination codon in the rhodopsin gene, in the same region as that of the vasopressin V2-receptor mutation described here, was shown to cause complete loss of normal receptor function in a patient with autosomal recessive retinitis pigmentosa22.
The severity of polyuria in patients with nephrogenic diabetes insipidus varies,2 probably because of the heterogeneity of the mutations that cause the disorder. Other mutations in the V2-receptor gene have been identified in other kindreds with X-linked nephrogenic diabetes insipidus,23,24,25 and we have identified different mutations in two additional kindreds (unpublished data). It is possible that the incomplete resistance to vasopressin in some male subjects with X-linked nephrogenic diabetes insipidus26 may be due to mutations that result in partially functional receptor molecules. The finding of specific mutations within the V2-receptor gene has clinical importance. The identification of a kindred-specific mutation in a woman whose carrier status is unknown could lead to earlier diagnosis and treatment of affected offspring. Understanding the nature of defective V2-receptor function in nephrogenic diabetes insipidus may ultimately lead to improved therapy.
Supported in part by a grant from Ciba-Geigy (to Dr. O'Carroll) and by grants from the National Alliance for Research on Schizophrenia and Depression and the Stanley Foundation (to Dr. Lolait).
We are indebted to Dr. Gary L. Robertson for performing the vasopressin assays and to Dr. Eitan Friedman for his assistance in the early phases of this project.
Source Information
From the Molecular Pathophysiology Branch, National Institute of Diabetes, Digestive and Kidney Diseases (J.J.M., A.M.S.), and the Laboratory of Cell Biology, National Institute of Mental Health (A.-M.O., M.J.B., S.J.L.), National Institutes of Health, Bethesda, Md., and the Children's Service, Massachusetts General Hospital, Boston (J.D.C.).
Address reprint requests to Dr. Merendino at the National Institutes of Health, Bldg. 10, Rm. 8C-101, Bethesda, MD 20892.
References
2-adrenergic receptors expressed in Xenopus oocytes. J Biol Chem 1987;262:15796-15802. gene by denaturing gradient gel electrophoresis in 18 families with thyroid hormone resistance. J Clin Endocrinol Metab 1992;74:712-719. [Abstract]
| |||||||||||||||||||||||
This article has been cited by other articles:
HOME | SUBSCRIBE | SEARCH | CURRENT ISSUE | PAST ISSUES | COLLECTIONS | PRIVACY | TERMS OF USE | HELP | beta.nejm.org Comments and questions? Please contact us. The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved. |
Previous
