The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
Original Article
Brief Report
PreviousPrevious
Volume 328:1538-1541 May 27, 1993 Number 21
NextNext

A Mutation in the Vasopressin V2-Receptor Gene in a Kindred with X-Linked Nephrogenic Diabetes Insipidus
John J. Merendino, Allen M. Spiegel, John D. Crawford, Anne-Marie O'Carroll, Michael J. Brownstein, and Stephen J. Lolait

 

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation
Hereditary nephrogenic diabetes insipidus is a rare, X-linked disorder manifested by an inability to concentrate the urine despite high plasma concentrations of arginine vasopressin or the administration of large doses of vasopressin or its analogues1,2. Affected males have profound hyposmotic polyuria soon after birth, often leading to recurrent episodes of severe dehydration. Unless recognized and treated early, these episodes may lead to failure to thrive, growth retardation, repeated bouts of cerebral edema with resultant mental retardation, or death. Females who are carriers of the gene for the disease have symptoms that range from a defective urinary-concentrating ability demonstrable only on provocative testing to polyuria nearly as severe as that in affected male subjects.

Renal unresponsiveness to vasopressin clearly underlies the pathogenesis of nephrogenic diabetes insipidus. The action of vasopressin is mediated by two different receptors3. The vasoconstrictive actions result from the activation of vasopressin V1 receptors, causing an increase in intracellular concentrations of inositol trisphosphate and calcium. The resorption of water by the distal convoluted tubule and collecting duct of the nephron is mediated by vasopressin binding to vasopressin V2 receptors, with generation of intracellular cyclic AMP (cAMP).

Patients with nephrogenic diabetes insipidus have a defect in the V2-receptor signaling pathway, but their V1-receptor signaling is normal4. Such a defect could theoretically occur anywhere in the signaling cascade, from the receptor to the molecules that are substrates for cAMP-dependent protein kinase. The patients have a normal increase in urinary cAMP excretion after the administration of parathyroid hormone5 and a normal increase in plasma cAMP levels after epinephrine infusion,6 indicating that there is no general impairment in the generation of cAMP. Studies of the response of urinary cAMP to vasopressin have been difficult to interpret because the response in normal subjects is small and variable, making it difficult to detect subnormal responses, but such studies have suggested that a defect occurs in the cascade before adenylate cyclase, perhaps in the receptor molecule itself6,7. Further evidence implicating a defective V2 receptor in nephrogenic diabetes insipidus has come from genetic-linkage studies. These studies showed close linkage of nephrogenic diabetes insipidus to chromosome Xq28,8,9 a finding consistent with the X-linked inheritance pattern of the disease. In another study, hybrid rodent cell lines carrying the q28 region of the human X chromosome were shown to express functional V2 receptors not possessed by the parental cells10.

Recently, the complementary DNA (cDNA) sequence for the V2 receptor was cloned11,12. When the cDNA was used as a probe, the V2-receptor gene was localized to Xq28,11 strongly suggesting that the receptor itself may be the site of the defect in X-linked nephrogenic diabetes insipidus. We report a mutation in the V2-receptor gene in the affected members of a family with the disorder. This defect disrupts 40 percent of the receptor sequence at the carboxyl terminal, thus producing renal resistance to vasopressin.

Methods

Patients

The proband (Subject III-2, Figure 1) was the child of Lithuanian immigrants, born after a pregnancy complicated by hydramnios. His birth weight was 3.4 kg. He was breast-fed and did well for the first five months, but had progressive growth failure as formula and solid foods were substituted for breast milk. When he was first referred for consultation at the age of 13 months, his mother was well aware of his need for large amounts of water. At this time the infant was dehydrated and wasted and had hypernatremia and severe hyposmotic polyuria unresponsive to exogenous vasopressin or desmopressin. The mother (Subject II-1) was an only child, and there was no family history of nephrogenic diabetes insipidus. The child was treated with a high-calorie diet with low solute concentrations, a liberal water intake, and a thiazide diuretic, to which he responded with decreased plasma hypertonicity, improved urinary concentrating ability, a moderate reduction in urine volume, and rapid weight gain. The mother subsequently gave birth to fraternal male twins (Subjects III-3 and III-4); one twin had polyuria (Subject III-3, Figure 1). When 10 weeks old, the affected boy was found to have an increased plasma vasopressin concentration (12.2 pg per milliliter [11.0 pmol per liter]) when the plasma osmolality was 298 mOsm per kilogram. Although treatment was instituted at that time, this child's growth during the first eight years of life was inferior to that of his twin.


View larger version (37K):
[in this window]
[in a new window]
 
Figure 1. Pedigree of a Family with Nephrogenic Diabetes Insipidus and the Results of Polyacrylamide-Gel Electrophoresis of DNA Fragments from the Family and a Normal Subject.

The lower panel shows the DNA fragments resulting from digestion with the restriction endonuclease EarI. The uncut normal DNA fragment is 332 bp long; the uncut mutant fragment (not shown) is 333 bp long because of the single-base insertion. The sequence contains a normal EarI recognition site 42 bp from the 5' end of the coding strand. Thus, the DNA from the normal subject and that of the unaffected male subjects (open squares) are digested to two fragments 290 and 42 bp long (the 42-bp fragment is not shown). The mutant DNA has a new EarI recognition site produced by the insertion of a cytosine residue, so that it is cut into three segments of 160, 131, and 42 bp. Since the two affected male subjects (solid squares) were homozygous for the mutant gene, they had only these bands on electrophoresis (upper panel). In contrast, the mother and the maternal grandmother (half-solid circles) had a mixture of normal DNA, which yields an uncut 290-bp fragment, and mutant DNA with fragments of 160 and 131 bp, confirming their heterozygosity for the mutant gene.

 
Figure 2 shows vasopressin concentrations in relation to urinary osmolality during recent water-deprivation testing of the proband (age, 12 years 3 months) and his mother. Plasma arginine vasopressin was measured with a modification13 of a previously described radioimmunoassay14. The results demonstrated complete renal unresponsiveness to vasopressin in the proband, with a maximally dilute urine despite high plasma arginine vasopressin concentrations. Subcutaneous administration of 2 µg of desmopressin failed to raise the urinary osmolality. The mother had partial renal resistance to vasopressin, with a rightward shift in the curve relating plasma arginine vasopressin to urinary osmolality.


View larger version (70K):
[in this window]
[in a new window]
 
Figure 2. Plasma Vasopressin Concentrations in Relation to Urinary Osmolality in the Proband and His Mother during Water-Deprivation Testing.

The shaded area represents the range of normal values. The proband had complete resistance to vasopressin; the mother had mild resistance, resulting in a rightward shift in the dose-response curve. To convert values for plasma vasopressin to picomoles per liter, multiply by 0.9.

 
DNA Preparation and Analysis

Genomic DNA was isolated from the blood of patients and control subjects as previously described15. Southern blot analysis was performed with DNA (20 µg per lane) digested with the restriction endonuclease HindIII, BamHI, or XbaI11. The blots were probed with a 32P-labeled 428-bp (base pair) fragment of human V2-receptor cDNA. The sequences of oligonucleotide primers used for the polymerase chain reaction (PCR)16 were 5'CTTGGGCCTTCTCGCTCCTTCTCAGCCTGC3' and 5'CGTCATCCTCACAGTCTTGGCCACAGC3', which give rise to a 332-bp fragment coding for a region extending from the fourth to the sixth transmembrane domains of the V2 receptor. The PCR was carried out with 1 µg of genomic DNA, 500 nmol of each oligonucleotide per liter, 200 µmol of each nucleotide triphosphate per liter, 1.5 mmol of magnesium chloride per liter, and 2.5 U of Taq DNA polymerase in standard PCR buffer (Perkin-Elmer Cetus) in a final volume of 100 microl. The reactions were performed with a thermocycler (Perkin-Elmer Cetus). After initial heating of the reaction mixture to 94 °C for 5 minutes, 30 cycles of two-step amplification were performed, with annealing and extension together at 72 °C for 1 minute and then melting at 94 °C for 45 seconds; the final annealing and extension step lasted 3 minutes. This reaction yielded a single band of DNA of the appropriate size, which was purified with a commercially available silicon-based resin (Magic PCR Preps, Promega). The PCR product was then either treated with T4 DNA polymerase and T4 polynucleotide kinase (New England Biolabs) to generate blunt, phosphorylated ends for subcloning into the HincII site of M13mp18, or digested overnight with the restriction endonuclease EarI. Sequencing of single-stranded endonuclease DNA was performed on multiple subclones11.

Results

Southern blot analysis with a 428-bp probe extending from the regions coding for the third to the fifth membrane-spanning domains of the V2 receptor revealed no evidence of major gene deletions or rearrangements (data not shown). To identify more subtle mutations, DNA was amplified by PCR for subcloning and sequencing. The DNA of the proband (Subject III-2) contained an additional cytosine residue inserted into the codon for isoleucine-228 (Figure 3, upper panel). This mutation was confirmed by sequencing multiple subclones of the PCR product from this patient in both directions. The DNA of the affected twin (Subject III-3) had the same mutation; the mother had a mixture of mutant and normal sequences that was consistent with her carrier status. Sequencing of DNA from seven normal subjects revealed no similar mutation.


View larger version (117K):
[in this window]
[in a new window]
 
Figure 3. Molecular Genetic Analysis of DNA and Protein Sequences of the Vasopressin V2 Receptor in a Normal Subject and a Patient with Nephrogenic Diabetes Insipidus.

The upper panel shows the DNA sequence in the normal subject and the proband. The DNA and protein sequences are read from bottom to top (arrow at left). The insertion of a cytosine residue (double-headed arrow) disrupts the protein translation reading frame. The first three abnormal amino acids (boldface type) resulting from the frame shift are shown at the upper right.

The lower panel shows the consequences of the frame-shift mutation in the predicted protein product in the proband. From the point of the base-pair insertion onward the protein translation is shifted, resulting in a missense sequence. In addition, after approximately 20 amino acid residues of the missense sequence, there is a premature stop codon that halts protein synthesis. Thus, nearly 40 percent of the amino acid residues at the carboxyl terminal of the receptor are disrupted by this mutation.

 
The insertion of a single cytosine at this point in the V2-receptor sequence shifted the reading frame for protein translation. As a consequence of this change in the predicted protein sequence, 40 percent of the receptor sequence at the carboxyl terminal was disrupted, first by the generation of a missense amino acid sequence and then by premature termination (Figure 3, lower panel).

The insertion of the additional cytosine residue generated the DNA sequence 5'CTCTTC3', a recognition site for the restriction endonuclease EarI. Digesting DNA from this portion of the gene with EarI could therefore be used as an independent method to detect this mutation. Figure 1 shows the results of this analysis. The 332-bp PCR fragment was generated from the DNA of three generations of maternal relatives and several unrelated normal subjects. The PCR product was then subjected to digestion with EarI, and the fragments were separated by polyacrylamide-gel electrophoresis. The normal DNA sequence in this region contains an EarI recognition site 42 bp from the upstream PCR oligonucleotide primer. Thus, in normal subjects a DNA fragment of 290 bp resulted from this digestion, and this pattern was found in the unaffected male members of the proband's family. The introduction of the additional cytosine residue created a second recognition site, so that the mutant 291-bp fragment was cleaved into fragments of 160 bp and 131 bp, as in both affected sons. The DNA fragments of the mother and the maternal grandmother consisted of a mixture of the normal 290-bp fragment and the mutant fragments of 160 bp and 131 bp, confirming their status as heterozygous carriers of the mutant gene.

Discussion

Our results strongly suggest that the mutation within the vasopressin V2-receptor gene reported here is the cause of nephrogenic diabetes insipidus in the family studied. Given the genetic linkage of the disorder to chromosome Xq28, the chromosomal localization of the V2 gene to this same locus, and the fact that the biochemical abnormalities in this disease are consistent with impairment of the V2-receptor signaling pathway, there was ample reason to suspect a defect in this gene. The vasopressin V2 receptor belongs to a family of G protein-coupled receptors that transmit their signals by interacting with one or more membrane-associated proteins that bind guanosine triphosphate17. These receptors share a number of features, including seven distinct membrane-spanning domains. We found a mutation within the V2-receptor gene in two brothers with nephrogenic diabetes insipidus and observed both mutant and normal alleles in their mother, an obligate carrier, and their maternal grandmother. Since the frame shift resulting from this mutation would disrupt a large part of the receptor molecule known to be important in transmembrane signaling,17 there is little doubt that the protein product of the mutant gene, if expressed, would be inactive, resulting in a state consistent with the complete vasopressin resistance in the proband of this kindred. Mutant {beta}-adrenergic receptors with similar premature truncations do not bind ligand or stimulate adenylate cyclase18. The partial resistance to vasopressin in the mother presumably resulted from random inactivation of the X chromosome containing the normal V2-receptor allele in a sufficient proportion of renal tubular cells to compromise normal responsiveness to arginine vasopressin.

End-organ resistance to hormones that is due to receptor mutations has been demonstrated for several classes of hormone receptors, including steroid hormone receptors in vitamin D-resistant rickets,19 tyrosine kinase hormone receptors in severe insulin resistance,20 and thyroid hormone receptors in thyroid hormone resistance21. We describe an example of hormone resistance resulting from a mutation in a G protein-coupled receptor. The opsins found in retinal photoreceptor cells are also members of the G protein-coupled receptor family17. A mutation encoding a premature termination codon in the rhodopsin gene, in the same region as that of the vasopressin V2-receptor mutation described here, was shown to cause complete loss of normal receptor function in a patient with autosomal recessive retinitis pigmentosa22.

The severity of polyuria in patients with nephrogenic diabetes insipidus varies,2 probably because of the heterogeneity of the mutations that cause the disorder. Other mutations in the V2-receptor gene have been identified in other kindreds with X-linked nephrogenic diabetes insipidus,23,24,25 and we have identified different mutations in two additional kindreds (unpublished data). It is possible that the incomplete resistance to vasopressin in some male subjects with X-linked nephrogenic diabetes insipidus26 may be due to mutations that result in partially functional receptor molecules. The finding of specific mutations within the V2-receptor gene has clinical importance. The identification of a kindred-specific mutation in a woman whose carrier status is unknown could lead to earlier diagnosis and treatment of affected offspring. Understanding the nature of defective V2-receptor function in nephrogenic diabetes insipidus may ultimately lead to improved therapy.

Supported in part by a grant from Ciba-Geigy (to Dr. O'Carroll) and by grants from the National Alliance for Research on Schizophrenia and Depression and the Stanley Foundation (to Dr. Lolait).

We are indebted to Dr. Gary L. Robertson for performing the vasopressin assays and to Dr. Eitan Friedman for his assistance in the early phases of this project.


Source Information

From the Molecular Pathophysiology Branch, National Institute of Diabetes, Digestive and Kidney Diseases (J.J.M., A.M.S.), and the Laboratory of Cell Biology, National Institute of Mental Health (A.-M.O., M.J.B., S.J.L.), National Institutes of Health, Bethesda, Md., and the Children's Service, Massachusetts General Hospital, Boston (J.D.C.).

Address reprint requests to Dr. Merendino at the National Institutes of Health, Bldg. 10, Rm. 8C-101, Bethesda, MD 20892.

References

  1. Bichet DG. Hereditary nephrogenic diabetes insipidus. Adv Nephrol Necker Hosp 1991;20:175-189. [Medline]
  2. Niaudet P, Dechaux M, Trivin C, Loirat C, Broyer M. Nephrogenic diabetes insipidus: clinical and pathophysiological aspects. Adv Nephrol Necker Hosp 1984;13:247-260. [Medline]
  3. Jard S, Barberis C, Audigier S, Tribollet E. Neurohypophyseal hormone receptor systems in brain and periphery. Prog Brain Res 1987;72:173-187. [Medline]
  4. Bichet DG, Arthus MF, Lonergan M. Platelet vasopressin receptors in patients with congenital nephrogenic diabetes insipidus. Kidney Int 1991;39:693-699. [CrossRef][Medline]
  5. Moses AM, Coulson BB. Absence of overlapping resistance to vasopressin and parathyroid hormone in patients with nephrogenic diabetes insipidus and pseudohypoparathyroidism. J Clin Endocrinol Metab 1982;55:699-702. [Free Full Text]
  6. Bichet DG, Razi M, Arthus MF, et al. Epinephrine and dDAVP administration in patients with congenital nephrogenic diabetes insipidus: evidence for a pre-cyclic AMP V2 receptor defective mechanism. Kidney Int 1989;36:859-866. [Medline]
  7. Bell NH, Clark CM Jr, Avery S, Sinha T, Trygstad CW, Allen DO. Demonstration of a defect in the formation of adenosine 3',5'-monophosphate in vasopressin-resistant diabetes insipidus. Pediatr Res 1974;8:223-230.
  8. Knoers N, van der Heyden H, van Oost BA, Ropers HH, Monnens L, Willems J. Nephrogenic diabetes insipidus: close linkage with markers from the distal long arm of the human X chromosome. Hum Genet 1988;80:31-38. [CrossRef][Medline]
  9. Kambouris M, Dlouhy SR, Trofatter JA, Conneally PM, Hodes ME. Localization of the gene for X-linked nephrogenic diabetes insipidus to Xq28. Am J Med Genet 1988;29:239-246. [CrossRef][Medline]
  10. Jans DA, van Oost BA, Ropers HH, Fahrenholz F. Derivatives of somatic cell hybrids which carry the human gene locus for nephrogenic diabetes insipidus (NDI) express functional vasopressin renal V2-type receptors. J Biol Chem 1990;265:15379-15382. [Free Full Text]
  11. Lolait SJ, O'Carroll AM, McBride OW, Konig M, Morel A, Brownstein MJ. Cloning and characterization of a vasopressin V2 receptor and possible link to nephrogenic diabetes insipidus. Nature 1992;357:336-339. [CrossRef][Medline]
  12. Birnbaumer M, Seibold A, Gilbert S, et al. Molecular cloning of the receptor for human antidiuretic hormone. Nature 1992;357:333-335. [CrossRef][Medline]
  13. Davison JM, Gilmore EA, Durr J, Robertson GL, Lindheimer MD. Altered osmotic thresholds for vasopressin secretion and thirst in human pregnancy. Am J Physiol 1984;246:F105-F109. 
  14. Robertson GL, Mahr EA, Athar S, Sinha T. Development and clinical application of a new method for the radioimmunoassay of arginine vasopressin in human plasma. J Clin Invest 1973;52:2340-2352.
  15. Jeanpierre M. A rapid method for the purification of DNA from blood. Nucleic Acids Res 1987;15:9611-9611. [Free Full Text]
  16. Saiki RK, Gelfand DH, Stoffel S, et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 1988;239:487-491. [Free Full Text]
  17. Dohlman HG, Thorner J, Caron MG, Lefkowitz RJ. Model systems for the study of seven-transmembrane-segment receptors. Annu Rev Biochem 1991;60:653-688. [CrossRef][Medline]
  18. Kobilka BK, MacGregor C, Daniel K, Kobilka TS, Caron MG, Lefkowitz RJ. Functional activity and regulation of human {beta}2-adrenergic receptors expressed in Xenopus oocytes. J Biol Chem 1987;262:15796-15802. [Free Full Text]
  19. Hughes MR, Malloy PJ, O'Malley BW, Pike JW, Feldman D. Genetic defects of the 1,25-dihydroxyvitamin D3 receptor. J Recept Res 1991;11:699-716. [Medline]
  20. Taylor SI, Cama A, Accili D, et al. Genetic basis of endocrine disease. 1. Molecular genetics of insulin resistant diabetes mellitus. J Clin Endocrinol Metab 1991;73:1158-1163. [Free Full Text]
  21. Takeda K, Weiss RE, Refetoff S. Rapid localization of mutations in the thyroid hormone receptor-{beta} gene by denaturing gradient gel electrophoresis in 18 families with thyroid hormone resistance. J Clin Endocrinol Metab 1992;74:712-719. [Abstract]
  22. Rosenfeld PJ, Cowley GS, McGee TL, Sandberg MA, Berson EL, Dryja TP. A null mutation in the rhodopsin gene causes rod photoreceptor dysfunction and autosomal recessive retinitis pigmentosa. Nat Genet 1992;1:209-213. [CrossRef][Medline]
  23. Rosenthal W, Seibold A, Antaramian A, et al. Molecular identification of the gene responsible for congenital nephrogenic diabetes insipidus. Nature 1992;359:233-235. [CrossRef][Medline]
  24. van den Ouweland AMW, Dreesen JCFM, Verdijk M, et al. Mutations in the vasopressin type 2 receptor gene (AVPR2) associated with nephrogenic diabetes insipidus. Nat Genet 1992;2:99-102. [CrossRef][Medline]
  25. Pan Y, Metzenberg A, Das S, Jing B, Gitschier J. Mutations in the V2 vasopressin receptor gene are associated with X-linked nephrogenic diabetes insipidus. Nat Genet 1992;2:103-106. [CrossRef][Medline]
  26. Robertson GL, Scheidler JA. A newly recognized variant of familial nephrogenic diabetes insipidus distinguished by partial resistance to vasopressin (type 2). Clin Res 1981;29:555A-555A.abstract 

 

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation

This article has been cited by other articles:



HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  TERMS OF USE  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved.