| |||||||||||||||||||||||
We describe the development of a lymphoma in a hepatic allograft recipient 4.5 months after orthotopic liver transplantation. Using a rapid technique based on the polymerase chain reaction (PCR), which makes use of a DNA sequence polymorphism at the D4S174 locus on chromosome 4, we demonstrated that the patient's tumor was of donor origin.
Case Report
In November 1991, a 54-year-old man underwent orthotopic liver transplantation for liver failure due to chronic hepatitis C infection. This infection was presumed to have been acquired from multiple transfusions during aortic-valve replacement in 1982. The patient's post-transplantation course included acute rejection beginning five days after surgery. He was treated with methylprednisolone sodium succinate (Solu-Medrol) and OKT3 and was discharged on the 20th day after transplantation with essentially normal hepatic allograft function.
One month later, a cytomegalovirus infection was diagnosed and treated with ganciclovir. The immunosuppressive post-transplantation therapy was adjusted: azathioprine was discontinued, and the daily dose of cyclosporine was gradually tapered from 12 to 9 mg per kilogram of body weight per day. Ten days later, a percutaneous liver biopsy was performed because of persistently abnormal hepatic function. Histopathological analysis showed cytomegalovirus infection with minimal evidence of rejection. After a reduction in the dose of cyclosporine to 6 mg per kilogram per day, the patient's condition improved and he was discharged in early January 1992. During the next two months, allograft function remained stable, with a total bilirubin level of 1.3 to 1.8 mg per deciliter (22 to 31 µmol per liter) and a serum aspartate aminotransferase level of 40 to 60 U per liter. Azathioprine therapy was resumed at a dose of 50 mg per day.
The patient was seen at a routine follow-up visit in March 1992. At that time, his immunosuppressive regimen consisted of 5.3 mg of cyclosporine per kilogram per day, 20 mg of prednisone per day, and 50 mg of azathioprine per day. Physical examination revealed mild icterus but was otherwise normal. Laboratory studies revealed a direct bilirubin level of 3.2 mg per deciliter (55 µmol per liter), total bilirubin level of 4.5 mg per deciliter (77 µmol per liter), lactate dehydrogenase concentration of 2816 U per liter, serum aspartate aminotransferase level of 2292 U per liter, and serum alanine aminotransferase level of 1561 U per liter. The patient was admitted for further evaluation.
Vascular ultrasonography performed on the first hospital day showed a patent portal vein. A percutaneous liver biopsy, performed on the second hospital day, showed macrovesicular steatohepatitis with Mallory's bodies. A contrast-enhanced computed tomographic scan of the abdomen showed a 4-cm mass in the porta hepatis and intrahepatic biliary dilatation (Figure 1). In addition, there was a 3-cm mass posterior to the left lobe of the liver and a small collection of fluid abutting the right hepatic lobe. Magnetic resonance imaging of the liver showed that, although the mass in the porta hepatis was solid, the two other collections of fluid seen on computed tomography were hematomas (Figure 2). A T-tube cholangiogram obtained to evaluate the bile ducts failed to provide adequate retrograde filling of the biliary tree. Endoscopic retrograde cholangiopancreatography demonstrated a narrowed segment of the common bile duct proximal to the T tube, apparently caused by extrinsic compression.
|
|
|
DNA was isolated from the patient's blood and frozen tumor specimen as described previously11. DNA fragments from the D4S174 locus were generated with use of the PCR in a volume of 25 microl containing 2.5 pmol of primer pair (5'AAGAACCATGCGATACGACT3' and 5'CATTCCTAGATGGGTAAAGC3'), 50 ng of DNA, 0.2 mmol (for fresh or frozen tissue) or 2 mmol (for paraffin-embedded samples) of deoxyadenosine triphosphate, deoxythymidine triphosphate, and deoxyguanosine triphosphate; 2 µmol of deoxycytidine triphosphate per liter; 1.5 mmol of magnesium chloride per liter; 20 mmol of TRIS buffer per liter (pH 8.6); 50 mmol of potassium chloride per liter; 50 µg of bovine serum albumin per milliliter; 0.5 U (for fresh or frozen tissue) or 1 U (for paraffin-embedded samples) of Taq polymerase (Perkin-Elmer Cetus); and 0.1 microl (7 nmol per liter) of [alpha-32P]deoxycytidine triphosphate (3000 Ci per millimole). The reaction was performed for 35 cycles (for fresh or frozen tissue) or 40 cycles (for paraffin-embedded samples), consisting of 5 minutes of denaturation at 94 °C, 30 seconds of annealing at 52 °C, and 30 seconds of extension at 71 °C. The samples were diluted, and polyacrylamide-gel electrophoresis was carried out as described previously12.
Results
The lesion was classified as a malignant diffuse large-cell lymphoma. There was no evidence of allografted tissue in the biopsy specimen. Immunoperoxidase staining of frozen sections showed that the tumor cells expressed IgG-
. The cells were positive for antibodies to CD20, but negative for antibodies to CD5 and CD10. Rare T cells (CD3+) were also present.
A highly polymorphic dinucleotide repeat [(AC)23A] on chromosome 4 at the D4S174 locus was examined13,14. Eleven different repeat configurations, ranging in size from 175 to 195 base pairs, were described. Figure 4 shows the variations in the lengths of PCR fragments derived from the patient's tumor, allograft, blood, and bone marrow. Tumor and blood (lanes 1 and 3, straight arrows) showed distinct differences in alleles, which are best explained by the different genetic origins of these tissues. This indicates that the tumor arose from allografted cells, rather than host tissue. In addition, DNA from a paraffin-embedded sample of allograft, obtained from a separate incisional biopsy, showed a pattern similar to that of the tumor. The allograft also had a weak signal corresponding to that of the recipient (Figure 4; lane 2, open arrow), as would be expected because of the presence of host nucleated blood cells in the allograft. The bone marrow shows an allelic pattern that corresponds predominantly to that of the recipient. Surprisingly, a weak signal corresponding to that of the allograft is evident in the bone marrow in addition to the pattern corresponding to the recipient (Figure 4; lane 4, curved arrow). This most likely represents donor white cells that have engrafted in the marrow; however, an alternative explanation is that there is subclinical involvement of the bone marrow by lymphoma. Analysis of a second highly polymorphic marker, Rb1.20,15 on chromosome 13 (data not shown) also confirmed that the tumor was not derived from host tissues.
|
Lymphoproliferative disorders are a potential complication of immunosuppressive therapy in patients who have received solid-organ transplants. In one series, the incidence of such disorders in liver-transplant recipients was 2.2 percent16. Three of the 23 lymphoproliferative disorders in this series were limited to the allograft or periportal region, 3 involved the allograft and distant sites, and 17 consisted of diffuse disease alone.
Two cases of lymphoma arising from donor tissue in recipients of renal allografts have been reported,9,10 but we could find no previous reports of donor-related lymphoproliferative disorders arising from allografted tissue after liver transplantation. A B-cell lymphoma of the porta hepatis developed in our patient 4.5 months after orthotopic liver transplantation. Using a rapid PCR-based technique to detect DNA polymorphisms, we showed that the tumor was of donor origin. The use of these techniques enabled us to analyze paraffin-embedded donor (allograft) and host (bone marrow) tissues, and these results confirmed the observed differences in host tissue and tumor specimens. Presumably, this tumor arose from lymphoid tissue present in the allograft. The donor had no evidence of lymphoma, so that it is unlikely that the recipient's lymphoma arose from occult involvement of the allograft by previously transformed lymphoid cells, although such a case has been reported17. In addition, lymphoma has not developed in two recipients of renal allografts from the same donor.
The role of local and systemic treatment in the management of post-transplantation lymphoproliferative disorders is controversial, since cessation of immunosuppressive therapy or a reduction in the dosage can result in resolution of the disease in some patients18,19. Unfortunately, many lymphomas do not respond to a reduction in the dosage,16,20,21 and the potential benefits of reduced doses of immunosuppressive drugs must be balanced against the risks of rejection in patients with life-sustaining allografts. In one case of donor-related lymphoma after renal transplantation, a trial of reduced doses of immunosuppressive drugs did not eradicate the disease9.
The demonstration that lymphoma can arise from donor tissue in a liver-transplant recipient should encourage molecular analysis of similar cases in which the allograft was the primary site of the lymphoproliferative disorder.
Source Information
From the Departments of Radiation Oncology (I.J.S.), Surgery (J.P., A.B.C.), Radiology (S.S.), Pathology (J.F.), and Medicine (W.N.K.), Massachusetts General Hospital; Harvard University School of Public Health (C.L., D.W.Y.); and Massachusetts Eye and Ear Infirmary (D.W.Y.) -- all in Boston.
Address reprint requests to Dr. Spiro at the Department of Radiation Oncology, Massachusetts General Hospital, Fruit St., Boston, MA 02114.
References
| |||||||||||||||||||||||
This article has been cited by other articles:
HOME | SUBSCRIBE | SEARCH | CURRENT ISSUE | PAST ISSUES | COLLECTIONS | PRIVACY | TERMS OF USE | HELP | beta.nejm.org Comments and questions? Please contact us. The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved. |
Previous
