| |||||||||||||||||||||||
Eulitz et al. have described a patient with systemic heavy-chain amyloidosis in whom the amyloid component was a short IgG heavy 
chain alone4. The shortened heavy chain belonged to the gamma1 subclass and contained a normal variable domain directly linked to the third constant domain. We now describe two patients with a disorder that resembled light-chain deposition disease both clinically and pathologically in whom the kidney deposits contained short heavy chains but no detectable light chains. Unlike the deposits associated with systemic heavy-chain amyloidosis, these deposits had a nonfibrillar structure and did not stain with Congo red. The sequence of the truncated heavy chain from one patient was strikingly similar to that of the protein found in the patient with systemic heavy-chain amyloidosis4. We believe that this condition, characterized by nonamyloid deposits of heavy chains, is a specific entity -- namely, heavy-chain deposition disease.
Methods
Patients
Patient 1, a 53-year-old woman, was referred because of hypertension, leg edema, exertional dyspnea, and anemia of five months' duration. Her urinary protein excretion was 4.4 g per 24 hours. Her serum total protein concentration was 47 g per liter, with 27 g of albumin per liter and 4 g of gamma globulin per liter (normal, 8 to 16). Thin-layer agarose electrophoresis revealed peaks of beta-2 and gamma globulin. The serum creatinine concentration was 1.5 mg per deciliter (133 µmol per liter). Bone marrow aspiration showed 8 percent plasma cells, and the results of a bone marrow biopsy were consistent with a diagnosis of multiple myeloma, with infiltration of plasma cells that stained with fluorescein-conjugated anti-gamma-heavy-chain and anti-lambda-light-chain antibodies by direct immunofluorescence. No cells containing kappa light chains were detected. The patient was treated with melphalan, prednisone, albumin, and antihypertensive drugs. Nine months later, she was asymptomatic, but her bone marrow was hypoplastic, with minimal plasma-cell infiltration (1 to 2 percent), and she had persistent proteinuria (5 to 7 g per 24 hours) and hypoproteinemia.
Patient 2, a 59-year old woman referred because she had hypertension and the nephrotic syndrome, had a long history of autoimmune disorders, including Graves' hyperthyroidism followed by Hashimoto's thyroiditis with a goiter and persistently high serum concentrations of antithyroid, antinuclear, and antigastric parietal-cell antibodies. She also had chronic thrombocytopenia, which had been treated unsuccessfully with prednisolone and cyclophosphamide and then with vincristine and danazol, and diabetes mellitus that was controlled by diet. Her 24-hour urinary protein excretion was 3 to 18 g. The serum total protein concentration was 52 g per liter, with 26 g of albumin per liter and 4 g of gamma globulin per liter. The patient was treated initially with intravenous immune globulin in a dose of 30 g per day for five days. A renal biopsy was performed and repeated (after platelet infusions) twice: 2 months later, to rule out the possibility that the infused immune globulin was deposited in glomeruli; and 15 months later because her serum creatinine concentration had increased from 1.6 to 7.1 mg per deciliter (140 to 630 µmol per liter). A liver biopsy was performed because of an elevated serum alkaline phosphatase concentration. Monoclonal-plasma-cell proliferation was not detected by skeletal x-ray survey, bone marrow aspiration and biopsy, thyroidectomy, or cytoplasmic immunofluorescence studies of bone marrow and thyroid cells with the use of antibodies to immunoglobulin heavy chains (including IgG-subclass-specific antibodies) and light chains. Treatment with chlorambucil, methylprednisolone, and plasma exchanges resulted in transient improvement; subsequent treatment with melphalan and prednisolone had no effect.
Pathological Studies
Fragments of tissue specimens (kidney and bone marrow from both patients and liver and thyroid from Patient 2) were processed for light, electron, and immunofluorescence microscopy with the use of fluorescein-labeled antibodies specific for immunoglobulin heavy and light chains and for C1q, C3, C4, fibrinogen, and albumin and for indirect assays with the monoclonal antibodies described below.
Immunochemical Studies
Serum and concentrated urine samples from both patients were studied by high-resolution electrophoresis, immunoelectrophoresis, and Western blot analysis5. The immunologic studies were performed with monoclonal antibodies specific for kappa light chains, lambda light chains, heavy-chain constant domains, and IgG subclasses. The antigen-antibody reactions were detected with alkaline phosphatase-conjugated antimouse IgG antibodies and were visualized with nitroblue tetrazolium and bromochloro-indolyl phosphate.
The abnormal (shortened) IgG from Patient 1 was partially purified by diethylaminoethyl and Sephadex G-150 superfine chromatography and analyzed by sodium dodecyl sulfate-polyacrylamide-gel electrophoresis followed by Western blotting. The size of the native molecule was evaluated on calibrated Sephadex G-100 and G-150 superfine columns.
Study of Messenger RNA in Patient 1
Single-stranded complementary DNA (cDNA) was synthesized from bone marrow messenger RNA from Patient 1, with reverse transcriptase and random hexadeoxynucleotides used as primers. A series of polymerase chain reactions was performed with the cDNA as a template, a 3' primer (5'CGAGAGCCCGGGGAGCGGGG3') complementary to a noncoding sequence downstream from the third heavy-chain constant (CH3) exon that is identical in the four IgG subclasses, and six different 5' primers that were consensus sequences of every subgroup leader of the variable region (VH)6,7. Two further independent amplifications were performed with the same 3' primer and the 5' primer corresponding to the third subgroup (VHIII) leader exon (5'ATGGAGTTTGGGCTGAGC3'). The amplification products and restriction fragments were independently cloned into mp18 and mp19 vectors, and both strands were sequenced8.
Results
Histopathological Studies
The microscopical appearance of the renal-biopsy specimens from the two patients was similar, and the renal, bone marrow, and thyroid specimens from Patient 2 had many similarities (Figure 1). Light microscopy showed nodular glomerulosclerosis but no fluorescence after staining with thioflavine T and no green birefringence under polarized light after staining with Congo red. After silver methenamine impregnation, the glomerular nodules were heterogeneously argyrophilic and sometimes laminated. Renal tubular-cell basement membranes were thickened by a refractile ribbonlike material that was positive on periodic acid-Schiff staining. Fibrinoid deposits were present in mesangial nodules and around renal tubules in Patient 2. No arteriolar hyaline deposits or exudative lesions, such as fibrinoid caps, were seen. Material positive on periodic acid-Schiff staining was present around smooth-muscle cells of the arterial and arteriolar walls in the kidney and bone marrow specimens from Patient 2.
|
|
Immunochemical and Sequencing Studies of Serum and Urine
The serum (five samples) and concentrated urine (two samples) from Patient 2 contained small amounts of several monoclonal immunoglobulins, which were probably related to long-term immunosuppressive therapy9. The patient's IgG4 appeared to be polyclonal, and no short heavy chain could be found by Western blotting after sodium dodecyl sulfate-polyacrylamide-gel electrophoresis. In both patients, tests for cryoglobulins were negative.
The serum and urine from Patient 1 contained two monoclonal forms of IgG, one with gamma globulin and the other with beta-2 globulin mobility; the latter lacked heavy-chain epitopes by immunoelectrophoresis. A lambda-chain Bence Jones protein was detected in the patient's urine. The slow-migrating IgG was an apparently normal IgG1, whereas the fast-migrating IgG was unreactive with antibodies to the first and second constant domains (Table 1). The native protein had an apparent molecular weight of 94,000. This finding and the results of gel electrophoresis (Figure 2) indicated that this short IgG was made up of two truncated (24 kd) heavy chains noncovalently linked to a covalent dimer of normal-sized lambda light chains.
|
Discussion
The two patients we studied have a disorder that is clinically and pathologically indistinguishable from light-chain deposition disease, except by immunofluorescence studies, and that clearly differs from amyloidosis. We believe them to have heavy-chain deposition disease, because the tissue deposits in both patients strongly stained for heavy chains. Light-chain determinants were undetectable by immunofluorescence with potent polyclonal and monoclonal reagents. Both patients presented with renal disease, but the process is probably more widespread, as evidenced in Patient 2. Diabetic nephropathy was ruled out by the results of light and immunofluorescence microscopy, and amyloidosis was ruled out by electron microscopy.
In Patient 1 a heavy-chain cDNA lacking the CH1, hinge, and CH2 domains was amplified from bone marrow RNA. The corresponding protein was the single immunoglobulin component in the renal deposits. It was noncovalently linked to lambda light-chain dimers in the serum and urine. These findings are similar to those reported in a patient with systemic heavy-chain amyloidosis,4 whose abnormal protein also belonged to the VHIII subgroup and gamma1 subclass; however, its variable region was strikingly different, and it belonged to a different allotype. The primary structure of the variable region of the protein in Patient 1 had unusual features that might play a part in tissue deposition.
The short heavy chains in our patients and in the patient with heavy-chain amyloidosis lacked the CH1 domain. The domain is present in the heavy chains of almost all patients with heavy-chain disease, a disorder in which there is no kidney disease and no deposition of heavy chains1. The absence of the CH1 domain and the unusual structure of the protein in Patient 1 suggest that the variable region has a role in tissue deposition.
No clinical feature distinguishes light-chain deposition disease from heavy-chain deposition disease. Both conditions may be associated with various immunoproliferative disorders or found in the absence of an overt malignant process. However, the predominant disease in patients with either light- or heavy-chain deposition is myeloma, whereas myeloma is extremely rare in patients with heavy-chain disease. Hence, the finding of symptoms (especially renal) known to be associated with light-chain deposition, especially in patients with myeloma, should lead to the use of anti-heavy-chain antibodies in biopsy studies.
Supported in part by grants from the Institut National de la Sante et de la Recherche Medicale (CRE930602) and the Association pour la Recherche sur le Cancer (6044) and by a fellowship from the Ligue Nationale Contre le Cancer (to Mr. Khamlichi).
We are indebted to Drs. George Carlone (Centers for Disease Control and Prevention, Atlanta) and Margaret Goodall (Recognition Sciences, Birmingham, United Kingdom) for the gift of monoclonal antibodies, to Mrs. Francoise Buisson for expert editorial assistance, and to Drs. Joel Buxbaum (New York) and Jean-Claude Brouet (Paris) for their critical reading of the manuscript.
Source Information
From the Laboratory of Immunology and Molecular Interactions (Centre National de la Recherche Scientifique Associated Research Unit 1172), University Hospital and Faculty of Sciences, Poitiers (P.A., A.A.K., M.C., J.-L.P.); the Department of Nephrology, University Hospital, Poitiers (G.T.); and the Department of Pathology (E.J.) and the Human and Experimental Digestive Cancer Unit (Institut National de la Sante et de la Recherche Medicale Unit 252) (B.C., F.M.), University Hospital, Dijon -- all in France.
Address reprint requests to Dr. Aucouturier at the Centre National de la Recherche Scientifique, Unite de Recherche Associee 1172, Centre Hospitalier Universitaire, B.P. 577, F-86021 Poitiers, France.
References
| |||||||||||||||||||||||
This article has been cited by other articles:
HOME | SUBSCRIBE | SEARCH | CURRENT ISSUE | PAST ISSUES | COLLECTIONS | PRIVACY | TERMS OF USE | HELP | beta.nejm.org Comments and questions? Please contact us. The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved. |
Previous
