Human herpesvirus 6 (HHV-6) was first isolated from patientswith the acquired immunodeficiency syndrome or lymphoproliferativediseases and was named human B-lymphotropic virus1. However,later studies revealed that the virus is T-lymphotropic in vitro2and in vivo3. Recently, two genotypes of HHV-6 (type A and typeB) have been distinguished on the basis of their restrictionpolymorphism4,5,6. HHV-6 has been identified as the etiologicagent of exanthem subitum in infants,7 and an acute febrileillness in young children8. Most people are seropositive forHHV-6 by the age of three years9,10.
HHV-6 also produces latent or chronic infections11,12,13 andis occasionally reactivated in immunocompromised hosts1,14,15,16.Furthermore, HHV-6 has been implicated in several diseases inimmunocompetent adults, including Kikuchi's lymphadenitis17and an infectious mononucleosis-like syndrome that is negativefor Epstein-Barr virus and cytomegalovirus18,19,20,21.
We describe the immunopathological and virologic features ofa severe infectious mononucleosis-like syndrome in a 43-year-oldman that was probably caused by a primary infection with HHV-6type B.
Case Report
A 43-year-old man was admitted to Harasanshin General Hospitalon May 2, 1992, with a seven-day history of fever and a five-dayhistory of progressive, generalized skin eruption. He had beenhealthy and had a history of self-limiting viral infectionsincluding measles and rubella in childhood. Physical examinationrevealed a high fever (temperature, 40.6 °C), bilateralcervical lymphadenopathy, mild splenomegaly, and tonsillar pharyngitiswith a white exudate. The skin was covered with erythematousmacules and papules (Figure 1A). The hemoglobin level was 12.7g per deciliter, the platelet count was 127 x 103 per cubicmillimeter, and the white-cell count was 16.9 x 103 per cubicmillimeter, with 58 percent atypical lymphocytes. Liver dysfunctionwas seen, with an increase in the levels of aspartate aminotransferase(64 IU per liter), alanine aminotransferase (98 IU per liter),and lactate dehydrogenase (1313 IU per liter). Serum immunoglobulinlevels were normal, and no antibodies against human T-cell lymphotrophicvirus type I and human immunodeficiency virus were detected.The heterophil antibody test was negative.
Figure 1. Physical and Immunohistochemical Findings in a 43-Year-Old Man.
There was generalized exanthem over the abdomen; the patient's body was covered with erythematous macules and papules (Panel A). Staining of a skin-biopsy specimen with hematoxylin and eosin revealed focal vacuolar degeneration of the basal layer of the epidermis, with occasional lymphoid cells, and a marked infiltration of lymphoid cells in the dermis (Panel B, x100). The infiltrating lymphocytes were positive for T11 (CD2) on immunohistochemical staining (Panel C, x140). They were also positive for OKT4 (CD4) and OKT8 (CD8) (data not shown), indicating that they consisted of both CD4+ T cells and CD8+ T cells. HHV-6 antigen staining of purified CD4+ T cells with OHV-2 antibody showed that 32 percent of the CD4+ T cells were positive for OHV-2 (Panel D, x950).
Within four days of hospitalization, there was a rapid increasein the white-cell count (to 31.0 x 103 per cubic millimeter),with 44 percent atypical lymphocytes, in association with highfevers, continued liver dysfunction (aspartate aminotransferase,271 IU per liter; alanine aminotransferase, 391 IU per liter;and lactate dehydrogenase, 2067 IU per liter), and renal dysfunction(creatinine, 3.6 mg per deciliter [315 µmol per liter]).The skin lesions coalesced, and diffuse erythema developed overthe whole body. Methylprednisolone (250 mg per day) was administeredfor three days beginning on the seventh day of hospitalization.A decrease in atypical lymphocytes was noted. The skin eruptionhealed, with abundant membranous exfoliation, and the mononucleosis-likesymptoms gradually disappeared. The patient was sent home onthe 58th hospital day and had no clinical sequelae.
Methods
Phenotypic Analysis of Atypical Lymphocytes
Peripheral-blood mononuclear cells (PBMCs) were separated byFicoll-Hypaque density-gradient centrifugation. NonadherentPBMCs were phenotyped on a FACSort flow cytometer (Becton Dickinson,Mountain View, Calif.), with the use of fluorescein- or phycoerythrin-conjugatedmonoclonal antibodies, including T11 (CD2), Leu-4 (CD3), Leu-3a(CD4), Leu-9 (CD7), Leu-2a (CD8), Leu-11 (CD16), NKH-1 (CD56),anti-HLA-DR and MY10 (CD34) (all from Becton Dickinson), andJ5 (CD10), MY7 (CD13), B4 (CD19), B1 (CD20), and MY9 (CD33)(all from Coulter Immunology, Hialeah, Fla.). Mouse IgG1 conjugatedto fluorescein or phycoerythrin was used as a negative control.CD4+ or CD8+ lymphocytes were purified from nonadherent PBMCson CD4- or CD8-conjugated immunomagnetic beads (Dynabeads M450;Dynal, Oslo, Norway).
Immunohistochemical Staining
A biopsy was performed on the sixth day of hospitalization,and skin was obtained from the forearm in an area with manyerythematous papules and macules. Sections of the specimen werestained with the monoclonal antibodies mentioned above, accordingto the avidin-biotin-alkaline phosphatase method22.
Examination of Viral Antigen
Cytomegalovirus antigen was stained by the direct immunoperoxidasemethod with a horseradish peroxidase-conjugated human monoclonalantibody, HRP-C723. HHV-6 antigen was examined with an HHV-6-specificmonoclonal antibody, OHV-2 (kindly provided by Dr. Yamanishi,Osaka University, Osaka, Japan),24 according to the avidin-biotin-alkalinephosphatase method. OHV-2 can recognize both types of HHV-6.
Titration of Anti-HHV-6 Antibody
The patient's serum samples were cryopreserved at -80 °Cuntil use. Titration of anti-HHV-6 antibody was done by an indirectimmunofluorescence assay in which MT-4 cells persistently infectedwith HHV-6 (HST strain) were used as a target antigen and fluorescein-conjugatedantihuman IgG or IgM goat serum was used as a secondary antibody.To detect anti-HHV-6 IgM, serum IgG and IgA were absorbed byG186 and AR1, respectively25. These samples were handled simultaneously.Serum obtained from a patient with active exanthem subitum wasused as a positive control.
Examination of Herpesvirus DNA by the Polymerase Chain Reaction
Herpesvirus DNA was detected by the polymerase-chain-reaction(PCR) method. The following primers were used: for amplificationof HHV-6 DNA, 5'CCCATTTACGATTTCCTGCACCACCTCTCTGC3' and 5'TTCAGGGACCGTTATGTCATTGAGCATGTC3'(the large-segment protein-gene region); for cytomegalovirus,5'GCAGAGCTCGTTTAGTGAACC3' and 5'GGCACGGGGAATCCGCGTTCC3' (themajor immediate early region); for Epstein-Barr virus, 5' CCAGAGGTAAGTGGACTT3'and 5'GACCGGTGCCTTCTTAGG3' (the long-internal-reiteration region);and for herpes simplex virus, 5'CATCACCGACCCGGAGAGGGAC3' and5'GGGCCAGGCGCTTCTTGGTGTA3' (the DNA polymerase region).
Genotyping of HHV-6
Genotyping of HHV-6 was carried out according to Aubin et al5.HHV-6 DNA was amplified with primers 5'GATCCGACGCCTACAAACAC3'and 5'CGGTGTCACACAGCATGAACTCTC3'. The expected PCR product of830 base pairs (bp) corresponds to the pHC5 insert of HHV-6.The PCR product was digested with HindIII and then subjectedto electrophoresis on a 3 percent agarose gel. After the bandswere stained with ethidium bromide, the electrophoretic patternwas photographed under ultraviolet light. PCR products fromHHV-6 type B are digested into 610-bp and 220-bp fragments,whereas those from type A HHV-6 are not5.
Results
The majority of the population of PBMCs on the sixth day ofhospitalization consisted of CD4+ and CD8+ T cells. The cellswere positive for CD2 (91.6 percent), CD3 (88.1 percent), CD4(35.7 percent), CD7 (77.2 percent), CD8 (52.6 percent), andHLA-DR (79.0 percent), whereas they were negative for CD10 (0percent), CD13 (0.4 percent), CD16 (1.4 percent), CD19 (0.8percent), CD20 (0.6 percent), CD33 (2 percent), CD34 (0 percent),and CD56 (1.9 percent). T cells positive for CD4 and CD8 werenot detected by CD4/CD8 two-color analysis.
The skin biopsy revealed a diffuse infiltration of atypicallymphoid cells in the dermis. The epidermis was nearly intactexcept for focal vacuolar degeneration of the basal layer (Figure 1B).The infiltrating lymphocytes were positive for CD2 (Figure 1C),CD3, CD4, and CD8, but negative for CD19 and CD20.
Table 1 shows the serial changes in titers of antibody againstherpesviruses. Anti-HHV-6 IgG could not be detected 13 daysafter the onset of disease (hospital day 6), but it was detectedon day 24 of the illness (hospital day 17) and reached its peakon day 74 (hospital day 67). IgG antibodies against cytomegalovirus,Epstein-Barr virus, and herpes simplex virus were detected,but their titers did not change significantly during the courseof the illness.
Table 1. Antibody Titers and Viral DNA in the Patient's Serum.
Immunohistochemical staining with OHV-2 was performed on CD4+and CD8+ T cells collected on the sixth day of hospitalization.Thirty-two percent of the CD4+ T cells were positive for theHHV-6 antigen (Figure 1D), whereas CD8+ T cells were negativefor the antigen (<1 percent). Cytomegalovirus-infected cellswere not observed in the nucleated blood cells (0 per 26,000cells).
HHV-6 DNA was detected by PCR in serum collected on days 10and 13 of the patient's illness, indicating the presence ofHHV-6 viremia (Table 1); other types of herpesvirus DNA werenot detected. HHV-6 DNA was also amplified by PCR in nonadherentPBMCs, CD4+ T cells, and a skin-biopsy specimen (data not shown).Digestion of the 830-bp PCR product with HindIII produced twofragments of 610 bp and 220 bp, indicating a type B genotype(Figure 2).
Figure 2. Genotypic Analysis of HHV-6 DNA Amplified by PCR.
The 830-bp PCR product was amplified in nonadherent PBMCs and CD4+ T cells. The digestion of the 830-bp band with HindIII produced two fragments of 610 bp and 220 bp, indicating an HHV-6 type B genotype. DNA from MT-4 cells persistently infected with HHV-6 and uninfected MT-4 cells were used as positive and negative controls, respectively. The plus and minus symbols indicate the presence and absence of HindIII digestion, respectively.
Discussion
Our 43-year-old patient with a severe mononucleosis-like syndromehad seroconversion of serum anti-HHV-6 IgG; HHV-6-specific DNAsequence was detected in serum, nonadherent PBMCs, CD4+ T cells,and a skin-biopsy specimen. In healthy adults who are positivefor anti-HHV-6 IgG, latent HHV-6 DNA has sometimes been undetectableby PCR in serum and nonadherent PBMCs, because HHV-6 latentlyinfects blood monocytes11. Our data indicate that HHV-6 wasthe cause of our patient's acute illness. Serologic and PCRstudies excluded the possibility of active infection by otherhuman herpesviruses. The cytomegalovirus antigen was not detectedin nucleated blood cells. Accordingly, the increase in the HHV-6IgG titer was not the result of serologic cross-reactions betweenHHV-6 and cytomegalovirus,26 or of the reactivation of HHV-6induced by active infections with cytomegalovirus or Epstein-Barrvirus27,28,29.
Since the anti-HHV-6 IgG titer declines with age,30 it may remainundetected in some adult carriers of HHV-6. It took more than13 days for anti-HHV-6 IgG to become detectable in our patient.Accordingly, we believe that this episode was due to a primaryHHV-6 infection, though anti-HHV-6 IgM could not be detected.The administration of methylprednisolone beginning on hospitalday 7 may have suppressed the increase in serum anti-HHV-6 IgMso that it remained below detectable levels. Alternatively,infection of CD4+ T cells with HHV-6 may have impaired the productionof anti-HHV-6 IgM.
All the viral strains isolated from children with exanthem subitumwere of the type B genotype,5,6,8 whereas HHV-6 type A was isolatedmost commonly from immunocompromised adults5. The causativeHHV-6 in this patient was type B. Skin lesions were strikingand severe and did not resemble exanthem subitum. The skin lesionswere characterized by an aggressive infiltration of both CD4+and CD8+ T-cell populations into the dermis. The pathogenesisof the skin rash in exanthem subitum is not well known. Thetype B genotype could not be regarded as a molecular markerof the pathogenicity of skin involvement in children, becausemost strains isolated from children with acute febrile illnesseswho do not have exanthem are also type B4.
HHV-6 preferentially infects CD4+ T cells in vitro2,6. In exanthemsubitum, HHV-6 has been shown to infect CD4+ T cells in vivo3.In our patient, the main target of HHV-6 was also CD4+ T cells.CD4+/CD8+ T cells did not appear in the blood, though the inductionof CD4 molecules in CD4-/ CD8+ T cells by HHV-631 has been reported.There were too few B cells to analyze. On the basis of thesedata, the mechanism of infectious mononucleosis-like illnessin this patient might be the unregulated proliferative responseof CD8+ T cells against CD4+ T cells infected with HHV-6. Thispossibility is quite interesting, because in infectious mononucleosisrelated to Epstein-Barr virus, there is a proliferative responseof CD8+ T cells against B cells infected with the virus.
Thus, in addition to causing exanthem subitum in infants anda febrile illness in children, HHV-6 type B can cause a severeinfectious mononucleosis-like syndrome in adults.
Supported in part by grants-in-aid from the Fukuoka Cancer Society(1991) and the Japanese Society for the Promotion of Sciencefor Japanese Junior Scientists (05-1238).
We are indebted to Dr. Shuhei Imayama, Department of Dermatology,Faculty of Medicine, Kyushu University, for helpful discussion.
Source Information
From the Departments of Hematology (K.A.) and Dermatology (S.H.), Harasanshin General Hospital, Fukuoka, Japan; the Department of Microbiology, Miyazaki Medical College, Miyazaki, Japan (Y.E., T.M., Y.M.); the First Department of Pathology, School of Medicine, Fukuoka University, Fukuoka, Japan (Y.S., M.K.); and the First Department of Internal Medicine, Kyushu University, Fukuoka, Japan (M.H., Y.N.).
Address reprint requests to Dr. Akashi at the Department of Hematology, Harasanshin General Hospital, 1-8 Taihaku-machi, Hakata-ku, Fukuoka 812, Japan.
References
Salahuddin SZ, Ablashi DV, Markham PD, et al. Isolation of a new virus, HBLV, in patients with lymphoproliferative disorders. Science 1986;234:596-601. [Free Full Text]
Lusso P, Markham PD, Tschachler E, et al. In vitro cellular tropism of human B-lymphotropic virus (human herpesvirus-6). J Exp Med 1988;167:1659-1670. [Free Full Text]
Takahashi K, Sonoda S, Higashi K, et al. Predominant CD4 T-lymphocyte tropism of human herpesvirus 6-related virus. J Virol 1989;63:3161-3163. [Free Full Text]
Ablashi DV, Balachandran N, Josephs SF, et al. Genomic polymorphism, growth properties, and immunologic variations in human herpesvirus-6 isolates. Virology 1991;184:545-552. [CrossRef][Medline]
Aubin J-T, Collandre H, Candotti D, et al. Several groups among human herpesvirus 6 strains can be distinguished by Southern blotting and polymerase chain reaction. J Clin Microbiol 1991;29:367-372. [Free Full Text]
Schirmer EC, Wyatt LS, Yamanishi K, Rodriguez WJ, Frenkel N. Differentiation between two distinct classes of viruses now classified as human herpesvirus 6. Proc Natl Acad Sci U S A 1991;88:5922-5926. [Free Full Text]
Yamanishi K, Okuno T, Shiraki K, et al. Identification of human herpesvirus-6 as a causal agent for exanthem subitum. Lancet 1988;1:1065-1067. [CrossRef][Medline]
Pruksananonda P, Hall CB, Insel RA, et al. Primary human herpesvirus 6 infection in young children. N Engl J Med 1992;326:1445-1450. [Abstract]
Briggs M, Fox J, Tedder RS. Age prevalence of antibody to human herpesvirus 6. Lancet 1988;1:1058-1059.
Okuno T, Takahashi K, Balachandra K, et al. Seroepidemiology of human herpesvirus 6 infection in normal children and adults. J Clin Microbiol 1989;27:651-653. [Free Full Text]
Kondo K, Kondo T, Okuno T, Takahashi M, Yamanishi K. Latent human herpesvirus 6 infection of human monocytes/macrophages. J Gen Virol 1991;72:1401-1408. [Free Full Text]
Fox JD, Briggs M, Ward PA, Tedder RS. Human herpesvirus 6 in salivary glands. Lancet 1990;336:590-593. [CrossRef][Medline]
Krueger GRF, Wassermann K, De Clerck LS, et al. Latent herpesvirus-6 in salivary and bronchial glands. Lancet 1990;336:1255-1256. [Medline]
Yoshikawa T, Suga S, Asano Y, et al. Human herpesvirus-6 infection in bone marrow transplantation. Blood 1991;78:1381-1384. [Free Full Text]
Carrigan DR, Drobyski WR, Russler SK, Tapper MA, Knox KK, Ash RC. Interstitial pneumonitis associated with human herpesvirus-6 infection after marrow transplantation. Lancet 1991;338:147-149. [CrossRef][Medline]
Okuno T, Higashi K, Shiraki K, et al. Human herpesvirus 6 infection in renal transplantation. Transplantation 1990;49:519-522. [Medline]
Eizuru Y, Minematsu T, Minamishima Y, et al. Human herpesvirus 6 in lymph nodes. Lancet 1989;1:40-40. [CrossRef]
Niederman JC, Liu C-R, Kaplan MH, Brown NA. Clinical and serological features of human herpesvirus-6 infection in three adults. Lancet 1988;2:817-819. [Medline]
Irving WL, Cunningham AL. Serological diagnosis of infection with human herpesvirus type 6. BMJ 1990;300:156-159.
Steeper TA, Horowitz CA, Ablashi DV, et al. The spectrum of clinical and laboratory findings resulting from human herpesvirus-6 (HHV-6) in patients with mononucleosis-like illnesses not resulting from Epstein-Barr virus or cytomegalovirus. Am J Clin Pathol 1990;93:776-783. [Medline]
Krueger GRF, Sander C. What's new in human herpesvirus-6? Clinical immunopathology of the HHV-6 infection. Pathol Res Pract 1989;185:915-929. [Medline]
Akashi K, Harada M, Shibuya T, et al. Simultaneous occurrence of myelomonocytic leukemia and multiple myeloma: involvement of common leukemia progenitors and their developmental abnormality of "lineage infidelity." J Cell Physiol 1991;148:446-456. [CrossRef][Medline]
Eizuru Y, Minematsu T, Minamishima Y, et al. Rapid diagnosis of cytomegalovirus infections by direct immunoperoxidase staining with human monoclonal antibody against an immediate-early antigen. Microbiol Immunol 1991;35:1015-1022. [Medline]
Okuno T, Sao H, Asada H, Shiraki K, Takahashi M, Yamanishi K. Analysis of a glycoprotein of human herpesvirus 6 (HHV-6) using monoclonal antibodies. Virology 1990;176:625-628. [CrossRef][Medline]
Kawano K, Minamishima Y. Removal of nonspecific hemagglutination inhibitors, immunoglobulin G, and immunoglobulin A with streptococcal cells and its application to the rubella hemagglutination inhibition test. Arch Virol 1987;95:41-52. [Medline]
Larcher C, Huemer HP, Margreiter R, Dierich MP. Serological crossreaction of human herpesvirus-6 with cytomegalovirus. Lancet 1988;2:963-964.
Brown NA, Liu C-R, Hur C, Kaplan MH, Niederman JC. Evidence for reactivation of human herpesvirus-6 in EBV-related mononucleosis. Pediatr Res 1989;25:174A-174A.abstract
Irving WL, Ratnamohan VM, Hueston LC, Chapman JR, Cunningham AL. Dual antibody rises to cytomegalovirus and human herpesvirus type 6: frequency of occurrence in CMV infections and evidence for genuine reactivity to both viruses. J Infect Dis 1990;161:910-916. [Medline]
Linde A, Fridell E, Dahl H, Andersson J, Biberfeld P, Wahren B. Effect of primary Epstein-Barr virus infection on human herpesvirus 6, cytomegalovirus, and measles virus immunoglobulin G titers. J Clin Microbiol 1990;28:211-215. [Free Full Text]
Yanagi K, Harada S, Ban F, Oya A, Okabe N, Tobinai K. High prevalence of antibody to human herpesvirus-6 and decrease in titer with increase in age in Japan. J Infect Dis 1990;161:153-154.
Lusso P, De Maria A, Malnati M, et al. Induction of CD4 and susceptibility to HIV-1 infection in human CD8+ T lymphocytes by human herpesvirus 6. Nature 1991;349:533-535. [CrossRef][Medline]
Primary Human Herpesvirus 6 Infection in an Adult
Morris D. J., Appleton A. L., Sviland L., Schmidt C.A., Wilborn F.F., Siegert W., Cone R., Corey L., Hackman R., Akashi K., Eizuru Y., Sumiyoshi Y.
Extract |
Full Text
N Engl J Med 1993;
329:1817-1819, Dec 9, 1993.
Correspondence
This article has been cited by other articles:
Eshki, M., Allanore, L., Musette, P., Milpied, B., Grange, A., Guillaume, J.-C., Chosidow, O., Guillot, I., Paradis, V., Joly, P., Crickx, B., Ranger-Rogez, S., Descamps, V.
(2009). Twelve-Year Analysis of Severe Cases of Drug Reaction With Eosinophilia and Systemic Symptoms: A Cause of Unpredictable Multiorgan Failure. Arch Dermatol
145: 67-72
[Abstract][Full Text]
Pohl, D, Rostasy, K, Krone, B, Hanefeld, F
(2005). Balo's concentric sclerosis associated with primary human herpesvirus 6 infection. J. Neurol. Neurosurg. Psychiatry
76: 1723-1725
[Abstract][Full Text]
De Bolle, L., Naesens, L., De Clercq, E.
(2005). Update on Human Herpesvirus 6 Biology, Clinical Features, and Therapy. Clin. Microbiol. Rev.
18: 217-245
[Abstract][Full Text]
Wong, G. A. E., Shear, N. H.
(2004). Is a Drug Alone Sufficient to Cause the Drug Hypersensitivity Syndrome?. Arch Dermatol
140: 226-230
[Full Text]
Dockrell, D.H.
(2003). Human herpesvirus 6: molecular biology and clinical features. J Med Microbiol
52: 5-18
[Abstract][Full Text]
Kakimoto, M., Hasegawa, A., Fujita, S., Yasukawa, M.
(2002). Phenotypic and Functional Alterations of Dendritic Cells Induced by Human Herpesvirus 6 Infection. J. Virol.
76: 10338-10345
[Abstract][Full Text]
Collot, S., Petit, B., Bordessoule, D., Alain, S., Touati, M., Denis, F., Ranger-Rogez, S.
(2002). Real-Time PCR for Quantification of Human Herpesvirus 6 DNA from Lymph Nodes and Saliva. J. Clin. Microbiol.
40: 2445-2451
[Abstract][Full Text]
Oster, B., Hollsberg, P.
(2002). Viral Gene Expression Patterns in Human Herpesvirus 6B-Infected T Cells. J. Virol.
76: 7578-7586
[Abstract][Full Text]
Yoshida, M., Torigoe, S., Ikeue, K., Yamada, M.
(2002). Neutralizing Antibody Responses to Human Herpesviruses 6 and 7 Do Not Cross-React with Each Other, and Maternal Neutralizing Antibodies Contribute to Sequential Infection with These Viruses in Childhood. CVI
9: 388-393
[Abstract][Full Text]
Tohyama, M., Hashimoto, K., Descamps, V., Mahe, E.
(2002). Drug Hypersensitivity Syndrome and Human Herpesvirus 6 Reactivation. Arch Dermatol
138: 268-269
[Full Text]
Descamps, V., Valance, A., Edlinger, C., Fillet, A.-M., Grossin, M., Lebrun-Vignes, B., Belaich, S., Crickx, B.
(2001). Association of Human Herpesvirus 6 Infection With Drug Reaction With Eosinophilia and Systemic Symptoms. Arch Dermatol
137: 301-304
[Abstract][Full Text]
Locatelli, G., Santoro, F., Veglia, F., Gobbi, A., Lusso, P., Malnati, M. S.
(2000). Real-Time Quantitative PCR for Human Herpesvirus 6 DNA. J. Clin. Microbiol.
38: 4042-4048
[Abstract][Full Text]
Isomura, H., Yoshida, M., Namba, H., Fujiwara, N., Ohuchi, R., Uno, F., Oda, M., Seino, Y., Yamada, M.
(2000). Suppressive effects of human herpesvirus-6 on thrombopoietin-inducible megakaryocytic colony formation in vitro. J. Gen. Virol.
81: 663-673
[Abstract][Full Text]
Drago, F., Rebora, A.
(1999). The New Herpesviruses: Emerging Pathogens of Dermatological Interest. Arch Dermatol
135: 71-75
[Abstract][Full Text]
Suzuki, Y., Inagi, R., Aono, T., Yamanishi, K., Shiohara, T.
(1998). Human Herpesvirus 6 Infection as a Risk Factor for the Development of Severe Drug-Induced Hypersensitivity Syndrome. Arch Dermatol
134: 1108-1112
[Abstract][Full Text]
Tohyama, M., Yahata, Y., Yasukawa, M., Inagi, R., Urano, Y., Yamanishi, K., Hashimoto, K.
(1998). Severe Hypersensitivity Syndrome Due to Sulfasalazine Associated With Reactivation of Human Herpesvirus 6. Arch Dermatol
134: 1113-1117
[Abstract][Full Text]
Le Cleach, L., Fillet, A. M., Agut, H., Chosidow, O.
(1998). Human Herpesviruses 6 and 7: New Roles Yet to Be Discovered?. Arch Dermatol
134: 1155-1157
[Full Text]
Bandobashi, K., Daibata, M., Kamioka, M., Tanaka, Y., Kubonishi, I., Taguchi, H., Ohtsuki, Y., Miyoshi, I.
(1997). Human Herpesvirus 6 (HHV-6)-Positive Burkitt's Lymphoma: Establishment of a Novel Cell Line Infected With HHV-6. Blood
90: 1200-1207
[Abstract][Full Text]
Morris, D. J., Appleton, A. L., Sviland, L., Schmidt, C.A., Wilborn, F.F., Siegert, W., Cone, R., Corey, L., Hackman, R., Akashi, K., Eizuru, Y., Sumiyoshi, Y.
(1993). Primary Human Herpesvirus 6 Infection in an Adult. NEJM
329: 1817-1819
[Full Text]
(1993). New Disease Associations for Herpes-6. Journal Watch Dermatology
1993: 13-13
[Full Text]
(1993). NEW DISEASE ASSOCIATIONS FOR HERPES-6. JWatch General
1993: 4-4
[Full Text]
Agut, H.
(1993). Puzzles Concerning the Pathogenicity of Human Herpesvirus 6. NEJM
329: 203-204
[Full Text]