The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
Original Article
Brief Report
PreviousPrevious
Volume 329:168-171 July 15, 1993 Number 3
NextNext

Severe Infectious Mononucleosis-like Syndrome and Primary Human Herpesvirus 6 Infection in an Adult
Koichi Akashi, Yoshito Eizuru, Yoshiaki Sumiyoshi, Toshio Minematsu, Sachiko Hara, Mine Harada, Masahiro Kikuchi, Yoshiyuki Niho, and Yoichi Minamishima

 

Commentary
-Letters

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation
Human herpesvirus 6 (HHV-6) was first isolated from patients with the acquired immunodeficiency syndrome or lymphoproliferative diseases and was named human B-lymphotropic virus1. However, later studies revealed that the virus is T-lymphotropic in vitro2 and in vivo3. Recently, two genotypes of HHV-6 (type A and type B) have been distinguished on the basis of their restriction polymorphism4,5,6. HHV-6 has been identified as the etiologic agent of exanthem subitum in infants,7 and an acute febrile illness in young children8. Most people are seropositive for HHV-6 by the age of three years9,10.

HHV-6 also produces latent or chronic infections11,12,13 and is occasionally reactivated in immunocompromised hosts1,14,15,16. Furthermore, HHV-6 has been implicated in several diseases in immunocompetent adults, including Kikuchi's lymphadenitis17 and an infectious mononucleosis-like syndrome that is negative for Epstein-Barr virus and cytomegalovirus18,19,20,21.

We describe the immunopathological and virologic features of a severe infectious mononucleosis-like syndrome in a 43-year-old man that was probably caused by a primary infection with HHV-6 type B.

Case Report

A 43-year-old man was admitted to Harasanshin General Hospital on May 2, 1992, with a seven-day history of fever and a five-day history of progressive, generalized skin eruption. He had been healthy and had a history of self-limiting viral infections including measles and rubella in childhood. Physical examination revealed a high fever (temperature, 40.6 °C), bilateral cervical lymphadenopathy, mild splenomegaly, and tonsillar pharyngitis with a white exudate. The skin was covered with erythematous macules and papules (Figure 1A). The hemoglobin level was 12.7 g per deciliter, the platelet count was 127 x 103 per cubic millimeter, and the white-cell count was 16.9 x 103 per cubic millimeter, with 58 percent atypical lymphocytes. Liver dysfunction was seen, with an increase in the levels of aspartate aminotransferase (64 IU per liter), alanine aminotransferase (98 IU per liter), and lactate dehydrogenase (1313 IU per liter). Serum immunoglobulin levels were normal, and no antibodies against human T-cell lymphotrophic virus type I and human immunodeficiency virus were detected. The heterophil antibody test was negative.


View larger version (375K):
[in this window]
[in a new window]
 
Figure 1. Physical and Immunohistochemical Findings in a 43-Year-Old Man.

There was generalized exanthem over the abdomen; the patient's body was covered with erythematous macules and papules (Panel A). Staining of a skin-biopsy specimen with hematoxylin and eosin revealed focal vacuolar degeneration of the basal layer of the epidermis, with occasional lymphoid cells, and a marked infiltration of lymphoid cells in the dermis (Panel B, x100). The infiltrating lymphocytes were positive for T11 (CD2) on immunohistochemical staining (Panel C, x140). They were also positive for OKT4 (CD4) and OKT8 (CD8) (data not shown), indicating that they consisted of both CD4+ T cells and CD8+ T cells. HHV-6 antigen staining of purified CD4+ T cells with OHV-2 antibody showed that 32 percent of the CD4+ T cells were positive for OHV-2 (Panel D, x950).

 
Within four days of hospitalization, there was a rapid increase in the white-cell count (to 31.0 x 103 per cubic millimeter), with 44 percent atypical lymphocytes, in association with high fevers, continued liver dysfunction (aspartate aminotransferase, 271 IU per liter; alanine aminotransferase, 391 IU per liter; and lactate dehydrogenase, 2067 IU per liter), and renal dysfunction (creatinine, 3.6 mg per deciliter [315 µmol per liter]). The skin lesions coalesced, and diffuse erythema developed over the whole body. Methylprednisolone (250 mg per day) was administered for three days beginning on the seventh day of hospitalization. A decrease in atypical lymphocytes was noted. The skin eruption healed, with abundant membranous exfoliation, and the mononucleosis-like symptoms gradually disappeared. The patient was sent home on the 58th hospital day and had no clinical sequelae.

Methods

Phenotypic Analysis of Atypical Lymphocytes

Peripheral-blood mononuclear cells (PBMCs) were separated by Ficoll-Hypaque density-gradient centrifugation. Nonadherent PBMCs were phenotyped on a FACSort flow cytometer (Becton Dickinson, Mountain View, Calif.), with the use of fluorescein- or phycoerythrin-conjugated monoclonal antibodies, including T11 (CD2), Leu-4 (CD3), Leu-3a (CD4), Leu-9 (CD7), Leu-2a (CD8), Leu-11 (CD16), NKH-1 (CD56), anti-HLA-DR and MY10 (CD34) (all from Becton Dickinson), and J5 (CD10), MY7 (CD13), B4 (CD19), B1 (CD20), and MY9 (CD33) (all from Coulter Immunology, Hialeah, Fla.). Mouse IgG1 conjugated to fluorescein or phycoerythrin was used as a negative control. CD4+ or CD8+ lymphocytes were purified from nonadherent PBMCs on CD4- or CD8-conjugated immunomagnetic beads (Dynabeads M450; Dynal, Oslo, Norway).

Immunohistochemical Staining

A biopsy was performed on the sixth day of hospitalization, and skin was obtained from the forearm in an area with many erythematous papules and macules. Sections of the specimen were stained with the monoclonal antibodies mentioned above, according to the avidin-biotin-alkaline phosphatase method22.

Examination of Viral Antigen

Cytomegalovirus antigen was stained by the direct immunoperoxidase method with a horseradish peroxidase-conjugated human monoclonal antibody, HRP-C723. HHV-6 antigen was examined with an HHV-6-specific monoclonal antibody, OHV-2 (kindly provided by Dr. Yamanishi, Osaka University, Osaka, Japan),24 according to the avidin-biotin-alkaline phosphatase method. OHV-2 can recognize both types of HHV-6.

Titration of Anti-HHV-6 Antibody

The patient's serum samples were cryopreserved at -80 °C until use. Titration of anti-HHV-6 antibody was done by an indirect immunofluorescence assay in which MT-4 cells persistently infected with HHV-6 (HST strain) were used as a target antigen and fluorescein-conjugated antihuman IgG or IgM goat serum was used as a secondary antibody. To detect anti-HHV-6 IgM, serum IgG and IgA were absorbed by G186 and AR1, respectively25. These samples were handled simultaneously. Serum obtained from a patient with active exanthem subitum was used as a positive control.

Examination of Herpesvirus DNA by the Polymerase Chain Reaction

Herpesvirus DNA was detected by the polymerase-chain-reaction (PCR) method. The following primers were used: for amplification of HHV-6 DNA, 5'CCCATTTACGATTTCCTGCACCACCTCTCTGC3' and 5'TTCAGGGACCGTTATGTCATTGAGCATGTC3' (the large-segment protein-gene region); for cytomegalovirus, 5'GCAGAGCTCGTTTAGTGAACC3' and 5'GGCACGGGGAATCCGCGTTCC3' (the major immediate early region); for Epstein-Barr virus, 5' CCAGAGGTAAGTGGACTT3' and 5'GACCGGTGCCTTCTTAGG3' (the long-internal-reiteration region); and for herpes simplex virus, 5'CATCACCGACCCGGAGAGGGAC3' and 5'GGGCCAGGCGCTTCTTGGTGTA3' (the DNA polymerase region).

Genotyping of HHV-6

Genotyping of HHV-6 was carried out according to Aubin et al5. HHV-6 DNA was amplified with primers 5'GATCCGACGCCTACAAACAC3' and 5'CGGTGTCACACAGCATGAACTCTC3'. The expected PCR product of 830 base pairs (bp) corresponds to the pHC5 insert of HHV-6. The PCR product was digested with HindIII and then subjected to electrophoresis on a 3 percent agarose gel. After the bands were stained with ethidium bromide, the electrophoretic pattern was photographed under ultraviolet light. PCR products from HHV-6 type B are digested into 610-bp and 220-bp fragments, whereas those from type A HHV-6 are not5.

Results

The majority of the population of PBMCs on the sixth day of hospitalization consisted of CD4+ and CD8+ T cells. The cells were positive for CD2 (91.6 percent), CD3 (88.1 percent), CD4 (35.7 percent), CD7 (77.2 percent), CD8 (52.6 percent), and HLA-DR (79.0 percent), whereas they were negative for CD10 (0 percent), CD13 (0.4 percent), CD16 (1.4 percent), CD19 (0.8 percent), CD20 (0.6 percent), CD33 (2 percent), CD34 (0 percent), and CD56 (1.9 percent). T cells positive for CD4 and CD8 were not detected by CD4/CD8 two-color analysis.

The skin biopsy revealed a diffuse infiltration of atypical lymphoid cells in the dermis. The epidermis was nearly intact except for focal vacuolar degeneration of the basal layer (Figure 1B). The infiltrating lymphocytes were positive for CD2 (Figure 1C), CD3, CD4, and CD8, but negative for CD19 and CD20.

Table 1 shows the serial changes in titers of antibody against herpesviruses. Anti-HHV-6 IgG could not be detected 13 days after the onset of disease (hospital day 6), but it was detected on day 24 of the illness (hospital day 17) and reached its peak on day 74 (hospital day 67). IgG antibodies against cytomegalovirus, Epstein-Barr virus, and herpes simplex virus were detected, but their titers did not change significantly during the course of the illness.

View this table:
[in this window]
[in a new window]
 
Table 1. Antibody Titers and Viral DNA in the Patient's Serum.

 
Immunohistochemical staining with OHV-2 was performed on CD4+ and CD8+ T cells collected on the sixth day of hospitalization. Thirty-two percent of the CD4+ T cells were positive for the HHV-6 antigen (Figure 1D), whereas CD8+ T cells were negative for the antigen (<1 percent). Cytomegalovirus-infected cells were not observed in the nucleated blood cells (0 per 26,000 cells).

HHV-6 DNA was detected by PCR in serum collected on days 10 and 13 of the patient's illness, indicating the presence of HHV-6 viremia (Table 1); other types of herpesvirus DNA were not detected. HHV-6 DNA was also amplified by PCR in nonadherent PBMCs, CD4+ T cells, and a skin-biopsy specimen (data not shown). Digestion of the 830-bp PCR product with HindIII produced two fragments of 610 bp and 220 bp, indicating a type B genotype (Figure 2).


View larger version (15K):
[in this window]
[in a new window]
 
Figure 2. Genotypic Analysis of HHV-6 DNA Amplified by PCR.

The 830-bp PCR product was amplified in nonadherent PBMCs and CD4+ T cells. The digestion of the 830-bp band with HindIII produced two fragments of 610 bp and 220 bp, indicating an HHV-6 type B genotype. DNA from MT-4 cells persistently infected with HHV-6 and uninfected MT-4 cells were used as positive and negative controls, respectively. The plus and minus symbols indicate the presence and absence of HindIII digestion, respectively.

 
Discussion

Our 43-year-old patient with a severe mononucleosis-like syndrome had seroconversion of serum anti-HHV-6 IgG; HHV-6-specific DNA sequence was detected in serum, nonadherent PBMCs, CD4+ T cells, and a skin-biopsy specimen. In healthy adults who are positive for anti-HHV-6 IgG, latent HHV-6 DNA has sometimes been undetectable by PCR in serum and nonadherent PBMCs, because HHV-6 latently infects blood monocytes11. Our data indicate that HHV-6 was the cause of our patient's acute illness. Serologic and PCR studies excluded the possibility of active infection by other human herpesviruses. The cytomegalovirus antigen was not detected in nucleated blood cells. Accordingly, the increase in the HHV-6 IgG titer was not the result of serologic cross-reactions between HHV-6 and cytomegalovirus,26 or of the reactivation of HHV-6 induced by active infections with cytomegalovirus or Epstein-Barr virus27,28,29.

Since the anti-HHV-6 IgG titer declines with age,30 it may remain undetected in some adult carriers of HHV-6. It took more than 13 days for anti-HHV-6 IgG to become detectable in our patient. Accordingly, we believe that this episode was due to a primary HHV-6 infection, though anti-HHV-6 IgM could not be detected. The administration of methylprednisolone beginning on hospital day 7 may have suppressed the increase in serum anti-HHV-6 IgM so that it remained below detectable levels. Alternatively, infection of CD4+ T cells with HHV-6 may have impaired the production of anti-HHV-6 IgM.

All the viral strains isolated from children with exanthem subitum were of the type B genotype,5,6,8 whereas HHV-6 type A was isolated most commonly from immunocompromised adults5. The causative HHV-6 in this patient was type B. Skin lesions were striking and severe and did not resemble exanthem subitum. The skin lesions were characterized by an aggressive infiltration of both CD4+ and CD8+ T-cell populations into the dermis. The pathogenesis of the skin rash in exanthem subitum is not well known. The type B genotype could not be regarded as a molecular marker of the pathogenicity of skin involvement in children, because most strains isolated from children with acute febrile illnesses who do not have exanthem are also type B4.

HHV-6 preferentially infects CD4+ T cells in vitro2,6. In exanthem subitum, HHV-6 has been shown to infect CD4+ T cells in vivo3. In our patient, the main target of HHV-6 was also CD4+ T cells. CD4+/CD8+ T cells did not appear in the blood, though the induction of CD4 molecules in CD4-/ CD8+ T cells by HHV-631 has been reported. There were too few B cells to analyze. On the basis of these data, the mechanism of infectious mononucleosis-like illness in this patient might be the unregulated proliferative response of CD8+ T cells against CD4+ T cells infected with HHV-6. This possibility is quite interesting, because in infectious mononucleosis related to Epstein-Barr virus, there is a proliferative response of CD8+ T cells against B cells infected with the virus.

Thus, in addition to causing exanthem subitum in infants and a febrile illness in children, HHV-6 type B can cause a severe infectious mononucleosis-like syndrome in adults.

Supported in part by grants-in-aid from the Fukuoka Cancer Society (1991) and the Japanese Society for the Promotion of Science for Japanese Junior Scientists (05-1238).

We are indebted to Dr. Shuhei Imayama, Department of Dermatology, Faculty of Medicine, Kyushu University, for helpful discussion.


Source Information

From the Departments of Hematology (K.A.) and Dermatology (S.H.), Harasanshin General Hospital, Fukuoka, Japan; the Department of Microbiology, Miyazaki Medical College, Miyazaki, Japan (Y.E., T.M., Y.M.); the First Department of Pathology, School of Medicine, Fukuoka University, Fukuoka, Japan (Y.S., M.K.); and the First Department of Internal Medicine, Kyushu University, Fukuoka, Japan (M.H., Y.N.).

Address reprint requests to Dr. Akashi at the Department of Hematology, Harasanshin General Hospital, 1-8 Taihaku-machi, Hakata-ku, Fukuoka 812, Japan.

References

  1. Salahuddin SZ, Ablashi DV, Markham PD, et al. Isolation of a new virus, HBLV, in patients with lymphoproliferative disorders. Science 1986;234:596-601. [Free Full Text]
  2. Lusso P, Markham PD, Tschachler E, et al. In vitro cellular tropism of human B-lymphotropic virus (human herpesvirus-6). J Exp Med 1988;167:1659-1670. [Free Full Text]
  3. Takahashi K, Sonoda S, Higashi K, et al. Predominant CD4 T-lymphocyte tropism of human herpesvirus 6-related virus. J Virol 1989;63:3161-3163. [Free Full Text]
  4. Ablashi DV, Balachandran N, Josephs SF, et al. Genomic polymorphism, growth properties, and immunologic variations in human herpesvirus-6 isolates. Virology 1991;184:545-552. [CrossRef][Medline]
  5. Aubin J-T, Collandre H, Candotti D, et al. Several groups among human herpesvirus 6 strains can be distinguished by Southern blotting and polymerase chain reaction. J Clin Microbiol 1991;29:367-372. [Free Full Text]
  6. Schirmer EC, Wyatt LS, Yamanishi K, Rodriguez WJ, Frenkel N. Differentiation between two distinct classes of viruses now classified as human herpesvirus 6. Proc Natl Acad Sci U S A 1991;88:5922-5926. [Free Full Text]
  7. Yamanishi K, Okuno T, Shiraki K, et al. Identification of human herpesvirus-6 as a causal agent for exanthem subitum. Lancet 1988;1:1065-1067. [CrossRef][Medline]
  8. Pruksananonda P, Hall CB, Insel RA, et al. Primary human herpesvirus 6 infection in young children. N Engl J Med 1992;326:1445-1450. [Abstract]
  9. Briggs M, Fox J, Tedder RS. Age prevalence of antibody to human herpesvirus 6. Lancet 1988;1:1058-1059. 
  10. Okuno T, Takahashi K, Balachandra K, et al. Seroepidemiology of human herpesvirus 6 infection in normal children and adults. J Clin Microbiol 1989;27:651-653. [Free Full Text]
  11. Kondo K, Kondo T, Okuno T, Takahashi M, Yamanishi K. Latent human herpesvirus 6 infection of human monocytes/macrophages. J Gen Virol 1991;72:1401-1408. [Free Full Text]
  12. Fox JD, Briggs M, Ward PA, Tedder RS. Human herpesvirus 6 in salivary glands. Lancet 1990;336:590-593. [CrossRef][Medline]
  13. Krueger GRF, Wassermann K, De Clerck LS, et al. Latent herpesvirus-6 in salivary and bronchial glands. Lancet 1990;336:1255-1256. [Medline]
  14. Yoshikawa T, Suga S, Asano Y, et al. Human herpesvirus-6 infection in bone marrow transplantation. Blood 1991;78:1381-1384. [Free Full Text]
  15. Carrigan DR, Drobyski WR, Russler SK, Tapper MA, Knox KK, Ash RC. Interstitial pneumonitis associated with human herpesvirus-6 infection after marrow transplantation. Lancet 1991;338:147-149. [CrossRef][Medline]
  16. Okuno T, Higashi K, Shiraki K, et al. Human herpesvirus 6 infection in renal transplantation. Transplantation 1990;49:519-522. [Medline]
  17. Eizuru Y, Minematsu T, Minamishima Y, et al. Human herpesvirus 6 in lymph nodes. Lancet 1989;1:40-40. [CrossRef]
  18. Niederman JC, Liu C-R, Kaplan MH, Brown NA. Clinical and serological features of human herpesvirus-6 infection in three adults. Lancet 1988;2:817-819. [Medline]
  19. Irving WL, Cunningham AL. Serological diagnosis of infection with human herpesvirus type 6. BMJ 1990;300:156-159.
  20. Steeper TA, Horowitz CA, Ablashi DV, et al. The spectrum of clinical and laboratory findings resulting from human herpesvirus-6 (HHV-6) in patients with mononucleosis-like illnesses not resulting from Epstein-Barr virus or cytomegalovirus. Am J Clin Pathol 1990;93:776-783. [Medline]
  21. Krueger GRF, Sander C. What's new in human herpesvirus-6? Clinical immunopathology of the HHV-6 infection. Pathol Res Pract 1989;185:915-929. [Medline]
  22. Akashi K, Harada M, Shibuya T, et al. Simultaneous occurrence of myelomonocytic leukemia and multiple myeloma: involvement of common leukemia progenitors and their developmental abnormality of "lineage infidelity." J Cell Physiol 1991;148:446-456. [CrossRef][Medline]
  23. Eizuru Y, Minematsu T, Minamishima Y, et al. Rapid diagnosis of cytomegalovirus infections by direct immunoperoxidase staining with human monoclonal antibody against an immediate-early antigen. Microbiol Immunol 1991;35:1015-1022. [Medline]
  24. Okuno T, Sao H, Asada H, Shiraki K, Takahashi M, Yamanishi K. Analysis of a glycoprotein of human herpesvirus 6 (HHV-6) using monoclonal antibodies. Virology 1990;176:625-628. [CrossRef][Medline]
  25. Kawano K, Minamishima Y. Removal of nonspecific hemagglutination inhibitors, immunoglobulin G, and immunoglobulin A with streptococcal cells and its application to the rubella hemagglutination inhibition test. Arch Virol 1987;95:41-52. [Medline]
  26. Larcher C, Huemer HP, Margreiter R, Dierich MP. Serological crossreaction of human herpesvirus-6 with cytomegalovirus. Lancet 1988;2:963-964. 
  27. Brown NA, Liu C-R, Hur C, Kaplan MH, Niederman JC. Evidence for reactivation of human herpesvirus-6 in EBV-related mononucleosis. Pediatr Res 1989;25:174A-174A.abstract 
  28. Irving WL, Ratnamohan VM, Hueston LC, Chapman JR, Cunningham AL. Dual antibody rises to cytomegalovirus and human herpesvirus type 6: frequency of occurrence in CMV infections and evidence for genuine reactivity to both viruses. J Infect Dis 1990;161:910-916. [Medline]
  29. Linde A, Fridell E, Dahl H, Andersson J, Biberfeld P, Wahren B. Effect of primary Epstein-Barr virus infection on human herpesvirus 6, cytomegalovirus, and measles virus immunoglobulin G titers. J Clin Microbiol 1990;28:211-215. [Free Full Text]
  30. Yanagi K, Harada S, Ban F, Oya A, Okabe N, Tobinai K. High prevalence of antibody to human herpesvirus-6 and decrease in titer with increase in age in Japan. J Infect Dis 1990;161:153-154. 
  31. Lusso P, De Maria A, Malnati M, et al. Induction of CD4 and susceptibility to HIV-1 infection in human CD8+ T lymphocytes by human herpesvirus 6. Nature 1991;349:533-535. [CrossRef][Medline]

 

Commentary
-Letters

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation

Related Letters:

Primary Human Herpesvirus 6 Infection in an Adult
Morris D. J., Appleton A. L., Sviland L., Schmidt C.A., Wilborn F.F., Siegert W., Cone R., Corey L., Hackman R., Akashi K., Eizuru Y., Sumiyoshi Y.
Extract | Full Text  
N Engl J Med 1993; 329:1817-1819, Dec 9, 1993. Correspondence

This article has been cited by other articles:



HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  TERMS OF USE  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved.