FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 330:675-679 March 10, 1994 Number 10 Next

Abstract Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

ABSTRACT

Background X-linked sideroblastic anemia is usually associated with reduced 5-aminolevulinate synthase activity in erythroid cells, and some cases are responsive to treatment with pyridoxine, the precursor to the cofactor of the enzyme. The recently identified gene for an erythroid-specific 5-aminolevulinate synthase isoenzyme and its localization to the X chromosome make it likely that one or more defects in this gene underlie the anemia.

Methods Using a polymorphic dinucleotide-repeat sequence in the erythroid 5-aminolevulinate synthase gene, we confirmed the linkage of this gene to the disorder in a family with X-linked pyridoxine-responsive sideroblastic anemia. We therefore sought evidence of a nucleotide-sequence abnormality in the erythroid 5-aminolevulinate synthase gene by analyzing enzymatically amplified DNA.

Results DNA-sequencing studies in two affected males and one carrier female in the kindred demonstrated a cytosine-to-guanine change at nucleotide 1215 (in exon 8). This change results in the substitution of serine for threonine at amino acid residue 388, near the lysine that binds the pyridoxal phosphate cofactor. In expression studies, the activity of the mutant enzyme was reduced relative to that of the wild type, and this reduction was comparable to that in erythroid cells of the proband during relapse of the anemia; the enzyme activity expressed in the presence of pyridoxine was comparable to that in the proband's marrow cells during remission. Although the affinity of the mutant enzyme for pyridoxal phosphate was not altered, the mutation appears to introduce a conformational change at the active site of the enzyme.

Conclusions We identified a point mutation resulting in an amino acid change near the pyridoxal phosphate-binding site of the erythroid 5-aminolevulinate synthase isoenzyme as the underlying defect in a kindred with X-linked pyridoxine-responsive sideroblastic anemia.

In all sideroblastic anemias the biosynthesis of heme in the erythroid cell is compromised despite the normal delivery of iron to mitochondria, and the unused iron accumulates in these organelles in the form of iron salts¹. A defect in the first enzyme of the heme biosynthetic pathway, 5-aminolevulinate synthase, can be implicated in patients with pyridoxine-responsive sideroblastic anemia, since pyridoxal phosphate is the essential cofactor for this enzyme. Moreover, the low level of activity of 5-aminolevulinate synthase in the bone marrow of patients with this type of anemia may be enhanced or restored to normal by the addition of pyridoxal phosphate in vitro or by supplementation with pyridoxine in vivo¹. The discovery of a distinct 5-aminolevulinate synthase gene (ALAS2),² located on the X chromosome^3,4 and expressed only in erythroid cells,^2,5,6 supports the proposition that the defect responsible for X-linked sideroblastic anemia resides in the gene for the erythroid 5-aminolevulinate synthase isoenzyme⁷.

Recently Cotter et al.⁸ identified a point mutation in ALAS2 in a patient with pyridoxine-responsive sideroblastic anemia that resulted in an enzyme with very low activity. However, no relatives were available for study, and the effect of pyridoxine administration on the activity of 5-aminolevulinate synthase in bone marrow was not investigated. We report a pedigree analysis of a family with X-linked pyridoxine-responsive sideroblastic anemia in which we demonstrate the transmission of a point mutation in ALAS2 different from that reported by Cotter et al.⁸ and describe unique features of the mutant enzyme.

Methods

Case Report

The proband, a man born in 1918, was noted in 1973 to have a hemoglobin level of 11.0 g per deciliter (6.8 mmol per liter), a mean corpuscular volume of 60 microm³, and ring sideroblasts in the bone marrow. After treatment with pyridoxine, his hemoglobin level increased to 13.2 g per deciliter (8.2 mmol per liter) and his mean corpuscular volume to 70 microm³. The patient subsequently discontinued pyridoxine therapy and was first seen at Austin Hospital (Heidelberg, Australia) in May 1987 with fatigue. Physical examination revealed signs of chronic obstructive lung disease. The hemoglobin level was 6.2 g per deciliter (3.8 mmol per liter), the mean corpuscular volume 41 microm³, the white-cell count 10,800 per cubic millimeter, and the platelet count 835,000 per cubic millimeter. The blood smear showed marked microcytosis, hypochromia, and poikilocytosis. Analysis of a bone marrow aspirate revealed mild erythroid hyperplasia and ring sideroblasts constituting half the erythroid precursors. The serum iron concentration was 246 µg per deciliter (44 µmol per liter), total iron-binding capacity 251 µg per deciliter (45 µmol per liter), transferrin saturation 98 percent, and serum ferritin concentration 773 ng per milliliter. The serum folate concentration was 1.7 ng per milliliter (3.9 nmol per liter). Except for a serum aspartate aminotransferase concentration of 62 U per liter, liver-function tests were normal, as were determinations of serum vitamin B₁₂, blood lead, and free erythrocyte protoporphyrin.

Therapy was begun with pyridoxine (300 mg per day) and folic acid (5 mg per day); the patient's hemoglobin level increased to 14.9 g per deciliter (9.2 mmol per liter) within two months, and the mean corpuscular volume stabilized at 77 microm³. A bone marrow aspirate seven weeks later showed only occasional ring sideroblasts. Pyridoxine was again discontinued. Eleven weeks later, the patient's hemoglobin level and mean corpuscular volume had decreased to 9.8 g per deciliter (6.1 mmol per liter) and 59 microm³, respectively, and numerous ring sideroblasts were again present in the marrow. After another remission of the anemia with pyridoxine supplementation, an effort was made to determine the minimal dose of pyridoxine necessary to maintain a normal hemoglobin value; this was found to be 4 mg per day.

An investigation of the patient's family revealed one grandson (Subject IV-6) (Figure 1), 22 years of age, with a normal hemoglobin level (14.4 g per deciliter [8.9 mmol per liter]), a mean corpuscular volume of 74 microm³, a serum transferrin saturation of 75 percent, and a serum ferritin level of 99 ng per milliliter. A nephew, 52 years of age (Subject III-1), had had severe sideroblastic anemia at the age of 40 (hemoglobin level, 5.0 g per deciliter [3.1 mmol per liter]; mean corpuscular volume, 68 microm³), with an incomplete but sustained response to pyridoxine (maximal hemoglobin level, 10.5 g per deciliter [6.5 mmol per liter]), splenomegaly, and myelofibrosis. One of the proband's daughters (Subject III-6) had a mean corpuscular volume of 73 microm³ and accompanying iron deficiency; the other four daughters (Subjects III-7, III-8, III-9, and III-10) had normal blood counts, no erythrocyte microcytosis, and normal serum iron and ferritin values.

View larger version (8K): [in this window] [in a new window]   Figure 1. Pedigree of a Family with Pyridoxine-Responsive Sideroblastic Anemia. Circles denote female family members, squares male family members, and diamonds additional members of either sex (the number of additional members is shown in the diamonds). Solid symbols denote affected family members, circles with a central dot carriers of the trait, question marks inside the symbols unknown status with respect to the trait, and symbols with diagonal lines deceased members. The arrow indicates the proband.

 
Measurement of 5-Aminolevulinate Synthase Activity in Bone Marrow Cells

Bone marrow aspirates were obtained from the proband and seven normal subjects after each had given informed consent in accord with institutional guidelines. The aspirates were treated with heparin, at least 95 percent of the erythrocytes were removed from the nucleated marrow cells,⁹ and the percentages of erythroid cells were calculated in Wright's-stained smears of the final cell preparations. Cells were disrupted by sonication or by homogenization in the presence of 0.1 percent Triton X-100 (Pierce Chemical, Rockford, Ill.),¹⁰ and the activity of 5-aminolevulinate synthase in these lysates was measured as described by Fitzsimons et al.¹¹. Although 5-aminolevulinate synthase activity in lysates of whole marrow cells reflects enzyme activity in erythroid and nonerythroid cells, the activity in nonerythroid cells from normal subjects is approximately one fourth of that in erythroid cells, so that at least 50 percent of the measured enzyme activity is from the erythroid source¹¹. Since the erythroid-cell fractions and stages of erythroid development in marrow samples from the normal subjects and the patient were comparable (15 to 25 percent), we inferred that the activity of 5-aminolevulinate synthase was largely in erythroid cells.

Amplification, Cloning, and Sequencing of ALAS2 DNA

RNA was prepared from bone marrow aspirates and whole blood as described by Chomczynski and Sacchi¹². Complementary DNA (cDNA) was synthesized from the RNA and amplified in a polymerase chain reaction with five sets of oligonucleotide primers (I, II, III, IV, and V) spanning the entire coding region of the ALAS2 messenger RNA to generate overlapping fragments of the cDNA⁶. These were cloned into the vector pTZ18R and then sequenced with the Sequenase version 2.0 kit (U.S. Biochemical, Cleveland).

Genomic DNA was isolated from venous blood according to the method of John et al.¹³. An ALAS2 genomic fragment spanning exons 8 and 9^5,6 was amplified under standard conditions with the oligonucleotide A17-1799, which binds within intron 7,¹⁴ and the antisense oligonucleotide from primer set IV⁶. The amplified fragments were cloned and sequenced as described above. The oligonucleotide primers and conditions used for the amplification and analysis of a fragment in intron 7 of ALAS2 and other fragments on the X chromosome were as described by Cox et al.¹⁴.

Expression of Constructs of Wild-Type and Mutant ALAS2 Clones in Escherichia coli

Wild-type and mutant ALAS2 clones expressing the mature form of the enzyme were constructed by site-directed mutagenesis¹⁵ of the full-length ALAS2 cDNA clone pHEA-6⁵. The glutamate residue corresponding to the 50th amino acid of the precursor form of 5-aminolevulinate synthase has been postulated to be the first amino acid of the mature enzyme,⁵ and the codon of this glutamate (at nucleotide position 200) was replaced in clone pHEA-6 with a methionine codon (as an NdeI restriction site) with an oligonucleotide (EA1737:5'CTACCCAAGACCAAACTGTCATATGATCCACCTTAAGGCAACAAAG3') corresponding to nucleotides 177 to 223. The resultant clone was excised as an NdeI-BamHI restriction-enzyme fragment of approximately 1.7 kb and ligated into pET3a vector (with NdeI and BamHI as restriction sites) to form the ALAS2 wild-type clone. A mutant ALAS2 clone in which serine was substituted for threonine at position 388 (representing the mutation detected in affected family members) was constructed as follows. The polymerase-chain-reaction product of the proband's DNA obtained with primer set IV was digested with NcoI to produce a fragment of 278 base pairs containing the mutation, and this fragment was substituted for the corresponding NcoI fragment in the wild-type construct. The generation of these clones was confirmed by sequencing.

The wild-type and mutant clones for ALAS2 were transformed into E. coli strain HMS174DE3 (T7 lysogen) under standard conditions¹⁵ and induced according to the procedure of Studier et al.¹⁶. Cultures were grown with or without 0.1 percent pyridoxine in the medium. The activity of 5-aminolevulinate synthase in harvested E. coli was assayed according to the radiochemical method of Fitzsimons et al.¹¹. Total protein concentration was measured with a protein microassay (Bio-Rad Laboratories, Richmond, Calif.). Enzyme protein was examined by Western blot analysis with a cross-reacting avian 5-aminolevulinate synthase antibody. The mature form of 5-aminolevulinate synthase produced by the prokaryotic expression system migrated at the expected molecular weight⁵ on sodium dodecyl sulfate-polyacrylamide-gel electrophoresis.

Results

5-Aminolevulinate Synthase Activity in the Proband's Bone Marrow Cells

The activity of 5-aminolevulinate synthase in the proband's bone marrow cells before and after pyridoxine administration is shown in Table 1. When the patient was not taking pyridoxine and was in relapse, the activity was 29 to 36 percent of the mean value in normal subjects and was enhanced but not restored to normal values by the addition of pyridoxal phosphate in vitro. The administration of pyridoxine restored the activity of 5-aminolevulinate synthase in the sonicate to normal and in the Triton X-100 lysate to a level above the control range (±2 SD).

View this table: [in this window] [in a new window]   Table 1. 5-Aminolevulinate Synthase Activity in Marrow Cell Sonicates and Lysates from the Proband during Relapse and Remission and from Seven Normal Subjects.

 
Analysis of Genetic Linkage of ALAS2 to Pyridoxine-Responsive Sideroblastic Anemia

To determine whether a defect in ALAS2 was responsible for the pyridoxine-responsive sideroblastic anemia in the kindred, genetic-linkage analysis was carried out with a highly polymorphic dinucleotide-repeat sequence in intron 7 of the ALAS2 gene¹⁴ and with other dinucleotide- and trinucleotide-repeat markers on the X chromosome (Table 2). The same ALAS2 allele was found to be present in all affected male family members (Subjects II-4, III-1, and IV-6) (Figure 1) as well as in the two obligate female carriers tested, but not in the two unaffected male relatives (Subjects III-11 and IV-13). A recombination event was detected (Subject III-1) between the disease locus and markers DXS7 and SYN1, which lie distal to ALAS2 on the short arm of the X chromosome, providing additional evidence that the pyridoxine-responsive sideroblastic anemia locus is proximal to the SYN1 marker¹⁴.

View this table: [in this window] [in a new window]   Table 2. Genotypes for Seven Dinucleotide- and Trinucleotide-Repeat Markers on the X Chromosome in Seven Members of the Kindred with Pyridoxine-Responsive Sideroblastic Anemia.

 
Identification of a Point Mutation in the ALAS2 Gene

The sequences of four clones for each polymerase-chain-reaction fragment derived from bone marrow ALAS2 messenger RNA from the proband and generated in different enzymatic reactions were identical. A comparison of the ALAS2 sequence obtained with the sequence in five normal subjects and the published sequences^5,17 revealed an alteration of a single base (a change from cytosine to guanine) at nucleotide position 1215 (Figure 2A), which is near the 3' end of exon 8. Sequence analysis of genomic DNA from a heterozygous daughter (Subject III-9) (Figure 1) and the nephew with erythrocyte microcytosis (Subject III-1) revealed the same nucleotide change. Amplified products from the normal subjects showed no sequence polymorphism at this position.

View larger version (45K): [in this window] [in a new window]   Figure 2. Identification of a Mutation in ALAS2 in the Kindred with Pyridoxine-Responsive Sideroblastic Anemia. Panel A shows the nucleotide sequence from normal (wild type) cDNA and from the proband's (mutant) cDNA. The region of nucleotides 1205 to 1221 (exon 8) is shown. The single nucleotide difference detected in the mutant cDNA causing the substitution of serine for threonine at position 388 is indicated by an asterisk. Panel B shows the conservation of the amino acid sequence surrounding the pyridoxal phosphate-binding lysine of 5-aminolevulinate synthase enzymes. Amino acid residues that do not vary across all species and in another pyridoxal phosphate-dependent enzyme, 2-amino-3-ketobutyrate coenzyme A ligase from E. coli, are boxed. The boxed lysine residue (K) is the pyridoxal phosphate-binding residue18. A consensus sequence for the region is shown below the comparison. The proband's sequence is presented below the consensus sequence, and the substitution of serine for threonine at position 388 is indicated by an arrow.

 
The mature ALAS2 protein contains 538 amino acids. The mutation detected would result in the replacement of a threonine by a serine at position 388,⁵ in a region that is highly conserved and contains the lysine involved in the binding of the pyridoxal phosphate cofactor (Figure 2B). A comparison of predicted secondary structures for the wild-type and mutant enzymes with the algorithm of Chou and Fasman revealed a subtle alteration in the mutant with the introduction of a turn in the region surrounding residue 388 (data not shown).

Expression of Wild-Type and Mutant ALAS2 Clones in E. coli

The cDNA clones encoding the mature mutant and wild-type ALAS2 proteins expressed in E. coli produced equivalent amounts of protein relative to total E. coli protein, and the amounts of either protein were not altered by the presence of pyridoxine in the medium. The enzyme activity in 10 experiments is summarized in Figure 3. The exclusion of pyridoxine from the medium and of pyridoxal phosphate from the assay resulted in activity of the mutant enzyme that was approximately 50 percent lower than that of the wild-type enzyme. The addition of pyridoxal phosphate to the assay or the inclusion of pyridoxine (0.1 percent) in the medium increased the activities of both enzymes to a similar degree. The inclusion of both pyridoxine in the medium and pyridoxal phosphate (0.4 mM) in the assay increased the relative enzyme activities above the levels obtainable by the addition of pyridoxal phosphate to the assay alone. Under all these conditions, however, the activity of the mutant enzyme was consistently 50 to 60 percent of that of the wild-type enzyme. The activity of the mutant enzyme expressed in pyridoxine-supplemented cells approximated that of the wild-type enzyme expressed in the absence of pyridoxine.

View larger version (12K): [in this window] [in a new window]   Figure 3. Activity of Wild-Type and Mutant ALAS2 Enzymes Expressed in E. coli. The activity of 5-aminolevulinate synthase was measured in the presence and absence of pyridoxal phosphate (0.4 mM) in the assay in extracts from E. coli transformed with either the wild-type or the mutant clone, each of which was grown in the presence or absence of 0.1 percent pyridoxine in the medium. The results are the means (±SE) of 10 sets of transformed cultures.

 
In other experiments pyridoxal phosphate, in concentrations ranging from 0 to 30 micro M, increased the relative activities of the normal and mutant enzymes to the same extent, indicating that they have the same binding affinity for the cofactor (data not shown). With pyridoxal phosphate concentrations of up to 2.0 mM, there was no further enhancement of the activity of either enzyme.

Discussion

The finding that affected members and obligate carriers of a family with X-linked pyridoxine-responsive sideroblastic anemia inherited the same ALAS2 allele supports the hypothesis that a defect in this gene underlies the disorder. The subsequently identified mutation of cytosine to guanine in exon 8 of the ALAS2 gene in the proband and two other members of the kindred leads to a conservative amino acid substitution of serine for threonine at residue 388 of the protein and results in an enzyme with reduced catalytic activity. This threonine is invariant and in a region that is highly conserved in bacterial and eukaryotic 5-aminolevulinate synthase proteins as well as in the E. coli pyridoxal phosphate-dependent enzyme 2-amino-3-ketobutyrate coenzyme A ligase¹⁹ (Figure 2B). The pyridoxal phosphate-binding site in ALAS2 in mice¹⁸ and in 2-amino-3-ketobutyrate coenzyme A ligase²⁰ is an invariant lysine located three residues from this threonine. Our study showed that the replacement of the threonine by serine did not lower the affinity of the enzyme for its cofactor. The reduced enzyme activity of the mutant protein may be due to a conformational change in the vicinity of the active lysine that reduces the affinity of the enzyme for its substrates, glycine and succinyl coenzyme A²¹.

Why treatment with pyridoxine increased the proband's bone marrow 5-aminolevulinate synthase activity to normal or above-normal values is not clear. Pyridoxine (or pyridoxal phosphate) may affect the amount of catalytically active ALAS2 in mitochondria by enhancing the synthesis, stability, transport into mitochondria, or correct folding of the enzyme. The expression studies demonstrated that the inclusion of pyridoxine in the growth medium always increased the activity of both mutant and wild-type enzymes to levels above those achievable when pyridoxal phosphate alone was added to the assay, suggesting that pyridoxine (by means of pyridoxal phosphate) facilitates the correct folding of the protein and hence the formation of larger amounts of catalytically active enzyme.

Further heterogeneity of the mutations in the ALAS2 gene can be anticipated in kindreds with X-linked sideroblastic anemia, in addition to those reported here and by Cotter et al.⁸. The nature of the ALAS2 mutation may determine the extent to which deficient enzyme activity can be corrected by the administration of pyridoxine. Variations in the amount of supplemental pyridoxine required to obtain a therapeutic response may likewise relate to the nature of the ALAS2 mutation. The vitamin has usually been administered in doses ranging from 25 to 300 mg per day, but a dose as small as 2.5 to 10 mg per day was sufficient in some patients²². In this study, the proband presented late in life and required only a small dose of pyridoxine (4 mg per day) to supplement the usual dietary intake of 1 to 2 mg per day. Such a late presentation may reflect the prior intake of pyridoxine as part of a multivitamin,²³ changes in dietary habits, or alterations in pyridoxine metabolism with age²⁴. The contribution of such factors could also be postulated in the two other affected male members of the kindred. Why the erythrocyte microcytosis persists despite the restoration of 5-aminolevulinate synthase activity and hemoglobin levels with pyridoxine therapy is not known.

Supported in part by research funds from the Department of Veterans Affairs and the National Health and Medical Research Council. Mr. Cox is the recipient of a National Health and Medical Research Council Biomedical Postgraduate Scholarship.

We are indebted to Drs. Peta Dennington and Andrew Grigg (Austin Hospital, Heidelberg, Australia) for obtaining bone marrow cells from the proband, to Dr. Henry Januszewicz (Peter MacCallum Hospital, Melbourne, Australia) for preparing DNA from the proband's nephew (Subject III-1), to Dr. John Mulley and Ms. Agi Gedeon (Adelaide Children's Hospital, Adelaide, Australia) for kindly supplying the various oligonucleotide primers for the linkage analysis, to Dr. John Wallace and Professor Bill Elliott for helpful discussions, and to Ms. Fiona Topfer for technical assistance.

Source Information

From the Department of Biochemistry, University of Adelaide, Adelaide, Australia (T.C.C., M.J.B., C.S.M., B.K.M.); the Department of Medicine, University of Oklahoma College of Medicine and Veterans Affairs Medical Center, Oklahoma City (S.S.B.); and the Department of Hematology, Austin Hospital, Heidelberg, Victoria, Australia (J.S.W.).

Address reprint requests to Dr. Bottomley at the Veterans Affairs Medical Center, Hematology-Oncology Section, 921 N.E. 13th St., Oklahoma City, OK 73104.

References

1. Bottomley SS. Sideroblastic anemias. In: Lee GR, Bithell TC, Foerster J, Athens JW, Lukens JN, eds. Wintrobe's clinical hematology. 9th ed. Vol. 1. Philadelphia: Lea & Febiger, 1993:852-71. 
2. Riddle RD, Yamamoto M, Engel JD. Expression of delta-aminolevulinate synthase in avian cells: separate genes encode erythroid-specific and nonspecific isozymes. Proc Natl Acad Sci U S A 1989;86:792-796. [Free Full Text]
3. Cox TC, Bawden MJ, Abraham NG, et al. Erythroid 5-aminolevulinate synthase is located on the X chromosome. Am J Hum Genet 1990;46:107-111. [Medline]
4. Bishop DF, Henderson AS, Astrin KH. Human delta-aminolevulinate synthase: assignment of housekeeping gene to 3p21 and the erythroid-specific gene to the X chromosome. Genomics 1990;7:207-214. [CrossRef][Medline]
5. Cox TC, Bawden MJ, Martin A, May BK. Human erythroid 5-aminolevulinate synthase: promoter analysis and identification of an iron-responsive element in the mRNA. EMBO J 1991;10:1891-1902. [Medline]
6. Conboy JG, Cox TC, Bottomley SS, Bawden MJ, May BK. Human erythroid 5-aminolevulinate synthase: gene structure and species-specific differences in alternative RNA splicing. J Biol Chem 1992;267:18753-18758. [Free Full Text]
7. May BK, Bhasker CR, Bawden MJ, Cox TC. Molecular regulation of 5-aminolevulinate synthase: diseases related to heme biosynthesis. Mol Biol Med 1990;7:405-421. [Medline]
8. Cotter PD, Baumann M, Bishop DF. Enzymatic defect in "X-linked" sideroblastic anemia: molecular evidence for erythroid delta-aminolevulinate synthase deficiency. Proc Natl Acad Sci U S A 1992;89:4028-4032. [Free Full Text]
9. Triebel F, Rio B, Tanzer J, Goube de Laforest P. The selective removal of red blood cells from bone marrow cell suspensions. Leuk Res 1979;3:131-134. [CrossRef][Medline]
10. Bottomley SS, Healy HM, Brandenburg MA, May BK. 5-Aminolevulinate synthase in sideroblastic anemias: mRNA and enzyme activity levels in bone marrow cells. Am J Hematol 1992;41:76-83. [Medline]
11. Fitzsimons EJ, May A, Elder GH, Jacobs A. Measurement of 5-aminolevulinic acid synthase activity in whole and fractionated human bone marrow: effect of myeloid cell lysis by monoclonal antibody. Anal Biochem 1986;153:9-17. [CrossRef][Medline]
12. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156-159. [Medline]
13. John SWM, Weitzner G, Rozen R, Scriver CR. A rapid procedure for extracting genomic DNA from leukocytes. Nucleic Acids Res 1991;19:408-408. [Free Full Text]
14. Cox TC, Kozman HM, Raskind WH, May BK, Mulley JC. Identification of a highly polymorphic marker within intron 7 of the ALAS2 gene and suggestion of at least two loci for X-linked sideroblastic anemia. Hum Mol Genet 1992;1:639-641. [Free Full Text]
15. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1989.
16. Studier FW, Rosenberg AH, Dunn JJ, Dubendorff JW. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol 1990;185:60-89. [Medline]
17. Bishop DF. Two different genes encode delta-aminolevulinate synthase in humans: nucleotide sequences of cDNAs for the housekeeping and erythroid genes. Nucleic Acids Res 1990;18:7187-7188. [Free Full Text]
18. Ferreira GC, Neame PJ, Dailey HA. Heme biosynthesis in mammalian systems: evidence of a Schiff base linkage between the pyridoxal 5'-phosphate cofactor and a lysine residue in 5-aminolevulinate synthase. Protein Sci 1993;2:1959-1965. [Medline]
19. Aronson BD, Ravnikar PD, Somerville RL. Nucleotide sequence of the 2-amino-3-ketobutyrate coenzyme A ligase (kbl) gene in E. coli. Nucleic Acids Res 1988;16:3586-3586. [Free Full Text]
20. Mukherjee JJ, Dekker EE. 2-Amino-3-ketobutyrate CoA ligase of Escherichia coli: stoichiometry of pyridoxal phosphate binding and location of the pyridoxyllysine peptide in the primary structure of the enzyme. Biochim Biophys Acta 1990;1037:24-29. [CrossRef][Medline]
21. Jordan PM. The biosynthesis of 5-aminolaevulinic acid and its transformation into uroporphyrinogen III. In: Jordan PM, ed. Biosynthesis of tetrapyrroles. Vol. 19 of New comprehensive biochemistry. Amsterdam: Elsevier, 1991:1-66.
22. Harris JW, Horrigan DL. Pyridoxine-responsive anemia -- prototype and variations on the theme. Vitam Horm 1964;22:721-753. [CrossRef][Medline]
23. Rosenberg SJ, Bennett JM. Pyridoxine-responsive anemia. N Y State J Med 1969;69:1430-1433. [Medline]
24. Hamfelt A, Soderhjelm L. Vitamin B-6 and aging. In: Leklem JE, Reynolds RD, eds. Clinical and physiological applications of vitamin B-6: proceedings of the Third International Conference on Vitamin B-6, Goslar-Hahnenklee, Germany, August 24-28, 1987. New York: Alan R. Liss, 1988:95-107.

Abstract Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

This article has been cited by other articles:

• Nakajima, O., Okano, S., Harada, H., Kusaka, T., Gao, X., Hosoya, T., Suzuki, N., Takahashi, S., Yamamoto, M. (2006). Transgenic rescue of erythroid 5-aminolevulinate synthase-deficient mice results in the formation of ring sideroblasts and siderocytes. GENES CELLS 11: 685-700 [Abstract] [Full Text]  
• Donovan, A., Roy, C. N., Andrews, N. C. (2006). The Ins and Outs of Iron Homeostasis. Physiology 21: 115-123 [Abstract] [Full Text]  
• Bekri, S., May, A., Cotter, P. D., Al-Sabah, A. I., Guo, X., Masters, G. S., Bishop, D. F. (2003). A promoter mutation in the erythroid-specific 5-aminolevulinate synthase (ALAS2) gene causes X-linked sideroblastic anemia. Blood 102: 698-704 [Abstract] [Full Text]  
• Taketani, S., Kakimoto, K., Ueta, H., Masaki, R., Furukawa, T. (2003). Involvement of ABC7 in the biosynthesis of heme in erythroid cells: interaction of ABC7 with ferrochelatase. Blood 101: 3274-3280 [Abstract] [Full Text]  
• Hofer, T., Wenger, R. H., Kramer, M. F., Ferreira, G. C., Gassmann, M. (2003). Hypoxic up-regulation of erythroid 5-aminolevulinate synthase. Blood 101: 348-350 [Abstract] [Full Text]  
• Cazzola, M., May, A., Bergamaschi, G., Cerani, P., Ferrillo, S., Bishop, D. F. (2002). Absent phenotypic expression of X-linked sideroblastic anemia in one of 2 brothers with a novel ALAS2 mutation. Blood 100: 4236-4238 [Abstract] [Full Text]  
• Ames, B. N, Elson-Schwab, I., Silver, E. A (2002). High-dose vitamin therapy stimulates variant enzymes with decreased coenzyme binding affinity (increased Km): relevance to genetic disease and polymorphisms. Am. J. Clin. Nutr. 75: 616-658 [Abstract] [Full Text]  
• Liu, J., Killilea, D. W., Ames, B. N. (2002). Age-associated mitochondrial oxidative decay: Improvement of carnitine acetyltransferase substrate-binding affinity and activity in brain by feeding old rats acetyl-L- carnitine and/or R-alpha -lipoic acid. Proc. Natl. Acad. Sci. USA 99: 1876-1881 [Abstract] [Full Text]  
• Roy, C. N., Andrews, N. C. (2001). Recent advances in disorders of iron metabolism: mutations, mechanisms and modifiers. Hum Mol Genet 10: 2181-2186 [Abstract] [Full Text]  
• Cotter, P. D., May, A., Li, L., Al-Sabah, A.I., Fitzsimons, E. J., Cazzola, M., Bishop, D. F. (1999). Four New Mutations in the Erythroid-Specific 5-Aminolevulinate Synthase (ALAS2) Gene Causing X-Linked Sideroblastic Anemia: Increased Pyridoxine Responsiveness After Removal of Iron Overload by Phlebotomy and Coinheritance of Hereditary Hemochromatosis. Blood 93: 1757-1769 [Abstract] [Full Text]  
• Harigae, H., Suwabe, N., Weinstock, P. H., Nagai, M., Fujita, H., Yamamoto, M., Sassa, S. (1998). Deficient Heme and Globin Synthesis in Embryonic Stem Cells Lacking the Erythroid-Specific delta -Aminolevulinate Synthase Gene. Blood 91: 798-805 [Abstract] [Full Text]  
• Gattermann, N., Retzlaff, S., Wang, Y.-L., Hofhaus, G., Heinisch, J., Aul, C., Schneider, W. (1997). Heteroplasmic Point Mutations of Mitochondrial DNA Affecting Subunit I of Cytochrome c Oxidase in Two Patients With Acquired Idiopathic Sideroblastic Anemia. Blood 90: 4961-4972 [Abstract] [Full Text]  
• Surinya, K. H., Cox, T. C., May, B. K. (1997). Transcriptional Regulation of the Human Erythroid 5-Aminolevulinate Synthase Gene. IDENTIFICATION OF PROMOTER ELEMENTS AND ROLE OF REGULATORY PROTEINS. J. Biol. Chem. 272: 26585-26594 [Abstract] [Full Text]  
• Furuyama, K., Fujita, H., Nagai, T., Yomogida, K., Munakata, H., Kondo, M., Kimura, A., Kuramoto, A., Hayashi, N., Yamamoto, M. (1997). Pyridoxine Refractory X-Linked Sideroblastic Anemia Caused by a Point Mutation in the Erythroid 5-Aminolevulinate Synthase Gene. Blood 90: 822-830 [Abstract] [Full Text]  
• Ponka, P (1997). Tissue-specific regulation of iron metabolism and heme synthesis: distinct control mechanisms in erythroid cells. Blood 89: 1-25 [Abstract] [Full Text]  
• Harris, J. W. (1994). X-Linked, Pyridoxine-Responsive Sideroblastic Anemia. NEJM 330: 709-711 [Full Text]