FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 330:885-891 March 31, 1994 Number 13 Next

Abstract Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited Related Article PubMed Citation

ABSTRACT

Background The Holt-Oram syndrome is an autosomal dominant condition characterized by skeletal abnormalities that are frequently accompanied by congenital cardiac defects. The cause of these disparate clinical features is unknown. To identify the chromosomal location of the Holt-Oram syndrome gene, we performed clinical and genetic studies.

Methods Two large families with the Holt-Oram syndrome were evaluated by radiography of the hands, electrocardiography, and transthoracic echocardiography. Genetic-linkage analyses were performed with polymorphic DNA loci dispersed throughout the genome to identify a locus that was inherited with the Holt-Oram syndrome in family members.

Results A total of 19 members of Family A had Holt-Oram syndrome with mild-to-moderate skeletal deformities, including triphalangeal thumbs and carpal-bone dysmorphism. All affected members of Family A had moderate-to-severe congenital cardiac abnormalities, such as ventricular or atrial septal defects or atrioventricular-canal defects. Eighteen members of a second kindred (Family B) had Holt-Oram syndrome with moderate-to-severe skeletal deformities, including phocomelia. Twelve of the affected members had no cardiac defects; six had only atrial septal defects. Genetic analyses demonstrated linkage of the disease in each family to polymorphic loci on the long arm of chromosome 12 (combined multipoint lod score, 16.8). These data suggest odds greater than 10¹⁶:1 that the genetic defect for Holt-Oram syndrome is present on the long arm of chromosome 12 (12q2).

Conclusions Mutations in a gene on chromosome 12q2 can produce a wide range of disease phenotypes characteristic of the Holt-Oram syndrome. This gene has an important role in both skeletal and cardiac development.

Virtually nothing is known about the cause or pathogenetic processes that account for these varied manifestations of Holt-Oram syndrome. The prevalence of this disorder has been estimated to be 0.95 per 100,000 total births; 85 percent of cases are attributed to new mutations⁵. Whether intragenic or intergenic heterogeneity produces the diverse disease phenotypes in different families is unknown. To address these questions, we have performed clinical and genetic studies in two families with Holt-Oram syndrome. Affected members of Family A have severe cardiac manifestations, whereas skeletal manifestations of the disorder predominate in Family B. Using molecular genetic techniques we have found that the genetic defect in both families is located on the long arm of chromosome 12. We propose that the wide spectrum of clinical presentations of Holt-Oram syndrome is due to mutations in a single gene.

Methods

Clinical Status

Informed consent was obtained from all participants in accordance with the Brigham and Women's Hospital Committee for the Protection of Human Subjects from Research Risks. All family members were evaluated by a thorough history taking and physical examination by someone who had no knowledge of their genotypic status. If there was any evidence of skeletal or cardiac disease suggestive of Holt-Oram syndrome, the subjects were further evaluated by electrocardiography, transthoracic echocardiography, and radiographic studies of the upper limbs. Patients were given a diagnosis of Holt-Oram syndrome if they had gross or radiographic evidence of radial-ray defects with or without associated cardiac septal defects or conduction disease. Cardiac septal defects were diagnosed either by a review of cardiac-catheterization studies or by the presence of anomalies at the interatrial or interventricular septa on color-flow Doppler echocardiography.

Genotypic Analyses

For the genotypic analyses, 5 to 30 ml of peripheral blood was obtained from each family member, and lymphoblastoid lines were established by transformation with the Epstein-Barr virus, as previously described⁶. Genomic DNA was isolated from either cell lines or peripheral lymphocytes⁶. Polymorphic short tandem-repeat sequences (also termed microsatellites) were amplified with the polymerase chain reaction (PCR) with use of published nucleotide primer sequences^7,8 and analyzed on denaturing polyacrylamide-urea gels as previously described⁶. In brief, 150 ng of genomic DNA was amplified in a volume of 10 microl containing 40 ng of unlabeled oligonucleotide primer; 40 ng of primer end-labeled with phosphorus-32; 200 micro M each of deoxyadenosine triphosphate, deoxycytidine triphosphate, deoxyguanosine triphosphate, and deoxythymidine triphosphate; and 0.1 U of AmpliTaq DNA polymerase (Perkin-Elmer Cetus) with 1 x PCR buffer (10 mM TRIS, pH 8.3; 50 mM potassium chloride; 1.5 mM magnesium chloride; and 0.01 percent gelatin) (Perkin-Elmer Cetus). The samples were processed through 30 cycles including denaturation for 20 seconds at 94 °C, primer annealing for 30 seconds at 55 °C, and primer extension for 45 seconds at 72 °C, followed by another 10 minutes of extension at 72 °C. The amplified products were subjected to electrophoresis on 6 percent polyacrylamide sequencing gels and visualized by autoradiography.

Two dimeric polymorphisms within a 500-base-pair region of the d-amino acid oxidase (DAO) gene⁹ were amplified with the following primers: DAO-1 forward primer: 5'CCTGCTCCACACTTACACAGAC3', DAO-1 reverse primer: 5'GCAAGCTTGGAGTATGTATCCC3', DAO-2 forward primer: 5'GATTTTACCTAAGGCTGGATCTG3', and DAO-2 reverse primer: 5'GACACTGATTATAGCAACGTGTGT3'. The CA polymorphism amplified by the DAO-2 primers is also amplified by the published primers for the anonymous marker D12S105⁸.

Linkage Analyses

Two-point analyses were performed with MLINK (version 5.1), and multipoint analyses were performed with LINKMAP^6,10 to calculate the lod scores. The lod score indicates the statistical likelihood that two genetic loci are linked and is calculated from the ratio of the probability of inheriting two loci given a certain recombination fraction between the loci to the probability of inheriting both loci if they are not linked in the human genome (theta = 0.5). Lod scores vary as a function of the recombination fraction, which approximates the genetic distance between loci. Two loci are 1 centimorgan (approximately 1 million base pairs of DNA) apart if they recombine in 1 percent of all meioses. A lod score of more than 3 indicates a significant likelihood of linkage (odds in favor of linkage, 1000:1). A lod score of less than -2 is generally accepted as evidence against linkage between loci. Penetrance of Holt-Oram syndrome was set at a P level of 0.95 for all analyses. Allele frequencies were taken from published data when available and otherwise estimated independently from at least 30 chromosomes in the study population.

Statistical Analyses of Phenotypes

All family members who were studied clinically or for whom clinical records were available were considered for analyses. Data were analyzed with the chi-square test.

Results

Clinical Evaluations

Family A (Figure 1A) is a North American kindred that was reported to have Holt-Oram syndrome in 1966¹¹. Of 49 family members in five generations at risk for inheriting the disorder, 26 family members (11 male and 15 female) were affected -- a pattern consistent with autosomal dominant inheritance. Clinical evaluation or an examination of historical records demonstrated that each affected family member was the offspring of an affected parent, thereby confirming the high penetrance of the disease gene. Clinical evaluations of family members (Figure 1A) identified 18 surviving members affected by the Holt-Oram syndrome.

View larger version (24K): [in this window] [in a new window]   Figure 1. Inheritance of Holt-Oram Syndrome in Families A and B. Squares denote male family members, circles female family members, solid symbols subjects with Holt-Oram syndrome, clear symbols unaffected subjects, stippled symbols subjects whose disease status is uncertain, and symbols with a slash deceased family members.

 
All affected family members had some skeletal abnormalities, many of which were subtle and detected only by radiography. Skeletal deformities generally manifested as deformities of the thenar and carpal bones (Figure 2A), occasionally in association with mildly hypoplastic clavicles and shortened radii. Thenar abnormalities included distal displacement of the thenar eminence in the presence or absence of a triphalangeal digit. Only Subject V-7 had an aplastic thumb (unilateral); the contralateral thumb was triphalangeal. None of the subjects had either phocomelia or severe ectromelia.

View larger version (137K): [in this window] [in a new window]   Figure 2. Clinical Manifestations of Holt-Oram Syndrome. Panel A shows the hands of Subject IV-7 (from Family A). The right thumb is triphalangeal, and there is mild acrocyanosis from an uncorrected ventricular septal defect and resultant Eisenmenger's syndrome. In Panel B, a left ventriculogram in the left anterior oblique projection shows a ventricular septal defect in Subject III-3 from Family A (kindly provided by Dr. Ronald Vlietstra, Watson Clinic, Lakeland, Fla.). Arrowheads indicate dye that has entered the right ventricle (RV) from the left ventricle (LV). Panel C shows Subject II-5 from Family B, who has phocomelia. In Panel D, a radiograph of Subject IV-5 from Family B shows severe ectromelia with thenar aplasia and hypoplastic radii. Note that only four digits are present. Carpal-bone fusion of the left side is so severe that the digital metacarpals arise from the ulna instead of the radius. Bilateral pollicization of the digiti minimi and a healed osteotomy (right side) result from surgical intervention.

 
All affected members of Family A had cardiovascular disease (Table 1). Fifteen of the surviving family members had septal defects: four had atrial septal defects, nine had ventricular septal defects, and two had both. The atrial septal defects were all of the ostium secundum type except for one involving an ostium primum defect (Subject V-13). Subjects V-5, V-7, V-12, and V-13 required surgical correction of hemodynamically significant defects. Subject V-12 died of complications related to a complete atrioventricular-canal defect. At the time of the study, Subject III-3 was being evaluated for surgical correction of a ventricular septal defect. Subject IV-7 had Eisenmenger's syndrome resulting from an uncorrected ventricular septal defect (Figure 2A). Eleven of the surviving affected family members had cardiac-conduction disease, including bradycardia, atrioventricular block, atrial fibrillation, and sinus-node dysfunction, and six required permanent pacemakers.

View this table: [in this window] [in a new window]   Table 1. Clinical Expression of the Holt-Oram Syndrome in Two Families.

 
In addition to cardiac and conduction-system defects, three affected persons had congenital vascular disease: Subject V-12 had a patent ductus arteriosus, Subject V-5 had a patent ductus arteriosus and an anomalous left-coronary-artery ostium, and Subject IV-11 had a persistent left superior vena cava accompanied by increased right ventricular trabeculation.

One family member, Subject III-5, was considered to have an indeterminate diagnosis for the purposes of linkage analysis. Although a small, hemodynamically insignificant inferoposterior muscular ventricular septal defect was noted incidentally on cardiac catheterization, no skeletal abnormalities were evident either on physical examination or radiography. Clinical evaluations of Subject IV-25, who was initially reported as affected,¹¹ demonstrated neither skeletal nor cardiac abnormalities. He was considered unaffected for these analyses.

Family B is a North American kindred, unrelated to Family A, with 31 members in three generations at risk for inheriting Holt-Oram syndrome (Figure 1B). Clinical evaluations identified 18 surviving members (10 male and 8 female) with the syndrome. Four affected family members elected not to participate in genetic studies.

All affected family members had skeletal abnormalities, which were typically more severe than those found in Family A. Seven had bilateral frank phocomelia or severe ectromelia characterized by hypoplastic humeri, radii, and clavicles, with thenar aplasia and carpal and digital deformities (Figure 2C and Figure 2D). The incidence of severe skeletal deformities (phocomelia or severe ectromelia) was significantly more frequent in affected family members of Family B (P<0.001) than in affected members of Family A.

Congenital cardiovascular disease in affected members of Family B was more mild and less frequent (P<0.001) than in Family A. Six affected family members had cardiac disease, all consisting of atrial septal defects of the ostium secundum type. Subjects II-2, III-9, and IV-9 all required surgery for their septal defects. Only Subject III-9 had conduction disease (incomplete right bundle-branch block). Congenital vascular disease was not found in any affected family members.

Genetic Analyses

Highly polymorphic short tandem-repeat sequences^7,8 dispersed throughout the genome were analyzed for linkage to the Holt-Oram syndrome locus in Family A. Because two reports had described cytogenetic abnormalities on chromosomes 14¹² and 20¹³ in patients with the syndrome, markers from these regions were selected for initial analyses. Linkage to both genomic regions was excluded (calculated lod scores, <-2.0; data not shown). Short tandem-repeat sequences were then randomly screened, and approximately 60 percent of the human genome was excluded before linkage was detected between the insulin-like growth factor I (IGF1) locus, on the long arm of chromosome 12, and the Holt-Oram syndrome locus (lod scores, >4.0; theta = 0.15). One recombination event occurred between IGF1 and the disease locus. Therefore, additional short tandem-repeat markers (PLA2, D12S76, D12S86, D12S79, DAO, D12S84, D12S78, D12S58, and D12S101) in this region were tested. The maximal two-point lod scores achieved with markers D12S79, DAO-2, and D12S84 were each greater than 6.0 (theta = 0.05) (Table 2), providing odds of more than 3,000,000:1 that the gene responsible for Holt-Oram syndrome in Family A is located on chromosome 12q2.

View this table: [in this window] [in a new window]   Table 2. Two-Point Lod Scores between Chromosome 12q2 Loci and the Holt-Oram Syndrome in Families A and B.

 
The genotypes of three family members (Subjects IV-7, IV-17, and IV-24) suggested that a recombination event had occurred between locus D12S79 and the Holt-Oram syndrome gene. Analyses also identified recombination between the DAO locus and the disease gene in Subject IV-18. Collectively, these data mapped the gene responsible for Holt-Oram syndrome to a region between D12S79 and DAO (Figure 3). With the use of loci D12S79, DAO, and D12S84, the maximal multipoint lod score was 10.1.

View larger version (14K): [in this window] [in a new window]   Figure 3. Idiogram of Chromosome 12. The conventional banding pattern of the short (p) and long (q) arms on Giemsa staining is shown. Positively stained bands are black, and the pericentromeric region is hatched. Numbers indicate cytogenetic designations for the bands. The location of the HOX C and retinoic acid-receptor gamma-subunit (RARgamma) genes is shown. The map locations of polymorphic loci analyzed from 12q are given. Linkage data suggest that the gene responsible for Holt-Oram syndrome (HOS) is located between DAO and D12S79.

 
To determine whether the gene responsible for Holt-Oram syndrome in Family A could also be mutated to produce the various clinical features found in affected members of Family B, linkage studies were performed. Two-point lod scores (Table 2) were calculated between polymorphic loci linked to Holt-Oram syndrome in Family A and the disease gene in Family B. These data, multipoint linkage analyses, and haplotype analyses of recombination events between the flanking loci mapped the disease locus in Family B to an area between D12S79 and DAO (maximal lod score, 7.3).

The maximal multipoint lod score obtained when data from both families were combined was calculated to be 16.8 in the interval between D12S79 and DAO, signifying odds of 6 x 10¹⁶:1 in favor of linkage of Holt-Oram syndrome to the chromosome 12q2 locus (Figure 3).

Discussion

These analyses demonstrate that the gene responsible for Holt-Oram syndrome (heart-hand syndrome) in two unrelated families is located on the long arm of chromosome 12 (12q2). The mutated gene segregating in Family A causes moderate-to-severe cardiac disease with relatively mild skeletal deformities. Genetic-linkage analyses demonstrate that a mutation at the same locus accounts for the mild cardiac disease and severe skeletal deformities found in Family B. We hypothesize that the disparate clinical manifestations in affected members of these families occur because of different mutations within a single gene or because of mutations in two closely linked genes. Although studies of two families cannot exclude genetic heterogeneity, these data demonstrate that the mutations within the 12q gene can account for the diverse clinical features found in patients with the Holt-Oram syndrome.

As has been noted in previous studies,^2,3,4 there was substantial variability in the clinical expression of the disease phenotype within each family. Skeletal findings were present in every affected family member, but ranged from subtle carpal-bone abnormalities to triphalangeal or absent thumbs and frank phocomelia. Cardiac disease, when present, included dysrhythmias, mild-to-severe cardiac septal defects, or both. Interestingly, the skeletal and cardiac manifestations of disease within nuclear families in these two kindreds were frequently more severe in the offspring than in their affected parents (Table 1). Analyses of more families and precise definition of the gene defect will help to determine whether genetic anticipation accounts in part for the variable disease expression that typifies Holt-Oram syndrome.

Given the contribution of the Holt-Oram syndrome gene product to both cardiac and skeletal differentiation, candidate genes that could be mutated to cause this condition might include a wide variety of proteins. Cytokines, extracellular-matrix proteins, cytoskeletal elements, and transcription factors are all represented on chromosome 12q¹. In experiments in animals, retinoic acid has been found to be involved in producing developmental limb deformities,¹⁴ and the retinoic acid-receptor gamma-subunit gene has been mapped to chromosome 12q13¹⁵. The homeotic genes (containing HOX sequences) encode proteins that appear to determine a variety of processes throughout fetal development¹⁶ and have been implicated in conduction-pathway differentiation¹⁷. The human HOX C gene also maps to chromosome 12q13⁷. Since genetic-linkage analyses localized the disease gene to chromosome 12q2, mutations in the retinoic acid-receptor gamma-subunit and HOX C genes can be excluded as the cause of Holt-Oram syndrome.

In families with Holt-Oram syndrome linked to the chromosome 12q2 locus, prenatal genetic diagnosis will be feasible. DNA-based diagnoses will inevitably need to be coupled with noninvasive fetal imaging techniques to define phenotypic manifestations. We expect that the eventual identification of the Holt-Oram syndrome gene and disease-causing mutations will further enhance the diagnosis and management of this complex congenital disease. In addition, the identification of the genetic cause of the syndrome should expand our knowledge of molecular mechanisms that regulate limb and cardiac development.

Supported by grants from the Howard Hughes Medical Institute (to Dr. J.G. Seidman) and the Bristol-Myers Squibb Company (to Drs. J.G. Seidman and Christine Seidman). Dr. Basson is the recipient of a Bugher Fellowship from the American Heart Association. Dr. Christine Seidman is an Established Investigator of the American Heart Association.

We are indebted to the members of the two families, without whose generous assistance these studies would not have been possible; to Dr. Aaron Stern and Dr. John Gall; to Dr. Jeffrey Leiden and Dr. Elizabeth Nabel for assistance with the evaluation of the patients; and to Mr. Mohammed Miri for technical help.

Source Information

From the Cardiovascular Division, Department of Medicine (C.T.B., S.D.S., C.E.S.), and the Department of Radiology (B.W.), Brigham and Women's Hospital, Boston; Harvard Medical School, Boston (C.T.B., S.D.S., C.E.S.); the Department of Genetics and Howard Hughes Medical Institute, Harvard Medical School, Boston (G.S.C., J.G.S.); the Department of Radiology, Children's Memorial Hospital, Chicago (A.K.P.); and the Cardiovascular Division, Department of Medicine, Johns Hopkins Hospital, Baltimore (T.A.T.).

Address reprint requests to Dr. Christine Seidman at the Department of Genetics, Harvard Medical School, Alpert Bldg., Rm. 533, 200 Longwood Ave., Boston, MA 02115.

References

1. McKusick VA. Mendelian inheritance in man: catalogs of autosomal dominant, autosomal recessive, and X-linked phenotypes. 10th ed. Vol. 1. Baltimore: Johns Hopkins University Press, 1992:542-3. 
2. Holt M, Oram S. Familial heart disease with skeletal malformations. Br Heart J 1960;22:236-242.
3. Poznanski AK, Gall JC Jr, Stern AM. Skeletal manifestations of the Holt-Oram syndrome. Radiology 1970;94:45-53. [Medline]
4. Smith AT, Sack GH Jr, Taylor GJ. Holt-Oram syndrome. J Pediatr 1979;95:538-543. [CrossRef][Medline]
5. Csaba E, Marta V, Endre C. Holt-Oram-syndroma. Orv Hetil 1991;132:73-8. (In Hungarian).
6. Chou YHW, Brown EM, Levi T, et al. The gene responsible for familial hypocalciuric hypercalcemia maps to chromosome 3q in four unrelated families. Nat Genet 1992;1:295-300. [CrossRef][Medline]
7. NIH/CEPH Collaborative Mapping Group. A comprehensive genetic linkage map of the human genome. Science 1992;258:67-86. [Free Full Text]
8. Weissenbach J, Gyapay G, Dib C, et al. A second-generation linkage map of the human genome. Nature 1992;359:794-801. [CrossRef][Medline]
9. Fukui K, Miyake Y. Molecular cloning and chromosomal localization of a human gene encoding d-amino-acid oxidase. J Biol Chem 1992;267:18631-18638. [Free Full Text]
10. Lathrop GM, Lalouel JM, Julier C, Ott J. Strategies for multilocus linkage analysis in humans. Proc Natl Acad Sci U S A 1984;81:3443-3446. [Free Full Text]
11. Gall JC Jr, Stern AM, Cohen MM, Adams MS, Davidson RT. Holt-Oram syndrome: clinical and genetic study of a large family. Am J Hum Genet 1966;18:187-200. [Medline]
12. Turleau C, de Grouchy J, Chavin-Colin F, et al. Two patients with interstitial del (14q), one with features of Holt-Oram syndrome: exclusion mapping of PI (alpha-1-antitrypsin). Ann Genet 1984;27:237-240. [Medline]
13. Yang SP, Sherman S, Derstine JB, Schonberg SA. Holt-Oram syndrome gene may be on chromosome 20. Pediatr Res 1990;27:Suppl:137A-137A.abstract 
14. Mendelsohn C, Ruberte E, Chambon P. Retinoid receptors in vertebrate limb development. Dev Biol 1992;152:50-61. [CrossRef][Medline]
15. Mattei MG, Riviere M, Krust A, et al. Chromosomal assignment of retinoic acid receptor (RAR) genes in the human, mouse, and rat genomes. Genomics 1991;10:1061-1069. [CrossRef][Medline]
16. McGinnis W, Krumlauf R. Homeobox genes and axial patterning. Cell 1992;68:283-302. [CrossRef][Medline]
17. Chan-Thomas PS, Thompson RP, Robert B, Yacoub MH, Barton PJR. Expression of homeobox genes Msx-1 (Hox-7) and Msx-2 (Hox-8) during cardiac development in the chick. J Cell Biochem Suppl 1993;17:209-209.abstract 

Abstract Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited Related Article PubMed Citation

This article has been cited by other articles:

• Hatcher, C. J., Basson, C. T. (2009). Specification of the Cardiac Conduction System by Transcription Factors. Circ. Res. 105: 620-630 [Abstract] [Full Text]  
• Meder, B., Katus, H. A., Rottbauer, W. (2008). Right into the heart of microRNA-133a. Genes Dev. 22: 3227-3231 [Abstract] [Full Text]  
• McDermott, D. A., Hatcher, C. J., Basson, C. T. (2008). Atrial Fibrillation and Other Clinical Manifestations of Altered TBX5 Dosage in Typical Holt-Oram Syndrome. Circ. Res. 103: e96-e96 [Full Text]  
• Postma, A. V., van de Meerakker, J. B.A., Mathijssen, I. B., Barnett, P., Christoffels, V. M., Ilgun, A., Lam, J., Wilde, A. A.M., Lekanne Deprez, R. H., Moorman, A. F.M. (2008). A Gain-of-Function TBX5 Mutation Is Associated With Atypical Holt-Oram Syndrome and Paroxysmal Atrial Fibrillation. Circ. Res. 102: 1433-1442 [Abstract] [Full Text]  
• (2007). Picture of the Month--Diagnosis. Arch Pediatr Adolesc Med 161: 712-712 [Full Text]  
• Pierpont, M. E., Basson, C. T., Benson, D. W. Jr, Gelb, B. D., Giglia, T. M., Goldmuntz, E., McGee, G., Sable, C. A., Srivastava, D., Webb, C. L. (2007). Genetic Basis for Congenital Heart Defects: Current Knowledge: A Scientific Statement From the American Heart Association Congenital Cardiac Defects Committee, Council on Cardiovascular Disease in the Young: Endorsed by the American Academy of Pediatrics. Circulation 115: 3015-3038 [Abstract] [Full Text]  
• Varma, P. K, Padmakumar, R., Harikrishnan, S., Koshy, T., Neelakandhan, K. S (2006). Holt-Oram Syndrome with Hemiazygous Continuation of Inferior Vena Cava. Asian Cardiovasc. Thorac. Ann. 14: 161-163 [Abstract] [Full Text]  
• Pizard, A., Burgon, P. G., Paul, D. L., Bruneau, B. G., Seidman, C. E., Seidman, J. G. (2005). Connexin 40, a Target of Transcription Factor Tbx5, Patterns Wrist, Digits, and Sternum. Mol. Cell. Biol. 25: 5073-5083 [Abstract] [Full Text]  
• James, M. A., Green, H. D., McCarroll, H. R. Jr., Manske, P. R. (2004). The Association of Radial Deficiency with Thumb Hypoplasia. JBJS 86: 2196-2205 [Abstract] [Full Text]  
• Moskowitz, I. P. G., Pizard, A., Patel, V. V., Bruneau, B. G., Kim, J. B., Kupershmidt, S., Roden, D., Berul, C. I., Seidman, C. E., Seidman, J. G. (2004). The T-Box transcription factor Tbx5 is required for the patterning and maturation of the murine cardiac conduction system. Development 131: 4107-4116 [Abstract] [Full Text]  
• Sepulveda, W., Enriquez, G., Martinez, J. L., Mejia, R. (2004). Holt-Oram Syndrome: Contribution of Prenatal 3-Dimensional Sonography in an Index Case. J Ultrasound Med 23: 983-987 [Full Text]  
• Rallis, C., Bruneau, B. G., Del Buono, J., Seidman, C. E., Seidman, J. G., Nissim, S., Tabin, C. J., Logan, M. P. O. (2003). Tbx5 is required for forelimb bud formation and continued outgrowth. Development 130: 2741-2751 [Abstract] [Full Text]  
• Fan, C, Duhagon, M A, Oberti, C, Chen, S, Hiroi, Y, Komuro, I, Duhagon, P I, Canessa, R, Wang, Q (2003). Novel TBX5 mutations and molecular mechanism for Holt-Oram syndrome. J. Med. Genet. 40: e29-29 [Full Text]  
• Agarwal, P., Wylie, J. N., Galceran, J., Arkhitko, O., Li, C., Deng, C., Grosschedl, R., Bruneau, B. G. (2003). Tbx5 is essential for forelimb bud initiation following patterning of the limb field in the mouse embryo. Development 130: 623-633 [Abstract] [Full Text]  
• Sakata, Y., Kamei, C. N., Nakagami, H., Bronson, R., Liao, J. K., Chin, M. T. (2002). Ventricular septal defect and cardiomyopathy in mice lacking the transcription factor CHF1/Hey2. Proc. Natl. Acad. Sci. USA 99: 16197-16202 [Abstract] [Full Text]  
• Feng, Q., Song, W., Lu, X., Hamilton, J. A., Lei, M., Peng, T., Yee, S.-P. (2002). Development of Heart Failure and Congenital Septal Defects in Mice Lacking Endothelial Nitric Oxide Synthase. Circulation 106: 873-879 [Abstract] [Full Text]  
• Garrity, D. M., Childs, S., Fishman, M. C. (2002). The heartstrings mutation in zebrafish causes heart/fin Tbx5 deficiency syndrome. Development 129: 4635-4645 [Abstract] [Full Text]  
• HUANG, T., LOCK, J.E, MARSHALL, A.C, BASSON, C., SEIDMAN, J.G., SEIDMAN, C.E. (2002). Causes of Clinical Diversity in Human TBX5 Mutations. Cold Spring Harb Symp Quant Biol 67: 115-120 [Abstract]  
• Forgosh, L. B., Poore, R. (2001). Carotid Anomaly in a Patient With Holt-Oram Syndrome. Journal of Diagnostic Medical Sonography 17: 347-349 [Abstract]  
• Ghosh, T. K., Packham, E. A., Bonser, A. J., Robinson, T. E., Cross, S. J., Brook, J. D. (2001). Characterization of the TBX5 binding site and analysis of mutations that cause Holt-Oram syndrome. Hum Mol Genet 10: 1983-1994 [Abstract] [Full Text]  
• Ferrari, V. A., Scott, C. H., Holland, G. A., Axel, L., St. John Sutton, M. (2001). Ultrafast three-dimensional contrast-enhanced magnetic resonance angiography and imaging in the diagnosis of partial anomalous pulmonary venous drainage. J Am Coll Cardiol 37: 1120-1128 [Abstract] [Full Text]  
• Lee, T. C., Zhao, Y. D., Courtman, D. W., Stewart, D. J. (2000). Abnormal Aortic Valve Development in Mice Lacking Endothelial Nitric Oxide Synthase. Circulation 101: 2345-2348 [Abstract] [Full Text]  
• Brickner, M. E., Hillis, L. D., Lange, R. A. (2000). Congenital Heart Disease in Adults- First of Two Parts. NEJM 342: 256-263 [Full Text]  
• Satoda, M., Pierpont, M. E. M., Diaz, G. A., Bornemeier, R. A., Gelb, B. D. (1999). Char Syndrome, an Inherited Disorder With Patent Ductus Arteriosus, Maps to Chromosome 6p12-p21. Circulation 99: 3036-3042 [Abstract] [Full Text]  
• Basson, C. T., Huang, T., Lin, R. C., Bachinsky, D. R., Weremowicz, S., Vaglio, A., Bruzzone, R., Quadrelli, R., Lerone, M., Romeo, G., Silengo, M., Pereira, A., Krieger, J., Mesquita, S. F., Kamisago, M., Morton, C. C., Pierpont, M. E. M., Muller, C. W., Seidman, J. G., Seidman, C. E. (1999). Different TBX5 interactions in heart and limb defined by Holt-Oram syndrome mutations. Proc. Natl. Acad. Sci. USA 96: 2919-2924 [Abstract] [Full Text]  
• Horb, M., Thomsen, G. (1999). Tbx5 is essential for heart development. Development 126: 1739-1751 [Abstract]  
• Bohm, M. (1998). Holt-Oram Syndrome. Circulation 98: 2636-2637 [Full Text]  
• Benson, D. W., Sharkey, A., Fatkin, D., Lang, P., Basson, C. T., McDonough, B., Strauss, A. W., Seidman, J. G., Seidman, C. E. (1998). Reduced Penetrance, Variable Expressivity, and Genetic Heterogeneity of Familial Atrial Septal Defects. Circulation 97: 2043-2048 [Abstract] [Full Text]  
• Grover, J., Chen, X.-N., Korenberg, J. R., Roughley, P. J. (1995). The Human Lumican Gene. J. Biol. Chem. 270: 21942-21949 [Abstract] [Full Text]  
• Britz-Cunningham, S. H., Shah, M. M., Zuppan, C. W., Fletcher, W. H. (1995). Mutations of the Connexin43 Gap-Junction Gene in Patients with Heart Malformations and Defects of Laterality. NEJM 332: 1323-1330 [Abstract] [Full Text]  
• Basson, C. T., Solomon, S. D., Weissman, B., MacRae, C. A., Poznanski, A. K., Prieto, F., de la Fuente, S. R., Pease, W. E., Levin, S.E., Holmes, L. B., Seidman, J.G., Seidman, C. E. (1995). Genetic Heterogeneity of Heart-Hand Syndromes. Circulation 91: 1326-1329 [Abstract] [Full Text]  
• Payne, R. M., Johnson, M. C., Grant, J. W., Strauss, A. W. (1995). Toward a Molecular Understanding of Congenital Heart Disease. Circulation 91: 494-504 [Abstract] [Full Text]  
• Dietz, H. C., Pyeritz, R. E. (1994). Molecular Biology -- To the Heart of the Matter. NEJM 330: 930-932 [Full Text]