FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 330:962-968 April 7, 1994 Number 14 Next

Abstract Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

ABSTRACT

Background Several families have been described in which a mutation of mitochondrial DNA, the substitution of guanine for adenine (A-to-G) at position 3243 of leucine transfer RNA, is associated with diabetes mellitus and deafness. The prevalence, clinical features, and pathophysiology of diabetes with this mutation are largely undefined.

Methods We studied 55 patients with insulin-dependent diabetes mellitus (IDDM) and a family history of diabetes (group 1), 85 patients with IDDM and no family history of diabetes (group 2), 100 patients with non-insulin-dependent diabetes mellitus (NIDDM) and a family history of diabetes (group 3), and 5 patients with diabetes and deafness (group 4) for the mutation. We also studied the prevalence and characteristics of diabetes in 39 patients with a syndrome consisting of mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes who were known to have the mutation and 127 of their relatives (group 5).

Results We identified 16 unrelated patients with diabetes associated with the A-to-G mutation: 3 patients from group 1 (6 percent), 2 patients from group 3 (2 percent), 3 patients from group 4 (60 percent), and 8 patients from group 5 (21 percent). We also identified 16 additional subjects who had diabetes and the mutation among 42 relatives of the patients with diabetes and the mutation in groups 1, 2, 3, and 4 and 20 affected subjects among the 127 relatives of the patients in group 5. Diabetes cosegregated with the mutation in a fashion consistent with maternal transmission, was frequently (in 61 percent of cases) associated with sensory hearing loss, and was generally accompanied by impaired insulin secretion.

Conclusions Diabetes mellitus associated with the A-to-G mutation at position 3243 of mitochondrial leucine transfer RNA represents a subtype of diabetes found in both patients with IDDM and patients with NIDDM in Japan.

Recently, several case reports^12,13,14,15 suggested that mutations in mitochondrial DNA, especially one involving the substitution of guanine for adenine (A-to-G) at position 3243 of leucine tRNA,^13,14,15 may cause diabetes and deafness. This mutation occurs within the mitochondrial DNA binding site for a protein factor that promotes the termination of transcription at the boundary between the 16S ribosomal RNA and tRNA Leu(UUR) genes. This mutation appears to interfere not only with the synthesis of tRNA Leu(UUR) but also with the binding of the transcription termination factor, thereby causing defects in the synthesis of mitochondrial proteins¹⁶. The prevalence, clinical characteristics, and pathophysiologic process of diabetes associated with the A-to-G mutation at position 3243 are largely unknown. In this study, we identified 22 families (52 patients) with the mutation and diabetes and examined the clinical features of this subtype of diabetes.

Methods

Families

We studied 55 patients with IDDM and a history of diabetes (either IDDM or NIDDM) in first-degree relatives (group 1), 85 patients with IDDM and no family history of diabetes (group 2), and 100 patients with NIDDM and a history of diabetes in first-degree relatives (group 3)⁹. The patients were recruited from the outpatient clinic of the Institute for Diabetes Care and Research of the Asahi Life Foundation. Five patients with diabetes and hearing loss (three of whom had a family history of these problems) were referred to us for testing for the mutation (group 4). The 245 patients were all unrelated. We studied 42 relatives of the patients in the four groups who were found to have the mutation. We also studied 39 unrelated patients with a syndrome consisting of mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke-like episodes (MELAS) who were known to have the mutation and 127 of their relatives (group 5). Questionnaires or direct examination of the patients and their relatives was used to ascertain the presence of diabetes, the type of diabetes, the treatment regimen, and insulin secretory capacity, as well as to determine whether associated symptoms such as sensory hearing loss, muscle weakness, ophthalmoplegia, and mental retardation were present. The diagnosis of diabetes in these subjects was based on the criteria of the World Health Organization,¹ and ketosis-prone patients were defined as having clinical IDDM. The study was approved by the appropriate institutional review committees, and all subjects gave informed consent.

Molecular Studies

DNA was prepared from peripheral-blood leukocytes. Fragments of mitochondrial DNA encompassing position 3243 were amplified with the polymerase chain reaction (PCR). The forward primer was 5'AGGACAAGAGAAATAAGGCC3', covering positions 3130 to 3149, and the reverse primer was 5'CACGTTGGGGCCTTTGCGTA3', covering positions 3423 through 3404¹⁷. The resultant 294-bp fragments of mitochondrial DNA (3130 through 3423) were digested with a restriction endonuclease, ApaI, and analyzed by agarose-gel (0.8 percent) electrophoresis. The PCR products were either sequenced directly¹⁸ or subcloned into a plasmid vector and then sequenced.

Insulin Secretory Capacity and Euglycemic-Clamp Studies

Insulin secretory capacity was evaluated by measurements of plasma insulin or C-peptide concentrations during a 75-g oral glucose-tolerance test or after the intravenous administration of glucagon (1 mg) or by measurements of C peptide in a 24-hour urine sample. Peripheral uptake of glucose (mainly by skeletal muscle) was measured in one patient with IDDM and one patient with NIDDM, both of whom had the mutation, during a euglycemic-hyperinsulinemic clamp study¹⁹.

Statistical Analysis

Continuous variables were compared by Student's t-test, and categorical variables were compared by chi-square analysis. All P values are two-tailed.

Results

Identification of the Mutation

We identified an A-to-G mutation at position 3243 of mitochondrial leucine tRNA in 16 of the patients from groups 1 through 5 (Figure 1). Figure 1A shows the sequences encompassing position 3243 in normal and mutant mitochondrial DNA from one patient (Subject II-2 in Family 2). This means that the patient is heteroplasmic for the mutation. This A-to-G transition created a recognition site for the restriction endonuclease ApaI (GAGCCC to GGGCCC). Digestion of mitochondrial DNA with ApaI revealed that affected subjects are heteroplasmic for the mutation (Figure 1B). This mutation was not found in 200 normal subjects with no family history of diabetes. In group 1, 3 of the 55 patients (6 percent) had this mutation; in group 2, 0 of 85 patients; in group 3, 2 of 100 patients (2 percent); in group 4, 3 of 5 patients (60 percent); and in group 5, 8 of 39 patients (21 percent). We identified 16 additional subjects with diabetes and the mutation in our study of 42 relatives of the patients in groups 1, 2, 3, and 4, and 20 additional subjects with diabetes and the mutation in our study of 127 relatives of the patients in group 5. Thus, we identified 52 patients with diabetes mellitus in 22 unrelated families who had the mutation (Table 1).

View larger version (39K): [in this window] [in a new window]   Figure 1. Identification of an A-to-G Mutation at Position 3243 of Mitochondrial Leucine tRNA. Panel A shows the sequences of mitochondrial DNA surrounding the mutated site in mitochondrial tRNA Leu(UUR) from Subject II-2 in Family 2. Fragments of mitochondrial DNA were amplified by PCR, and the products were subcloned into a plasmid vector and sequenced as described in the Methods section. In Panel B, 294-bp fragments (3130 through 3423) of mitochondrial DNA encompassing position 3243 were obtained from three subjects and prepared by PCR, digested with ApaI, and analyzed by agarose-gel (0.8 percent) electrophoresis. Affected subjects are heteroplasmic for the mutation.

 

View this table: [in this window] [in a new window]   Table 1. Characteristics of the Families with Diabetes Mellitus Associated with the A to G Mutation at Position 3243 of Mitochondrial Leucine tRNA.

 
Representative Families with Diabetes and the Mutation

The pedigrees of nine representative families with diabetes and the mutation are shown in Figure 2. A preliminary description of Family 1 has been reported¹⁵.

View larger version (21K): [in this window] [in a new window]   Figure 2. Pedigrees of Nine Families with Diabetes Mellitus and the A to G Mutation at Position 3243. Families 1, 2, 3, 4, 5, and 7 have a history of diabetes and the mutation but not the MELAS syndrome. Families 10, 12, and 13 have a history of diabetes and the mutation and have a proband with the MELAS syndrome.

 
            Family 2

The proband in Family 2 (Subject II-2) was identified during screening for the mutation in group 1. He was given a diagnosis of diabetes after an oral glucose-tolerance test at the age of 13 years, and he started taking insulin at the age of 17, when he became prone to ketoacidosis. His insulin secretory capacity was considered to be low on the basis of low urinary C-peptide excretion (7 to 13 µg per day [2.3 to 4.3 nmol per day]) and a low plasma C-peptide response to glucagon injection (Table 2). Although he was given a diagnosis of slowly progressive IDDM,²⁰ a test for islet-cell antibodies was negative. He began to have sensory hearing loss at the age of 29 years. His mother (Subject I-2), sister (Subject II-1), and uncle (Subject I-3) had the mutation and insulin-requiring NIDDM with low insulin secretion (Table 2) and sensory hearing loss. The proband's father (Subject I-1), who did not have the mutation, had normal glucose tolerance.

View this table: [in this window] [in a new window]   Table 2. Insulin Secretory Capacity of Pancreatic Cells in Patients with Diabetes Associated with the A to G Mutation at Position 3243 of Mitochondrial Leucine tRNA.

 
            Family 3

The proband in Family 3 (Subject II-2) was also identified during screening for the mutation in group 1. He had been prone to ketosis since the age of 24 years unless treated with insulin and had recently had mild sensory hearing loss. His urinary C-peptide excretion was low (19 µg per day [6.3 nmol per day]) (Table 2). His mother (Subject I-2), who also had the mutation, had NIDDM and was being treated with an oral hypoglycemic agent but did not have a hearing loss. Neither of his sons (Subjects III-1 and III-2) had the mutation or diabetes.

            Family 5

The proband in Family 5 (Subject III-1) was identified during screening for the mutation in group 3. She was given a diagnosis of NIDDM at the age of 36 years and was treated with an oral hypoglycemic agent until the age of 44, when she started taking insulin. She had no hearing loss. Her insulin secretory capacity was low (Table 2). Her mother (Subject II-3), two uncles (Subjects II-1 and II-5), and grandmother (Subject I-2) had diabetes, and her mother and one of her uncles had sensory hearing loss.

            Family 10

The proband in Family 10 (Subject II-2) had the MELAS syndrome with the mutation (group 5) but did not have diabetes. His mother (Subject I-2) and sister (Subject II-1) had the mutation and diabetes and were being treated with insulin. Neither had the MELAS syndrome, but both had sensory hearing loss and short stature.

            Family 13

The proband in Family 13 (Subject III-1) had the MELAS syndrome and the mutation (group 5) but not diabetes. His mother (Subject II-3) and his aunt (Subject II-1) had insulin-requiring NIDDM, and his mother also had sensory hearing loss. The proband's grandmother (Subject I-2) had NIDDM. The offspring (Subject II-4) of the proband's grandmother with a different partner (Subject I-3) also had insulin-requiring NIDDM. None of the family members except the proband had the MELAS syndrome.

Clinical Characteristics of Patients with Diabetes and the Mutation

In these families, diabetes is apparently transmitted maternally. Thus, diabetes and the A-to-G mutation at position 3243 were transmitted by the mother (for example, see Families 1, 2, 3, 4, 5, 10, 12, and 13 in Figure 2), not by the father. The men with diabetes and the mutation transmitted neither diabetes nor the mutation to their offspring (for example, see Families 3 and 12 in Figure 2). Twenty-seven of the 52 patients with diabetes and the mutation (52 percent) were treated with insulin. Among 44 patients with diabetes but not the MELAS syndrome, 24 (55 percent) were treated with insulin. Before the identification of the mutation, patients with diabetes and the mutation were often given a diagnosis of IDDM or insulin-deficient NIDDM on the basis of the development of ketoacidosis unless insulin was given and their endogenous insulin secretory capacity (Table 2). Some of these patients were given a diagnosis of slowly progressive IDDM²⁰ because there was a lag (2 to 20 years) between the diagnosis of diabetes and the initiation of insulin therapy. However, tests for islet-cell antibodies were not positive in any of the four patients with IDDM with the mutation who were tested (Table 1). Thirty-three of the 52 patients with diabetes (63 percent), including 27 of 44 patients with diabetes who did not have the MELAS syndrome, had hearing loss. The hearing loss often developed after the onset of diabetes. However, only the probands of the families with a history of the MELAS syndrome had other neuromuscular symptoms.

We compared the clinical characteristics of the 44 patients with diabetes associated with the mutation who did not have the MELAS syndrome with those of the 52 patients with IDDM in group 1 without the mutation and the 98 patients with NIDDM in group 3 without the mutation (Table 3). As compared with the patients in group 1 who had diabetes without the mutation, the patients with diabetes and the mutation were more likely to have a hearing loss and a mother with diabetes and less likely to have a father with diabetes. Similarly, as compared with the patients in group 3 with NIDDM without the mutation, the patients with diabetes and the mutation were more likely to have a mother with diabetes, were younger at the time of diagnosis, had a lower frequency of obesity in the past, had a higher frequency of treatment with insulin, and had a higher frequency of hearing loss.

View this table: [in this window] [in a new window]   Table 3. Clinical Characteristics of Patients with Diabetes and the Mutation but Not the MELAS Syndrome, Patients with IDDM and a Family History of Diabetes but Not the Mutation, and Patients with NIDDM and a Family History of Diabetes but Not the Mutation.

 
Insulin Secretory Capacity and Peripheral Insulin Resistance

Insulin secretory capacity was studied in 13 families (19 patients) with the mutation (Table 2). Urinary C-peptide excretion in these patients was low (mean ±SD, 24 ±15 µg per day [7.9 ±5.0 nmol per day]; normal range, 60 to 120 µg per day [20 to 40 nmol per day]). In three patients studied repeatedly, urinary C-peptide excretion progressively decreased (data not shown). The plasma insulin and C-peptide concentrations were subnormal after the administration of glucagon, although the response was not abolished.

Euglycemic-clamp studies were performed in one patient with IDDM and one patient with NIDDM from Family 1¹⁵. Peripheral uptake of glucose was not significantly impaired in these patients (9.9 mg per kilogram of body weight per minute [55.0 µmol per kilogram per minute] and 8.6 mg per kilogram per minute [47.7 µmol per kilogram per minute], respectively; normal value, 10.5 ±4.4 mg per kilogram per minute [58.3 ±24.4 µmol per kilogram per minute]).

Discussion

We found that the A-to-G mutation at position 3243 in mitochondrial DNA may be associated with either IDDM or NIDDM in Japan. The mutation appears to be the cause of diabetes in affected families, since the disease is inherited maternally and cosegregated with the mutation. Patients with diabetes and the mutation may have sensory hearing loss, which often develops after the onset of diabetes, and they are younger at diagnosis, have a lower frequency of obesity in the past, and more often need insulin than diabetic patients without the mutation.

Patients with diabetes and the mutation have impaired insulin secretion, and this impairment probably has an important role in the development of diabetes. One patient with IDDM and one patient with NIDDM who had the mutation had apparently normal glucose uptake. In findings consistent with our results, Reardon et al.¹⁴ described two patients with the mutation who had poor insulin secretory responses to glucose. In contrast, van den Ouweland et al.¹³ reported that insulin secretion was apparently normal in affected patients, suggesting the pathogenic importance of peripheral insulin resistance. It is likely that the mechanisms whereby the mutation causes diabetes are heterogeneous.

How might this mutation cause dysfunction of pancreatic cells? Since oxidative phosphorylation in the mitochondria may have an important role in insulin secretion,¹⁰ mutant mitochondrial DNA in the pancreatic cells may interfere with the normal process of insulin secretion.

The tRNA Leu(UUR) mutation at position 3243 was originally identified in heteroplasmic form in patients with the MELAS syndrome¹⁷. It is noteworthy that in the families we studied some of the patients who had the mutation had diabetes (and deafness) without the MELAS syndrome and other family members with the mutation had the MELAS syndrome without diabetes (Families 10, 12, and 13). In this respect, the degree of heteroplasmy is reported to differ in various tissues and various persons (even in a single family)¹¹. Thus, it is tempting to speculate that the fraction of abnormal mitochondria with the mutation is relatively high in pancreatic cells, liver cells, muscle cells, or some combination of these cells in patients with diabetes and in nerve and muscle cells in patients with the MELAS syndrome. It is also possible that patients with IDDM or insulin-deficient NIDDM have a higher fraction of abnormal mitochondria in pancreatic cells than patients with NIDDM with apparently normal insulin secretion,¹³ even though they share the same mutation.

Although IDDM is generally thought to be an autoimmune disorder, the mutation in the mitochondrial gene may represent another cause of IDDM. Moreover, although IDDM and NIDDM were thought to be distinct clinical entities, our results suggest that a common diabetogenic gene such as the A-to-G mutation at position 3243 of mitochondrial leucine tRNA may cause either IDDM or NIDDM, indicating overlap between these two entities.

In summary, we have described a subtype of diabetes associated with a mutation in mitochondrial DNA in patients with either IDDM or NIDDM in Japan. Mutations in mitochondrial DNA such as the A-to-G mutation at position 3243 should be considered as a cause of (slowly progressive) IDDM and insulin-deficient NIDDM, especially in patients with sensory hearing loss or a mother with diabetes.

Supported by a grant from the Juvenile Diabetes Foundation International (192125), a grant from the Ministry of Health and Welfare of Japan, and a Diabetes Research Grant from Otsuka Pharmaceutical Company (to Dr. T. Kadowaki).

We are indebted to Drs. Kazuki Yasuda and Simeon I. Taylor for useful comments; to Dr. Masato Kasuga, Dr. Kinori Kosaka, Dr. Takeshi Kuzuya, Dr. Yasunori Kanazawa, Dr. Kimitaka Kaga, Dr. Makiko Kaga, and Ms. Teruko Yoshida for encouragement throughout the study; and to Drs. Nozomi Akashi, Takahiro Iizuka, Takashi Ichiki, Jin Kaneko, Tatsuro Sato, and Kazumasa Shindo for referring patients to the study or providing information about them.

Source Information

From the Third Department of Internal Medicine, Faculty of Medicine, University of Tokyo, Tokyo (T. Kadowaki, Y.M., K.T., H.S., T.H., Y.Y.); the Institute for Diabetes Care and Research, Asahi Life Foundation, Tokyo (H.K., R.H., Y.A.); the Division of Ultrastructural Research, National Institute of Neuroscience, Kodaira (R.S., Y.G., I.N.); Chiba Children's Hospital, Chiba (Y.T.); the Department of Endocrinology and Metabolism, Jichi Medical School, Minamikawachi (T.A.); Saiseikai Central Hospital, Tokyo (Y.S., K.M.); the First Department of Internal Medicine, Osaka University Medical School, Osaka (R.K., T. Kamada); and the National Institute of Genetics, Mishima (S.H.) -- all in Japan.

Address reprint requests to Dr. T. Kadowaki at the Third Department of Internal Medicine, Faculty of Medicine, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113, Japan.

References

1. Diabetes mellitus: report of a WHO Study Group. World Health Organ Tech Rep Ser 1985;727:1-113. [Medline]
2. Taylor SI. Molecular mechanisms of insulin resistance: lessons from patients with mutations in the insulin-receptor gene. Diabetes 1992;41:1473-1490. [Abstract]
3. Kadowaki T, Bevins CL, Cama A, et al. Two mutant alleles of the insulin receptor gene in a patient with extreme insulin resistance. Science 1988;240:787-790. [Free Full Text]
4. Bell GI, Xiang KS, Newman MV, et al. Gene for non-insulin-dependent diabetes mellitus (maturity-onset diabetes of the young subtype) is linked to DNA polymorphism on human chromosome 20q. Proc Natl Acad Sci U S A 1991;88:1484-1488. [Free Full Text]
5. Froguel P, Vaxillaire M, Sun F, et al. Close linkage of glucokinase locus on chromosome 7p to early-onset non-insulin-dependent diabetes mellitus. Nature 1992;356:162-164. [Erratum, Nature 1992;357:607.] [CrossRef][Medline]
6. Froguel P, Zouali H, Vionnet N, et al. Familial hyperglycemia due to mutations in glucokinase: definition of a subtype of diabetes mellitus. N Engl J Med 1993;328:697-702. [Free Full Text]
7. DeFronzo RA, Bonadonna RC, Ferrannini E. Pathogenesis of NIDDM: a balanced overview. Diabetes Care 1992;15:318-368. [Abstract]
8. Kadowaki T, Miyake Y, Hagura R, et al. Risk factors for worsening to diabetes in subjects with impaired glucose tolerance. Diabetologia 1984;26:44-49. [Medline]
9. Eto K, Sakura H, Shimokawa K, et al. Sequence variations of the glucokinase gene in Japanese subjects with NIDDM. Diabetes 1993;42:1133-1137. [Abstract]
10. Ashcroft FM, Ashcroft SJH. Mechanism of insulin secretion. In: Ashcroft FM, Ashcroft SJH, eds. Insulin: molecular biology to pathology. Oxford, England: Oxford University Press, 1992:97-150.
11. Wallace DC. Mitochondrial genetics: a paradigm for aging and degenerative diseases? Science 1992;256:628-632. [Free Full Text]
12. Ballinger SW, Shoffner JM, Hedaya EV, et al. Maternally transmitted diabetes and deafness associated with a 10.4 kb mitochondrial DNA deletion. Nat Genet 1992;1:11-15. [CrossRef][Medline]
13. van den Ouweland JMW, Lemkes HHPJ, Ruitenbeek W, et al. Mutation in mitochondrial tRNALeu(UUR) gene in a large pedigree with maternally transmitted type II diabetes mellitus and deafness. Nat Genet 1992;1:368-371. [CrossRef][Medline]
14. Reardon W, Ross RJM, Sweeney MG, et al. Diabetes mellitus associated with a pathogenic point mutation in mitochondrial DNA. Lancet 1992;340:1376-1379. [CrossRef][Medline]
15. Kadowaki H, Tobe K, Mori Y, et al. Mitochondrial gene mutation and insulin-deficient type of diabetes mellitus. Lancet 1993;341:893-894. 
16. Chomyn A, Martinuzzi A, Yoneda M, et al. MELAS mutation in mtDNA binding site for transcription termination factor causes defects in protein synthesis and in respiration but no change in levels of upstream and downstream mature transcripts. Proc Natl Acad Sci U S A 1992;89:4221-4225. [Free Full Text]
17. Goto Y, Nonaka I, Horai S. A mutation in the tRNALeu(UUR) gene associated with the MELAS subgroup of mitochondrial encephalomyopathies. Nature 1990;348:651-653. [CrossRef][Medline]
18. Kadowaki T, Kadowaki H, Taylor SI. A nonsense mutation causing decreased levels of insulin receptor mRNA: detection by a simplified technique for direct sequencing of genomic DNA amplified by the polymerase chain reaction. Proc Natl Acad Sci U S A 1990;87:658-662. [Free Full Text]
19. Kawamori R, Kubota M, Ikeda M, et al. Quantitative determination of hepatic glucose uptake using an innovative approach: effect of strict glycemic regulation and exercise in diabetic subjects. J Nutr Sci Vitaminol (Tokyo) 1991;37:Suppl:S35-S42.
20. Kobayashi T, Itoh T, Kosaka K, Sato K, Tsuji K. Time course of islet cell antibodies and -cell function in non-insulin-dependent stage of type I diabetes. Diabetes 1987;36:510-517. [Abstract]

Abstract Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

This article has been cited by other articles:

• Rath, P P, Jenkins, S, Michaelides, M, Smith, A, Sweeney, M G, Davis, M B, Fitzke, F W, Bird, A C (2008). Characterisation of the macular dystrophy in patients with the A3243G mitochondrial DNA point mutation with fundus autofluorescence. Br. J. Ophthalmol. 92: 623-629 [Abstract] [Full Text]  
• Michaelides, M., Jenkins, S. A., Bamiou, D.-E., Sweeney, M. G., Davis, M. B., Luxon, L., Bird, A. C., Rath, P. P. (2008). Macular Dystrophy Associated With the A3243G Mitochondrial DNA Mutation: Distinct Retinal and Associated Features, Disease Variability, and Characterization of Asymptomatic Family Members. Arch Ophthalmol 126: 320-328 [Abstract] [Full Text]  
• Greer, D. M., Cagliero, E., Krakauer, E. L., Gonzalez, R. G., Hedley-Whyte, E. T. (2007). Case 21-2007 -- A 58-Year-Old Woman with Headaches, Weakness, and Strokelike Episodes. NEJM 357: 164-173 [Full Text]  
• Sahu, R. P., Aggarwal, A., Zaidi, G., Shah, A., Modi, K., Kongara, S., Aggarwal, S., Talwar, S., Chu, S., Bhatia, V., Bhatia, E. (2007). Etiology of Early-Onset Type 2 Diabetes in Indians: Islet Autoimmunity and Mutations in Hepatocyte Nuclear Factor 1{alpha} and Mitochondrial Gene. J. Clin. Endocrinol. Metab. 92: 2462-2467 [Abstract] [Full Text]  
• Watanabe, R. M., Black, M. H., Xiang, A. H., Allayee, H., Lawrence, J. M., Buchanan, T. A. (2007). Genetics of Gestational Diabetes Mellitus and Type 2 Diabetes. Diabetes Care 30: S134-S140 [Full Text]  
• KAWASAKI, E., EGUCHI, K. (2006). Genetics of Fulminant Type 1 Diabetes. Ann. N. Y. Acad. Sci. 1079: 24-30 [Abstract] [Full Text]  
• Park, S. Y., Choi, G. H., Choi, H. I., Ryu, J., Jung, C. Y., Lee, W. (2005). Depletion of Mitochondrial DNA Causes Impaired Glucose Utilization and Insulin Resistance in L6 GLUT4myc Myocytes. J. Biol. Chem. 280: 9855-9864 [Abstract] [Full Text]  
• ROY, M. D., WITTENHAGEN, L. M., KELLEY, S. O. (2005). Structural probing of a pathogenic tRNA dimer. RNA 11: 254-260 [Abstract] [Full Text]  
• Li, N., Wang, Q., Li, J., Wang, X., Hellmich, M. R., Rajaraman, S., Greeley, G. H. Jr., Townsend, C. M. Jr., Evers, B. M. (2005). Inhibition of mitochondrial gene transcription suppresses neurotensin secretion in the human carcinoid cell line BON. Am. J. Physiol. Gastrointest. Liver Physiol. 288: G213-G220 [Abstract] [Full Text]  
• Mauvais-Jarvis, F., Smith, S. B., May, C. L., Leal, S. M., Gautier, J.-F., Molokhia, M., Riveline, J.-P., Rajan, A. S., Kevorkian, J.-P., Zhang, S., Vexiau, P., German, M. S., Vaisse, C. (2004). PAX4 gene variations predispose to ketosis-prone diabetes. Hum Mol Genet 13: 3151-3159 [Abstract] [Full Text]  
• Urata, M., Wada, Y., Kim, S. H., Chumpia, W., Kayamori, Y., Hamasaki, N., Kang, D. (2004). High-Sensitivity Detection of the A3243G Mutation of Mitochondrial DNA by a Combination of Allele-Specific PCR and Peptide Nucleic Acid-Directed PCR Clamping. Clin. Chem. 50: 2045-2051 [Abstract] [Full Text]  
• Bouche, C., Serdy, S., Kahn, C. R., Goldfine, A. B. (2004). The Cellular Fate of Glucose and Its Relevance in Type 2 Diabetes. Endocr. Rev. 25: 807-830 [Abstract] [Full Text]  
• Fukushima, K., Fiocchi, C. (2004). Paradoxical decrease of mitochondrial DNA deletions in epithelial cells of active ulcerative colitis patients. Am. J. Physiol. Gastrointest. Liver Physiol. 286: G804-G813 [Abstract] [Full Text]  
• LEE, H. K. (2004). Overview. Ann. N. Y. Acad. Sci. 1011: 1-6 [Full Text]  
• SUZUKI, S. (2004). Diabetes Mellitus with Mitochondrial Gene Mutations in Japan. Ann. N. Y. Acad. Sci. 1011: 185-192 [Abstract] [Full Text]  
• NOMIYAMA, T., TANAKA, Y., PIAO, L., HATTORI, N., UCHINO, H., WATADA, H., KAWAMORI, R., OHTA, S. (2004). Accumulation of Somatic Mutation in Mitochondrial DNA and Atherosclerosis in Diabetic Patients. Ann. N. Y. Acad. Sci. 1011: 193-204 [Abstract] [Full Text]  
• McCarthy, M. I. (2004). Progress in defining the molecular basis of type 2 diabetes mellitus through susceptibility-gene identification. Hum Mol Genet 13: R33-R41 [Abstract] [Full Text]  
• Inoue, K., Ikegami, H., Fujisawa, T., Kawabata, Y., Shintani, M., Nijima, K., Masaya, O., Nishino, M., Itoi-babaya, M., Babaya, N., Ogihara, T. (2003). High Degree of Mitochondrial 3243 Mutation in Gastric Biopsy Specimen in a Patient With MELAS and Diabetes Complicated by Marked Gastrointestinal Abnormalities. Diabetes Care 26: 2219-2219 [Full Text]  
• DiMauro, S., Schon, E. A. (2003). Mitochondrial Respiratory-Chain Diseases. NEJM 348: 2656-2668 [Full Text]  
• Kulkarni, R. N., Almind, K., Goren, H. J., Winnay, J. N., Ueki, K., Okada, T., Kahn, C. R. (2003). Impact of Genetic Background on Development of Hyperinsulinemia and Diabetes in Insulin Receptor/Insulin Receptor Substrate-1 Double Heterozygous Mice. Diabetes 52: 1528-1534 [Abstract] [Full Text]  
• Suzuki, Y., Taniyama, M., Muramatsu, T., Ohta, S., Murata, C., Atsumi, Y., Matsuoka, K. (2003). Mitochondrial tRNALeu(UUR) Mutation at Position 3243 and Symptomatic Polyneuropathy in Type 2 Diabetes. Diabetes Care 26: 1315-1316 [Full Text]  
• Silveiro, S. P., Canani, L. H., Maia, A. L., Butany, J. W., Gross, J. L. (2003). Myocardial Dysfunction in Maternally Inherited Diabetes and Deafness. Diabetes Care 26: 1323-1324 [Full Text]  
• (2003). Report of the Expert Committee on the Diagnosis and Classification of Diabetes Mellitus. Diabetes Care 26: s5-20 [Full Text]  
• Momiyama, Y., Suzuki, Y., Ohtomo, M., Atsumi, Y., Matsuoka, K., Ohsuzu, F., Kimura, M. (2002). Cardiac Autonomic Nervous Dysfunction in Diabetic Patients With a Mitochondrial DNA Mutation: Assessment by heart rate variability. Diabetes Care 25: 2308-2313 [Abstract] [Full Text]  
• Noda, M., Yamashita, S., Takahashi, N., Eto, K., Shen, L.-M., Izumi, K., Daniel, S., Tsubamoto, Y., Nemoto, T., Iino, M., Kasai, H., Sharp, G. W. G., Kadowaki, T. (2002). Switch to Anaerobic Glucose Metabolism with NADH Accumulation in the beta -Cell Model of Mitochondrial Diabetes. CHARACTERISTICS OF beta HC9 CELLS DEFICIENT IN MITOCHONDRIAL DNA TRANSCRIPTION. J. Biol. Chem. 277: 41817-41826 [Abstract] [Full Text]  
• McCarthy, M. I., Froguel, P. (2002). Genetic approaches to the molecular understanding of type 2 diabetes. Am. J. Physiol. Endocrinol. Metab. 283: E217-E225 [Abstract] [Full Text]  
• Elbein, S. C. (2002). Perspective: The Search for Genes for Type 2 Diabetes in the Post-Genome Era. Endocrinology 143: 2012-2018 [Abstract] [Full Text]  
• Mori, Y., Otabe, S., Dina, C., Yasuda, K., Populaire, C., Lecoeur, C., Vatin, V., Durand, E., Hara, K., Okada, T., Tobe, K., Boutin, P., Kadowaki, T., Froguel, P. (2002). Genome-Wide Search for Type 2 Diabetes in Japanese Affected Sib-Pairs Confirms Susceptibility Genes on 3q, 15q, and 20q and Identifies Two New Candidate Loci on 7p and 11p. Diabetes 51: 1247-1255 [Abstract] [Full Text]  
• Shanske, A. L., Shanske, S., DiMauro, S. (2001). The Other Human Genome. Arch Pediatr Adolesc Med 155: 1210-1216 [Abstract] [Full Text]  
• Ohkubo, K., Yamano, A., Nagashima, M., Mori, Y., Anzai, K., Akehi, Y., Nomiyama, R., Asano, T., Urae, A., Ono, J. (2001). Mitochondrial Gene Mutations in the tRNALeu(UUR) Region and Diabetes: Prevalence and Clinical Phenotypes in Japan. Clin. Chem. 47: 1641-1648 [Abstract] [Full Text]  
• Guttman, A., Gao, H.-G., Haas, R. (2001). Rapid Analysis of Mitochondrial DNA Heteroplasmy in Diabetes by Gel-Microchip Electrophoresis. Clin. Chem. 47: 1469-1472 [Full Text]  
• Brandle, M., Lehmann, R., Maly, F. E., Schmid, C., Spinas, G. A. (2001). Diminished Insulin Secretory Response to Glucose but Normal Insulin and Glucagon Secretory Responses to Arginine in a Family With Maternally Inherited Diabetes and Deafness Caused by Mitochondrial tRNALEU(UUR) Gene Mutation. Diabetes Care 24: 1253-1258 [Abstract] [Full Text]  
• Park, K.-S., Nam, K.-J., Kim, J.-W., Lee, Y.-B., Han, C.-Y., Jeong, J.-K., Lee, H.-K., Pak, Y. K. (2001). Depletion of mitochondrial DNA alters glucose metabolism in SK-Hep1 cells. Am. J. Physiol. Endocrinol. Metab. 280: E1007-E1014 [Abstract] [Full Text]  
• Song, J., Oh, J. Y., Sung, Y.-A., Pak, Y. K., Park, K. S., Lee, H. K. (2001). Peripheral Blood Mitochondrial DNA Content Is Related to Insulin Sensitivity in Offspring of Type 2 Diabetic Patients. Diabetes Care 24: 865-869 [Abstract] [Full Text]  
• Guillausseau, P.-J., Massin, P., Dubois-LaForgue, D., Timsit, J., Virally, M., Gin, H., Bertin, E., Blickle, J.-F., Bouhanick, B., Cahen, J., Caillat-Zucman, S., Charpentier, G., Chedin, P., Derrien, C., Ducluzeau, P.-H., Grimaldi, A., Guerci, B., Kaloustian, E., Murat, A., Olivier, F., Paques, M., Paquis-Flucklinger, V., Porokhov, B., Samuel-Lajeunesse, J., Vialettes, B. (2001). Maternally Inherited Diabetes and Deafness: A Multicenter Study. ANN INTERN MED 134: 721-728 [Abstract] [Full Text]  
• Fischel-Ghodsian, N. (2001). Mitochondrial DNA Mutations and Diabetes: Another Step toward Individualized Medicine. ANN INTERN MED 134: 777-779 [Full Text]  
• Walston, J., Silver, K., Hilfiker, H., Andersen, R. E., Seibert, M., Beamer, B., Roth, J., Poehlman, E., Shuldiner, A. R. (2000). Insulin Response to Glucose Is Lower in Individuals Homozygous for the Arg 64 Variant of the {beta}-3-Adrenergic Receptor. J. Clin. Endocrinol. Metab. 85: 4019-4022 [Abstract] [Full Text]  
• Balestri, P., Grosso, S. (2000). Endocrine Disorders in Two Sisters Affected by MELAS Syndrome. J Child Neurol 15: 755-758 [Abstract]  
• Yamagata, K., Tomida, C., Umeyama, K., Urakami, K.-i., Ishizu, T., Hirayama, K., Gotoh, M., Iitsuka, T., Takemura, K., Kikuchi, H., Nakamura, H., Kobayashi, M., Koyama, A. (2000). Prevalence of Japanese dialysis patients with an A-to-G mutation at nucleotide 3243 of the mitochondrial tRNALeu(UUR) gene. Nephrol Dial Transplant 15: 385-388 [Abstract] [Full Text]  
• Uusimaa, J., Remes, A. M., Rantala, H., Vainionpää, L., Herva, R., Vuopala, K., Nuutinen, M., Majamaa, K., Hassinen, I. E. (2000). Childhood Encephalopathies and Myopathies: A Prospective Study in a Defined Population to Assess the Frequency of Mitochondrial Disorders. Pediatrics 105: 598-603 [Abstract] [Full Text]  
• Yasukawa, T., Suzuki, T., Suzuki, T., Ueda, T., Ohta, S., Watanabe, K. (2000). Modification Defect at Anticodon Wobble Nucleotide of Mitochondrial tRNAsLeu(UUR) with Pathogenic Mutations of Mitochondrial Myopathy, Encephalopathy, Lactic Acidosis, and Stroke-like Episodes. J. Biol. Chem. 275: 4251-4257 [Abstract] [Full Text]  
• Usami, S.-i., Abe, S., Akita, J., Namba, A., Shinkawa, H., Ishii, M., Iwasaki, S., Hoshino, T., Ito, J., Doi, K., Kubo, T., Nakagawa, T., Komiyama, S., Tono, T., Komune, S. (2000). Prevalence of mitochondrial gene mutations among hearing impaired patients. J. Med. Genet. 37: 38-40 [Abstract] [Full Text]  
• Taylor, (1999). Genetically Defined Forms of Diabetes in Children. J. Clin. Endocrinol. Metab. 84: 4390-4396 [Full Text]  
• Janssen, G. M. C., Maassen, J. A., van den Ouweland, J. M. W. (1999). The Diabetes-associated 3243 Mutation in the Mitochondrial tRNALeu(UUR) Gene Causes Severe Mitochondrial Dysfunction without a Strong Decrease in Protein Synthesis Rate. J. Biol. Chem. 274: 29744-29748 [Abstract] [Full Text]  
• Eto, K., Suga, S., Wakui, M., Tsubamoto, Y., Terauchi, Y., Taka, J., Aizawa, S., Noda, M., Kimura, S., Kasai, H., Kadowaki, T. (1999). NADH Shuttle System Regulates KATP Channel-dependent Pathway and Steps Distal to Cytosolic Ca2+ Concentration Elevation in Glucose-induced Insulin Secretion. J. Biol. Chem. 274: 25386-25392 [Abstract] [Full Text]  
• Berneburg, M., Grether-Beck, S., Kurten, V., Ruzicka, T., Briviba, K., Sies, H., Krutmann, J. (1999). Singlet Oxygen Mediates the UVA-induced Generation of the Photoaging-associated Mitochondrial Common Deletion. J. Biol. Chem. 274: 15345-15349 [Abstract] [Full Text]  
• Momiyama, Y., Suzuki, Y., Ohsuzu, F., Atsumi, Y., Matsuoka, K., Kimura, M. (1999). Maternally transmitted susceptibility to non-insulin-dependent diabetes mellitus and left ventricular hypertrophy. J Am Coll Cardiol 33: 1372-1378 [Abstract] [Full Text]  
• Urata, M., Wakiyama, M., Iwase, M., Yoneda, M., Kinoshita, S., Hamasaki, N., Kang, D. (1998). New sensitive method for the detection of the A3243G mutation of human mitochondrial deoxyribonucleic acid in diabetes mellitus patients by ligation-mediated polymerase chain reaction. Clin. Chem. 44: 2088-2093 [Abstract] [Full Text]  
• Hayakawa, T., Noda, M., Yasuda, K., Yorifuji, H., Taniguchi, S., Miwa, I., Sakura, H., Terauchi, Y., Hayashi, J.-i., Sharp, G. W. G., Kanazawa, Y., Akanuma, Y., Yazaki, Y., Kadowaki, T. (1998). Ethidium Bromide-induced Inhibition of Mitochondrial Gene Transcription Suppresses Glucose-stimulated Insulin Release in the Mouse Pancreatic beta -Cell Line beta HC9. J. Biol. Chem. 273: 20300-20307 [Abstract] [Full Text]  
• Hirai, M., Suzuki, S., Onoda, M., Hinokio, Y., Hirai, A., Ohtomo, M., Chiba, M., Kasuga, S., Hirai, S., Satoh, Y., Akai, H., Miyabayashi, S., Toyota, T. (1998). Mitochondrial Deoxyribonucleic Acid 3256C-T Mutation in a Japanese Family with Noninsulin-Dependent Diabetes Mellitus. J. Clin. Endocrinol. Metab. 83: 992-994 [Abstract] [Full Text]  
• Dimauro, S., Schon, E. A. (1998). Mitochondrial DNA and Diseases of the Nervous System: The Spectrum. Neuroscientist 4: 53-63 [Abstract]  
• Smith, M. L., Hua, X.-Y., Marsden, D. L., Liu, D., Kennaway, N. G., Ngo, K.-Y., Haas, R. H. (1997). Diabetes and Mitochondrial Encephalomyopathy with Lactic Acidosis and Stroke-Like Episodes (MELAS): Radiolabeled Polymerase Chain Reaction Is Necessary for Accurate Detection of Low Percentages of Mutation. J. Clin. Endocrinol. Metab. 82: 2826-2831 [Abstract] [Full Text]  
• Urhammer, S. A., Hansen, T., Jensen, L. B., O. Clausen, J., Hansen, L., Chui, K. C., Pedersen, O. (1997). Studies of the Impact of a Liver Glucokinase Promoter Variant on Glucose Tolerance and Insulin Sensitivity Index. J. Clin. Endocrinol. Metab. 82: 1786-1789 [Abstract] [Full Text]  
• Lee, H. c., Song, Y. d., Li, H.-R., Park, J. o., Suh, H. c., Lee, E., Lim, S., Kim, K., Huh, K. (1997). Mitochondrial Gene Transfer Ribonucleic Acid (tRNA)Leu(UUR) 3243 and tRNALys 8344 Mutations and Diabetes Mellitus in Korea. J. Clin. Endocrinol. Metab. 82: 372-374 [Abstract] [Full Text]  
• Soejima, A., Inoue, K., Takai, D., Kaneko, M., Ishihara, H., Oka, Y., Hayashi, J.-I. (1996). Mitochondrial DNA Is Required for Regulation of Glucose-stimulated Insulin Secretion in a Mouse Pancreatic Beta Cell Line, MIN6. J. Biol. Chem. 271: 26194-26199 [Abstract] [Full Text]  
• Cooke, C. E., Greenberg, M. D., Coughlin, S. S., Mishark, K., Odawara, M., Yamashita, K., Legha, S. S., Dec, G.W., Fuster, V. (1995). Idiopathic Dilated Cardiomyopathy. NEJM 332: 1384-1386 [Full Text]