Background Several families have been described in which a mutationof mitochondrial DNA, the substitution of guanine for adenine(A-to-G) at position 3243 of leucine transfer RNA, is associatedwith diabetes mellitus and deafness. The prevalence, clinicalfeatures, and pathophysiology of diabetes with this mutationare largely undefined.
Methods We studied 55 patients with insulin-dependent diabetesmellitus (IDDM) and a family history of diabetes (group 1),85 patients with IDDM and no family history of diabetes (group2), 100 patients with non-insulin-dependent diabetes mellitus(NIDDM) and a family history of diabetes (group 3), and 5 patientswith diabetes and deafness (group 4) for the mutation. We alsostudied the prevalence and characteristics of diabetes in 39patients with a syndrome consisting of mitochondrial myopathy,encephalopathy, lactic acidosis, and stroke-like episodes whowere known to have the mutation and 127 of their relatives (group5).
Results We identified 16 unrelated patients with diabetes associatedwith the A-to-G mutation: 3 patients from group 1 (6 percent),2 patients from group 3 (2 percent), 3 patients from group 4(60 percent), and 8 patients from group 5 (21 percent). We alsoidentified 16 additional subjects who had diabetes and the mutationamong 42 relatives of the patients with diabetes and the mutationin groups 1, 2, 3, and 4 and 20 affected subjects among the127 relatives of the patients in group 5. Diabetes cosegregatedwith the mutation in a fashion consistent with maternal transmission,was frequently (in 61 percent of cases) associated with sensoryhearing loss, and was generally accompanied by impaired insulinsecretion.
Conclusions Diabetes mellitus associated with the A-to-G mutationat position 3243 of mitochondrial leucine transfer RNA representsa subtype of diabetes found in both patients with IDDM and patientswith NIDDM in Japan.
Diabetes mellitus is one of the most common chronic disorders,affecting as many as 5 to 10 percent of persons in both Japanand Western countries1. Both types of diabetes mellitus -- insulin-dependent(IDDM) and non-insulin-dependent (NIDDM) -- are heterogeneousdisorders, and several mechanisms have been implicated in theircauses. These include autoimmune destruction of pancreatic cells in IDDM and mutations in the insulin gene, the insulin-receptorgene,2,3 a gene linked to the adenosine deaminase gene on chromosome20,4 and the glucokinase gene5,6 in NIDDM. Although defectsin both glucose-induced insulin secretion and peripheral insulinsensitivity are generally thought to contribute to the pathogenesisof NIDDM,7 many patients with NIDDM in Japan have decreasedinsulin responses to glucose even during the preclinical period8;however, the prevalence of mutations in the glucokinase geneappears to be low9. Mitochondrial genes are plausible causativeagents of both IDDM and NIDDM, since it has been suggested thatoxidative phosphorylation in the mitochondria has a crucialrole in the secretion of insulin by pancreatic cells in responseto glucose and other nutrients10. Normal mitochondrial DNA isa circular molecule of 16,569 base pairs (bp) that contains37 genes encoding 22 types of transfer RNA (tRNA), 2 types ofribosomal RNA, and 13 enzymes involved in oxidative phosphorylation11.
Recently, several case reports12,13,14,15 suggested that mutationsin mitochondrial DNA, especially one involving the substitutionof guanine for adenine (A-to-G) at position 3243 of leucinetRNA,13,14,15 may cause diabetes and deafness. This mutationoccurs within the mitochondrial DNA binding site for a proteinfactor that promotes the termination of transcription at theboundary between the 16S ribosomal RNA and tRNA Leu(UUR) genes.This mutation appears to interfere not only with the synthesisof tRNA Leu(UUR) but also with the binding of the transcriptiontermination factor, thereby causing defects in the synthesisof mitochondrial proteins16. The prevalence, clinical characteristics,and pathophysiologic process of diabetes associated with theA-to-G mutation at position 3243 are largely unknown. In thisstudy, we identified 22 families (52 patients) with the mutationand diabetes and examined the clinical features of this subtypeof diabetes.
Methods
Families
We studied 55 patients with IDDM and a history of diabetes (eitherIDDM or NIDDM) in first-degree relatives (group 1), 85 patientswith IDDM and no family history of diabetes (group 2), and 100patients with NIDDM and a history of diabetes in first-degreerelatives (group 3)9. The patients were recruited from the outpatientclinic of the Institute for Diabetes Care and Research of theAsahi Life Foundation. Five patients with diabetes and hearingloss (three of whom had a family history of these problems)were referred to us for testing for the mutation (group 4).The 245 patients were all unrelated. We studied 42 relativesof the patients in the four groups who were found to have themutation. We also studied 39 unrelated patients with a syndromeconsisting of mitochondrial myopathy, encephalopathy, lacticacidosis, and stroke-like episodes (MELAS) who were known tohave the mutation and 127 of their relatives (group 5). Questionnairesor direct examination of the patients and their relatives wasused to ascertain the presence of diabetes, the type of diabetes,the treatment regimen, and insulin secretory capacity, as wellas to determine whether associated symptoms such as sensoryhearing loss, muscle weakness, ophthalmoplegia, and mental retardationwere present. The diagnosis of diabetes in these subjects wasbased on the criteria of the World Health Organization,1 andketosis-prone patients were defined as having clinical IDDM.The study was approved by the appropriate institutional reviewcommittees, and all subjects gave informed consent.
Molecular Studies
DNA was prepared from peripheral-blood leukocytes. Fragmentsof mitochondrial DNA encompassing position 3243 were amplifiedwith the polymerase chain reaction (PCR). The forward primerwas 5'AGGACAAGAGAAATAAGGCC3', covering positions 3130 to 3149,and the reverse primer was 5'CACGTTGGGGCCTTTGCGTA3', coveringpositions 3423 through 340417. The resultant 294-bp fragmentsof mitochondrial DNA (3130 through 3423) were digested witha restriction endonuclease, ApaI, and analyzed by agarose-gel(0.8 percent) electrophoresis. The PCR products were eithersequenced directly18 or subcloned into a plasmid vector andthen sequenced.
Insulin Secretory Capacity and Euglycemic-Clamp Studies
Insulin secretory capacity was evaluated by measurements ofplasma insulin or C-peptide concentrations during a 75-g oralglucose-tolerance test or after the intravenous administrationof glucagon (1 mg) or by measurements of C peptide in a 24-hoururine sample. Peripheral uptake of glucose (mainly by skeletalmuscle) was measured in one patient with IDDM and one patientwith NIDDM, both of whom had the mutation, during a euglycemic-hyperinsulinemicclamp study19.
Statistical Analysis
Continuous variables were compared by Student's t-test, andcategorical variables were compared by chi-square analysis.All P values are two-tailed.
Results
Identification of the Mutation
We identified an A-to-G mutation at position 3243 of mitochondrialleucine tRNA in 16 of the patients from groups 1 through 5 (Figure 1).Figure 1A shows the sequences encompassing position 3243in normal and mutant mitochondrial DNA from one patient (SubjectII-2 in Family 2). This means that the patient is heteroplasmicfor the mutation. This A-to-G transition created a recognitionsite for the restriction endonuclease ApaI (GAGCCC to GGGCCC).Digestion of mitochondrial DNA with ApaI revealed that affectedsubjects are heteroplasmic for the mutation (Figure 1B). Thismutation was not found in 200 normal subjects with no familyhistory of diabetes. In group 1, 3 of the 55 patients (6 percent)had this mutation; in group 2, 0 of 85 patients; in group 3,2 of 100 patients (2 percent); in group 4, 3 of 5 patients (60percent); and in group 5, 8 of 39 patients (21 percent). Weidentified 16 additional subjects with diabetes and the mutationin our study of 42 relatives of the patients in groups 1, 2,3, and 4, and 20 additional subjects with diabetes and the mutationin our study of 127 relatives of the patients in group 5. Thus,we identified 52 patients with diabetes mellitus in 22 unrelatedfamilies who had the mutation (Table 1).
Figure 1. Identification of an A-to-G Mutation at Position 3243 of Mitochondrial Leucine tRNA.
Panel A shows the sequences of mitochondrial DNA surrounding the mutated site in mitochondrial tRNA Leu(UUR) from Subject II-2 in Family 2. Fragments of mitochondrial DNA were amplified by PCR, and the products were subcloned into a plasmid vector and sequenced as described in the Methods section. In Panel B, 294-bp fragments (3130 through 3423) of mitochondrial DNA encompassing position 3243 were obtained from three subjects and prepared by PCR, digested with ApaI, and analyzed by agarose-gel (0.8 percent) electrophoresis. Affected subjects are heteroplasmic for the mutation.
Table 1. Characteristics of the Families with Diabetes Mellitus Associated with the A to G Mutation at Position 3243 of Mitochondrial Leucine tRNA.
Representative Families with Diabetes and the Mutation
The pedigrees of nine representative families with diabetesand the mutation are shown in Figure 2. A preliminary descriptionof Family 1 has been reported15.
Figure 2. Pedigrees of Nine Families with Diabetes Mellitus and the A to G Mutation at Position 3243.
Families 1, 2, 3, 4, 5, and 7 have a history of diabetes and the mutation but not the MELAS syndrome. Families 10, 12, and 13 have a history of diabetes and the mutation and have a proband with the MELAS syndrome.
Family 2
The proband in Family 2 (Subject II-2) was identified duringscreening for the mutation in group 1. He was given a diagnosisof diabetes after an oral glucose-tolerance test at the ageof 13 years, and he started taking insulin at the age of 17,when he became prone to ketoacidosis. His insulin secretorycapacity was considered to be low on the basis of low urinaryC-peptide excretion (7 to 13 µg per day [2.3 to 4.3 nmolper day]) and a low plasma C-peptide response to glucagon injection(Table 2). Although he was given a diagnosis of slowly progressiveIDDM,20 a test for islet-cell antibodies was negative. He beganto have sensory hearing loss at the age of 29 years. His mother(Subject I-2), sister (Subject II-1), and uncle (Subject I-3)had the mutation and insulin-requiring NIDDM with low insulinsecretion (Table 2) and sensory hearing loss. The proband'sfather (Subject I-1), who did not have the mutation, had normalglucose tolerance.
Table 2. Insulin Secretory Capacity of Pancreatic Cells in Patients with Diabetes Associated with the A to G Mutation at Position 3243 of Mitochondrial Leucine tRNA.
Family 3
The proband in Family 3 (Subject II-2) was also identified duringscreening for the mutation in group 1. He had been prone toketosis since the age of 24 years unless treated with insulinand had recently had mild sensory hearing loss. His urinaryC-peptide excretion was low (19 µg per day [6.3 nmol perday]) (Table 2). His mother (Subject I-2), who also had themutation, had NIDDM and was being treated with an oral hypoglycemicagent but did not have a hearing loss. Neither of his sons (SubjectsIII-1 and III-2) had the mutation or diabetes.
Family 5
The proband in Family 5 (Subject III-1) was identified duringscreening for the mutation in group 3. She was given a diagnosisof NIDDM at the age of 36 years and was treated with an oralhypoglycemic agent until the age of 44, when she started takinginsulin. She had no hearing loss. Her insulin secretory capacitywas low (Table 2). Her mother (Subject II-3), two uncles (SubjectsII-1 and II-5), and grandmother (Subject I-2) had diabetes,and her mother and one of her uncles had sensory hearing loss.
Family 10
The proband in Family 10 (Subject II-2) had the MELAS syndromewith the mutation (group 5) but did not have diabetes. His mother(Subject I-2) and sister (Subject II-1) had the mutation anddiabetes and were being treated with insulin. Neither had theMELAS syndrome, but both had sensory hearing loss and shortstature.
Family 13
The proband in Family 13 (Subject III-1) had the MELAS syndromeand the mutation (group 5) but not diabetes. His mother (SubjectII-3) and his aunt (Subject II-1) had insulin-requiring NIDDM,and his mother also had sensory hearing loss. The proband'sgrandmother (Subject I-2) had NIDDM. The offspring (SubjectII-4) of the proband's grandmother with a different partner(Subject I-3) also had insulin-requiring NIDDM. None of thefamily members except the proband had the MELAS syndrome.
Clinical Characteristics of Patients with Diabetes and the Mutation
In these families, diabetes is apparently transmitted maternally.Thus, diabetes and the A-to-G mutation at position 3243 weretransmitted by the mother (for example, see Families 1, 2, 3,4, 5, 10, 12, and 13 in Figure 2), not by the father. The menwith diabetes and the mutation transmitted neither diabetesnor the mutation to their offspring (for example, see Families3 and 12 in Figure 2). Twenty-seven of the 52 patients withdiabetes and the mutation (52 percent) were treated with insulin.Among 44 patients with diabetes but not the MELAS syndrome,24 (55 percent) were treated with insulin. Before the identificationof the mutation, patients with diabetes and the mutation wereoften given a diagnosis of IDDM or insulin-deficient NIDDM onthe basis of the development of ketoacidosis unless insulinwas given and their endogenous insulin secretory capacity (Table 2).Some of these patients were given a diagnosis of slowlyprogressive IDDM20 because there was a lag (2 to 20 years) betweenthe diagnosis of diabetes and the initiation of insulin therapy.However, tests for islet-cell antibodies were not positive inany of the four patients with IDDM with the mutation who weretested (Table 1). Thirty-three of the 52 patients with diabetes(63 percent), including 27 of 44 patients with diabetes whodid not have the MELAS syndrome, had hearing loss. The hearingloss often developed after the onset of diabetes. However, onlythe probands of the families with a history of the MELAS syndromehad other neuromuscular symptoms.
We compared the clinical characteristics of the 44 patientswith diabetes associated with the mutation who did not havethe MELAS syndrome with those of the 52 patients with IDDM ingroup 1 without the mutation and the 98 patients with NIDDMin group 3 without the mutation (Table 3). As compared withthe patients in group 1 who had diabetes without the mutation,the patients with diabetes and the mutation were more likelyto have a hearing loss and a mother with diabetes and less likelyto have a father with diabetes. Similarly, as compared withthe patients in group 3 with NIDDM without the mutation, thepatients with diabetes and the mutation were more likely tohave a mother with diabetes, were younger at the time of diagnosis,had a lower frequency of obesity in the past, had a higher frequencyof treatment with insulin, and had a higher frequency of hearingloss.
Table 3. Clinical Characteristics of Patients with Diabetes and the Mutation but Not the MELAS Syndrome, Patients with IDDM and a Family History of Diabetes but Not the Mutation, and Patients with NIDDM and a Family History of Diabetes but Not the Mutation.
Insulin Secretory Capacity and Peripheral Insulin Resistance
Insulin secretory capacity was studied in 13 families (19 patients)with the mutation (Table 2). Urinary C-peptide excretion inthese patients was low (mean ±SD, 24 ±15 µgper day [7.9 ±5.0 nmol per day]; normal range, 60 to120 µg per day [20 to 40 nmol per day]). In three patientsstudied repeatedly, urinary C-peptide excretion progressivelydecreased (data not shown). The plasma insulin and C-peptideconcentrations were subnormal after the administration of glucagon,although the response was not abolished.
Euglycemic-clamp studies were performed in one patient withIDDM and one patient with NIDDM from Family 115. Peripheraluptake of glucose was not significantly impaired in these patients(9.9 mg per kilogram of body weight per minute [55.0 µmolper kilogram per minute] and 8.6 mg per kilogram per minute[47.7 µmol per kilogram per minute], respectively; normalvalue, 10.5 ±4.4 mg per kilogram per minute [58.3 ±24.4µmol per kilogram per minute]).
Discussion
We found that the A-to-G mutation at position 3243 in mitochondrialDNA may be associated with either IDDM or NIDDM in Japan. Themutation appears to be the cause of diabetes in affected families,since the disease is inherited maternally and cosegregated withthe mutation. Patients with diabetes and the mutation may havesensory hearing loss, which often develops after the onset ofdiabetes, and they are younger at diagnosis, have a lower frequencyof obesity in the past, and more often need insulin than diabeticpatients without the mutation.
Patients with diabetes and the mutation have impaired insulinsecretion, and this impairment probably has an important rolein the development of diabetes. One patient with IDDM and onepatient with NIDDM who had the mutation had apparently normalglucose uptake. In findings consistent with our results, Reardonet al.14 described two patients with the mutation who had poorinsulin secretory responses to glucose. In contrast, van denOuweland et al.13 reported that insulin secretion was apparentlynormal in affected patients, suggesting the pathogenic importanceof peripheral insulin resistance. It is likely that the mechanismswhereby the mutation causes diabetes are heterogeneous.
How might this mutation cause dysfunction of pancreatic cells?Since oxidative phosphorylation in the mitochondria may havean important role in insulin secretion,10 mutant mitochondrialDNA in the pancreatic cells may interfere with the normal processof insulin secretion.
The tRNA Leu(UUR) mutation at position 3243 was originally identifiedin heteroplasmic form in patients with the MELAS syndrome17.It is noteworthy that in the families we studied some of thepatients who had the mutation had diabetes (and deafness) withoutthe MELAS syndrome and other family members with the mutationhad the MELAS syndrome without diabetes (Families 10, 12, and13). In this respect, the degree of heteroplasmy is reportedto differ in various tissues and various persons (even in asingle family)11. Thus, it is tempting to speculate that thefraction of abnormal mitochondria with the mutation is relativelyhigh in pancreatic cells, liver cells, muscle cells, or somecombination of these cells in patients with diabetes and innerve and muscle cells in patients with the MELAS syndrome.It is also possible that patients with IDDM or insulin-deficientNIDDM have a higher fraction of abnormal mitochondria in pancreatic cells than patients with NIDDM with apparently normal insulinsecretion,13 even though they share the same mutation.
Although IDDM is generally thought to be an autoimmune disorder,the mutation in the mitochondrial gene may represent anothercause of IDDM. Moreover, although IDDM and NIDDM were thoughtto be distinct clinical entities, our results suggest that acommon diabetogenic gene such as the A-to-G mutation at position3243 of mitochondrial leucine tRNA may cause either IDDM orNIDDM, indicating overlap between these two entities.
In summary, we have described a subtype of diabetes associatedwith a mutation in mitochondrial DNA in patients with eitherIDDM or NIDDM in Japan. Mutations in mitochondrial DNA suchas the A-to-G mutation at position 3243 should be consideredas a cause of (slowly progressive) IDDM and insulin-deficientNIDDM, especially in patients with sensory hearing loss or amother with diabetes.
Supported by a grant from the Juvenile Diabetes Foundation International(192125), a grant from the Ministry of Health and Welfare ofJapan, and a Diabetes Research Grant from Otsuka PharmaceuticalCompany (to Dr. T. Kadowaki).
We are indebted to Drs. Kazuki Yasuda and Simeon I. Taylor foruseful comments; to Dr. Masato Kasuga, Dr. Kinori Kosaka, Dr.Takeshi Kuzuya, Dr. Yasunori Kanazawa, Dr. Kimitaka Kaga, Dr.Makiko Kaga, and Ms. Teruko Yoshida for encouragement throughoutthe study; and to Drs. Nozomi Akashi, Takahiro Iizuka, TakashiIchiki, Jin Kaneko, Tatsuro Sato, and Kazumasa Shindo for referringpatients to the study or providing information about them.
Source Information
From the Third Department of Internal Medicine, Faculty of Medicine, University of Tokyo, Tokyo (T. Kadowaki, Y.M., K.T., H.S., T.H., Y.Y.); the Institute for Diabetes Care and Research, Asahi Life Foundation, Tokyo (H.K., R.H., Y.A.); the Division of Ultrastructural Research, National Institute of Neuroscience, Kodaira (R.S., Y.G., I.N.); Chiba Children's Hospital, Chiba (Y.T.); the Department of Endocrinology and Metabolism, Jichi Medical School, Minamikawachi (T.A.); Saiseikai Central Hospital, Tokyo (Y.S., K.M.); the First Department of Internal Medicine, Osaka University Medical School, Osaka (R.K., T. Kamada); and the National Institute of Genetics, Mishima (S.H.) -- all in Japan.
Address reprint requests to Dr. T. Kadowaki at the Third Department of Internal Medicine, Faculty of Medicine, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113, Japan.
References
Diabetes mellitus: report of a WHO Study Group. World Health Organ Tech Rep Ser 1985;727:1-113. [Medline]
Taylor SI. Molecular mechanisms of insulin resistance: lessons from patients with mutations in the insulin-receptor gene. Diabetes 1992;41:1473-1490. [Abstract]
Kadowaki T, Bevins CL, Cama A, et al. Two mutant alleles of the insulin receptor gene in a patient with extreme insulin resistance. Science 1988;240:787-790. [Free Full Text]
Bell GI, Xiang KS, Newman MV, et al. Gene for non-insulin-dependent diabetes mellitus (maturity-onset diabetes of the young subtype) is linked to DNA polymorphism on human chromosome 20q. Proc Natl Acad Sci U S A 1991;88:1484-1488. [Free Full Text]
Froguel P, Vaxillaire M, Sun F, et al. Close linkage of glucokinase locus on chromosome 7p to early-onset non-insulin-dependent diabetes mellitus. Nature 1992;356:162-164. [Erratum, Nature 1992;357:607.] [CrossRef][Medline]
Froguel P, Zouali H, Vionnet N, et al. Familial hyperglycemia due to mutations in glucokinase: definition of a subtype of diabetes mellitus. N Engl J Med 1993;328:697-702. [Free Full Text]
DeFronzo RA, Bonadonna RC, Ferrannini E. Pathogenesis of NIDDM: a balanced overview. Diabetes Care 1992;15:318-368. [Abstract]
Kadowaki T, Miyake Y, Hagura R, et al. Risk factors for worsening to diabetes in subjects with impaired glucose tolerance. Diabetologia 1984;26:44-49. [Medline]
Eto K, Sakura H, Shimokawa K, et al. Sequence variations of the glucokinase gene in Japanese subjects with NIDDM. Diabetes 1993;42:1133-1137. [Abstract]
Ashcroft FM, Ashcroft SJH. Mechanism of insulin secretion. In: Ashcroft FM, Ashcroft SJH, eds. Insulin: molecular biology to pathology. Oxford, England: Oxford University Press, 1992:97-150.
Wallace DC. Mitochondrial genetics: a paradigm for aging and degenerative diseases? Science 1992;256:628-632. [Free Full Text]
Ballinger SW, Shoffner JM, Hedaya EV, et al. Maternally transmitted diabetes and deafness associated with a 10.4 kb mitochondrial DNA deletion. Nat Genet 1992;1:11-15. [CrossRef][Medline]
van den Ouweland JMW, Lemkes HHPJ, Ruitenbeek W, et al. Mutation in mitochondrial tRNALeu(UUR) gene in a large pedigree with maternally transmitted type II diabetes mellitus and deafness. Nat Genet 1992;1:368-371. [CrossRef][Medline]
Reardon W, Ross RJM, Sweeney MG, et al. Diabetes mellitus associated with a pathogenic point mutation in mitochondrial DNA. Lancet 1992;340:1376-1379. [CrossRef][Medline]
Kadowaki H, Tobe K, Mori Y, et al. Mitochondrial gene mutation and insulin-deficient type of diabetes mellitus. Lancet 1993;341:893-894.
Chomyn A, Martinuzzi A, Yoneda M, et al. MELAS mutation in mtDNA binding site for transcription termination factor causes defects in protein synthesis and in respiration but no change in levels of upstream and downstream mature transcripts. Proc Natl Acad Sci U S A 1992;89:4221-4225. [Free Full Text]
Goto Y, Nonaka I, Horai S. A mutation in the tRNALeu(UUR) gene associated with the MELAS subgroup of mitochondrial encephalomyopathies. Nature 1990;348:651-653. [CrossRef][Medline]
Kadowaki T, Kadowaki H, Taylor SI. A nonsense mutation causing decreased levels of insulin receptor mRNA: detection by a simplified technique for direct sequencing of genomic DNA amplified by the polymerase chain reaction. Proc Natl Acad Sci U S A 1990;87:658-662. [Free Full Text]
Kawamori R, Kubota M, Ikeda M, et al. Quantitative determination of hepatic glucose uptake using an innovative approach: effect of strict glycemic regulation and exercise in diabetic subjects. J Nutr Sci Vitaminol (Tokyo) 1991;37:Suppl:S35-S42.
Kobayashi T, Itoh T, Kosaka K, Sato K, Tsuji K. Time course of islet cell antibodies and -cell function in non-insulin-dependent stage of type I diabetes. Diabetes 1987;36:510-517. [Abstract]
Sasarman, F., Antonicka, H., Shoubridge, E. A.
(2008). The A3243G tRNALeu(UUR) MELAS mutation causes amino acid misincorporation and a combined respiratory chain assembly defect partially suppressed by overexpression of EFTu and EFG2. Hum Mol Genet
17: 3697-3707
[Abstract][Full Text]
Rath, P P, Jenkins, S, Michaelides, M, Smith, A, Sweeney, M G, Davis, M B, Fitzke, F W, Bird, A C
(2008). Characterisation of the macular dystrophy in patients with the A3243G mitochondrial DNA point mutation with fundus autofluorescence. Br. J. Ophthalmol.
92: 623-629
[Abstract][Full Text]
Michaelides, M., Jenkins, S. A., Bamiou, D.-E., Sweeney, M. G., Davis, M. B., Luxon, L., Bird, A. C., Rath, P. P.
(2008). Macular Dystrophy Associated With the A3243G Mitochondrial DNA Mutation: Distinct Retinal and Associated Features, Disease Variability, and Characterization of Asymptomatic Family Members. Arch Ophthalmol
126: 320-328
[Abstract][Full Text]
Greer, D. M., Cagliero, E., Krakauer, E. L., Gonzalez, R. G., Hedley-Whyte, E. T.
(2007). Case 21-2007 -- A 58-Year-Old Woman with Headaches, Weakness, and Strokelike Episodes. NEJM
357: 164-173
[Full Text]
Sahu, R. P., Aggarwal, A., Zaidi, G., Shah, A., Modi, K., Kongara, S., Aggarwal, S., Talwar, S., Chu, S., Bhatia, V., Bhatia, E.
(2007). Etiology of Early-Onset Type 2 Diabetes in Indians: Islet Autoimmunity and Mutations in Hepatocyte Nuclear Factor 1{alpha} and Mitochondrial Gene. J. Clin. Endocrinol. Metab.
92: 2462-2467
[Abstract][Full Text]
Watanabe, R. M., Black, M. H., Xiang, A. H., Allayee, H., Lawrence, J. M., Buchanan, T. A.
(2007). Genetics of Gestational Diabetes Mellitus and Type 2 Diabetes. Diabetes Care
30: S134-S140
[Full Text]
Park, S. Y., Choi, G. H., Choi, H. I., Ryu, J., Jung, C. Y., Lee, W.
(2005). Depletion of Mitochondrial DNA Causes Impaired Glucose Utilization and Insulin Resistance in L6 GLUT4myc Myocytes. J. Biol. Chem.
280: 9855-9864
[Abstract][Full Text]
ROY, M. D., WITTENHAGEN, L. M., KELLEY, S. O.
(2005). Structural probing of a pathogenic tRNA dimer. RNA
11: 254-260
[Abstract][Full Text]
Li, N., Wang, Q., Li, J., Wang, X., Hellmich, M. R., Rajaraman, S., Greeley, G. H. Jr., Townsend, C. M. Jr., Evers, B. M.
(2005). Inhibition of mitochondrial gene transcription suppresses neurotensin secretion in the human carcinoid cell line BON. Am. J. Physiol. Gastrointest. Liver Physiol.
288: G213-G220
[Abstract][Full Text]
Mauvais-Jarvis, F., Smith, S. B., May, C. L., Leal, S. M., Gautier, J.-F., Molokhia, M., Riveline, J.-P., Rajan, A. S., Kevorkian, J.-P., Zhang, S., Vexiau, P., German, M. S., Vaisse, C.
(2004). PAX4 gene variations predispose to ketosis-prone diabetes. Hum Mol Genet
13: 3151-3159
[Abstract][Full Text]
Urata, M., Wada, Y., Kim, S. H., Chumpia, W., Kayamori, Y., Hamasaki, N., Kang, D.
(2004). High-Sensitivity Detection of the A3243G Mutation of Mitochondrial DNA by a Combination of Allele-Specific PCR and Peptide Nucleic Acid-Directed PCR Clamping. Clin. Chem.
50: 2045-2051
[Abstract][Full Text]
Bouche, C., Serdy, S., Kahn, C. R., Goldfine, A. B.
(2004). The Cellular Fate of Glucose and Its Relevance in Type 2 Diabetes. Endocr. Rev.
25: 807-830
[Abstract][Full Text]
Fukushima, K., Fiocchi, C.
(2004). Paradoxical decrease of mitochondrial DNA deletions in epithelial cells of active ulcerative colitis patients. Am. J. Physiol. Gastrointest. Liver Physiol.
286: G804-G813
[Abstract][Full Text]
McCarthy, M. I.
(2004). Progress in defining the molecular basis of type 2 diabetes mellitus through susceptibility-gene identification. Hum Mol Genet
13: R33-R41
[Abstract][Full Text]
Inoue, K., Ikegami, H., Fujisawa, T., Kawabata, Y., Shintani, M., Nijima, K., Masaya, O., Nishino, M., Itoi-babaya, M., Babaya, N., Ogihara, T.
(2003). High Degree of Mitochondrial 3243 Mutation in Gastric Biopsy Specimen in a Patient With MELAS and Diabetes Complicated by Marked Gastrointestinal Abnormalities. Diabetes Care
26: 2219-2219
[Full Text]
DiMauro, S., Schon, E. A.
(2003). Mitochondrial Respiratory-Chain Diseases. NEJM
348: 2656-2668
[Full Text]
Kulkarni, R. N., Almind, K., Goren, H. J., Winnay, J. N., Ueki, K., Okada, T., Kahn, C. R.
(2003). Impact of Genetic Background on Development of Hyperinsulinemia and Diabetes in Insulin Receptor/Insulin Receptor Substrate-1 Double Heterozygous Mice. Diabetes
52: 1528-1534
[Abstract][Full Text]
Suzuki, Y., Taniyama, M., Muramatsu, T., Ohta, S., Murata, C., Atsumi, Y., Matsuoka, K.
(2003). Mitochondrial tRNALeu(UUR) Mutation at Position 3243 and Symptomatic Polyneuropathy in Type 2 Diabetes. Diabetes Care
26: 1315-1316
[Full Text]
Silveiro, S. P., Canani, L. H., Maia, A. L., Butany, J. W., Gross, J. L.
(2003). Myocardial Dysfunction in Maternally Inherited Diabetes and Deafness. Diabetes Care
26: 1323-1324
[Full Text]
(2003). Report of the Expert Committee on the Diagnosis and Classification of Diabetes Mellitus. Diabetes Care
26: s5-20
[Full Text]
Momiyama, Y., Suzuki, Y., Ohtomo, M., Atsumi, Y., Matsuoka, K., Ohsuzu, F., Kimura, M.
(2002). Cardiac Autonomic Nervous Dysfunction in Diabetic Patients With a Mitochondrial DNA Mutation: Assessment by heart rate variability. Diabetes Care
25: 2308-2313
[Abstract][Full Text]
Noda, M., Yamashita, S., Takahashi, N., Eto, K., Shen, L.-M., Izumi, K., Daniel, S., Tsubamoto, Y., Nemoto, T., Iino, M., Kasai, H., Sharp, G. W. G., Kadowaki, T.
(2002). Switch to Anaerobic Glucose Metabolism with NADH Accumulation in the beta -Cell Model of Mitochondrial Diabetes. CHARACTERISTICS OF beta HC9 CELLS DEFICIENT IN MITOCHONDRIAL DNA TRANSCRIPTION. J. Biol. Chem.
277: 41817-41826
[Abstract][Full Text]
McCarthy, M. I., Froguel, P.
(2002). Genetic approaches to the molecular understanding of type 2 diabetes. Am. J. Physiol. Endocrinol. Metab.
283: E217-E225
[Abstract][Full Text]
Elbein, S. C.
(2002). Perspective: The Search for Genes for Type 2 Diabetes in the Post-Genome Era. Endocrinology
143: 2012-2018
[Abstract][Full Text]
Mori, Y., Otabe, S., Dina, C., Yasuda, K., Populaire, C., Lecoeur, C., Vatin, V., Durand, E., Hara, K., Okada, T., Tobe, K., Boutin, P., Kadowaki, T., Froguel, P.
(2002). Genome-Wide Search for Type 2 Diabetes in Japanese Affected Sib-Pairs Confirms Susceptibility Genes on 3q, 15q, and 20q and Identifies Two New Candidate Loci on 7p and 11p. Diabetes
51: 1247-1255
[Abstract][Full Text]
Shanske, A. L., Shanske, S., DiMauro, S.
(2001). The Other Human Genome. Arch Pediatr Adolesc Med
155: 1210-1216
[Abstract][Full Text]
Ohkubo, K., Yamano, A., Nagashima, M., Mori, Y., Anzai, K., Akehi, Y., Nomiyama, R., Asano, T., Urae, A., Ono, J.
(2001). Mitochondrial Gene Mutations in the tRNALeu(UUR) Region and Diabetes: Prevalence and Clinical Phenotypes in Japan. Clin. Chem.
47: 1641-1648
[Abstract][Full Text]
Guttman, A., Gao, H.-G., Haas, R.
(2001). Rapid Analysis of Mitochondrial DNA Heteroplasmy in Diabetes by Gel-Microchip Electrophoresis. Clin. Chem.
47: 1469-1472
[Full Text]
Brandle, M., Lehmann, R., Maly, F. E., Schmid, C., Spinas, G. A.
(2001). Diminished Insulin Secretory Response to Glucose but Normal Insulin and Glucagon Secretory Responses to Arginine in a Family With Maternally Inherited Diabetes and Deafness Caused by Mitochondrial tRNALEU(UUR) Gene Mutation. Diabetes Care
24: 1253-1258
[Abstract][Full Text]
Park, K.-S., Nam, K.-J., Kim, J.-W., Lee, Y.-B., Han, C.-Y., Jeong, J.-K., Lee, H.-K., Pak, Y. K.
(2001). Depletion of mitochondrial DNA alters glucose metabolism in SK-Hep1 cells. Am. J. Physiol. Endocrinol. Metab.
280: E1007-E1014
[Abstract][Full Text]
Song, J., Oh, J. Y., Sung, Y.-A., Pak, Y. K., Park, K. S., Lee, H. K.
(2001). Peripheral Blood Mitochondrial DNA Content Is Related to Insulin Sensitivity in Offspring of Type 2 Diabetic Patients. Diabetes Care
24: 865-869
[Abstract][Full Text]
Guillausseau, P.-J., Massin, P., Dubois-LaForgue, D., Timsit, J., Virally, M., Gin, H., Bertin, E., Blickle, J.-F., Bouhanick, B., Cahen, J., Caillat-Zucman, S., Charpentier, G., Chedin, P., Derrien, C., Ducluzeau, P.-H., Grimaldi, A., Guerci, B., Kaloustian, E., Murat, A., Olivier, F., Paques, M., Paquis-Flucklinger, V., Porokhov, B., Samuel-Lajeunesse, J., Vialettes, B.
(2001). Maternally Inherited Diabetes and Deafness: A Multicenter Study. ANN INTERN MED
134: 721-728
[Abstract][Full Text]
Fischel-Ghodsian, N.
(2001). Mitochondrial DNA Mutations and Diabetes: Another Step toward Individualized Medicine. ANN INTERN MED
134: 777-779
[Full Text]
Walston, J., Silver, K., Hilfiker, H., Andersen, R. E., Seibert, M., Beamer, B., Roth, J., Poehlman, E., Shuldiner, A. R.
(2000). Insulin Response to Glucose Is Lower in Individuals Homozygous for the Arg 64 Variant of the {beta}-3-Adrenergic Receptor. J. Clin. Endocrinol. Metab.
85: 4019-4022
[Abstract][Full Text]
Balestri, P., Grosso, S.
(2000). Endocrine Disorders in Two Sisters Affected by MELAS Syndrome. J Child Neurol
15: 755-758
[Abstract]
Yamagata, K., Tomida, C., Umeyama, K., Urakami, K.-i., Ishizu, T., Hirayama, K., Gotoh, M., Iitsuka, T., Takemura, K., Kikuchi, H., Nakamura, H., Kobayashi, M., Koyama, A.
(2000). Prevalence of Japanese dialysis patients with an A-to-G mutation at nucleotide 3243 of the mitochondrial tRNALeu(UUR) gene. Nephrol Dial Transplant
15: 385-388
[Abstract][Full Text]
Uusimaa, J., Remes, A. M., Rantala, H., Vainionpää, L., Herva, R., Vuopala, K., Nuutinen, M., Majamaa, K., Hassinen, I. E.
(2000). Childhood Encephalopathies and Myopathies: A Prospective Study in a Defined Population to Assess the Frequency of Mitochondrial Disorders. Pediatrics
105: 598-603
[Abstract][Full Text]
Yasukawa, T., Suzuki, T., Suzuki, T., Ueda, T., Ohta, S., Watanabe, K.
(2000). Modification Defect at Anticodon Wobble Nucleotide of Mitochondrial tRNAsLeu(UUR) with Pathogenic Mutations of Mitochondrial Myopathy, Encephalopathy, Lactic Acidosis, and Stroke-like Episodes. J. Biol. Chem.
275: 4251-4257
[Abstract][Full Text]
Usami, S.-i., Abe, S., Akita, J., Namba, A., Shinkawa, H., Ishii, M., Iwasaki, S., Hoshino, T., Ito, J., Doi, K., Kubo, T., Nakagawa, T., Komiyama, S., Tono, T., Komune, S.
(2000). Prevalence of mitochondrial gene mutations among hearing impaired patients. J. Med. Genet.
37: 38-40
[Abstract][Full Text]
Taylor,
(1999). Genetically Defined Forms of Diabetes in Children. J. Clin. Endocrinol. Metab.
84: 4390-4396
[Full Text]
Janssen, G. M. C., Maassen, J. A., van den Ouweland, J. M. W.
(1999). The Diabetes-associated 3243 Mutation in the Mitochondrial tRNALeu(UUR) Gene Causes Severe Mitochondrial Dysfunction without a Strong Decrease in Protein Synthesis Rate. J. Biol. Chem.
274: 29744-29748
[Abstract][Full Text]
Eto, K., Suga, S., Wakui, M., Tsubamoto, Y., Terauchi, Y., Taka, J., Aizawa, S., Noda, M., Kimura, S., Kasai, H., Kadowaki, T.
(1999). NADH Shuttle System Regulates KATP Channel-dependent Pathway and Steps Distal to Cytosolic Ca2+ Concentration Elevation in Glucose-induced Insulin Secretion. J. Biol. Chem.
274: 25386-25392
[Abstract][Full Text]
Berneburg, M., Grether-Beck, S., Kurten, V., Ruzicka, T., Briviba, K., Sies, H., Krutmann, J.
(1999). Singlet Oxygen Mediates the UVA-induced Generation of the Photoaging-associated Mitochondrial Common Deletion. J. Biol. Chem.
274: 15345-15349
[Abstract][Full Text]
Momiyama, Y., Suzuki, Y., Ohsuzu, F., Atsumi, Y., Matsuoka, K., Kimura, M.
(1999). Maternally transmitted susceptibility to non-insulin-dependent diabetes mellitus and left ventricular hypertrophy. J Am Coll Cardiol
33: 1372-1378
[Abstract][Full Text]
Urata, M., Wakiyama, M., Iwase, M., Yoneda, M., Kinoshita, S., Hamasaki, N., Kang, D.
(1998). New sensitive method for the detection of the A3243G mutation of human mitochondrial deoxyribonucleic acid in diabetes mellitus patients by ligation-mediated polymerase chain reaction. Clin. Chem.
44: 2088-2093
[Abstract][Full Text]
Hayakawa, T., Noda, M., Yasuda, K., Yorifuji, H., Taniguchi, S., Miwa, I., Sakura, H., Terauchi, Y., Hayashi, J.-i., Sharp, G. W. G., Kanazawa, Y., Akanuma, Y., Yazaki, Y., Kadowaki, T.
(1998). Ethidium Bromide-induced Inhibition of Mitochondrial Gene Transcription Suppresses Glucose-stimulated Insulin Release in the Mouse Pancreatic beta -Cell Line beta HC9. J. Biol. Chem.
273: 20300-20307
[Abstract][Full Text]
Hirai, M., Suzuki, S., Onoda, M., Hinokio, Y., Hirai, A., Ohtomo, M., Chiba, M., Kasuga, S., Hirai, S., Satoh, Y., Akai, H., Miyabayashi, S., Toyota, T.
(1998). Mitochondrial Deoxyribonucleic Acid 3256C-T Mutation in a Japanese Family with Noninsulin-Dependent Diabetes Mellitus. J. Clin. Endocrinol. Metab.
83: 992-994
[Abstract][Full Text]
Dimauro, S., Schon, E. A.
(1998). Mitochondrial DNA and Diseases of the Nervous System: The Spectrum. Neuroscientist
4: 53-63
[Abstract]
Dagogo-Jack, S., Santiago, J. V.
(1997). Pathophysiology of Type 2 Diabetes and Modes of Action of Therapeutic Interventions. Arch Intern Med
157: 1802-1817
[Abstract]
Smith, M. L., Hua, X.-Y., Marsden, D. L., Liu, D., Kennaway, N. G., Ngo, K.-Y., Haas, R. H.
(1997). Diabetes and Mitochondrial Encephalomyopathy with Lactic Acidosis and Stroke-Like Episodes (MELAS): Radiolabeled Polymerase Chain Reaction Is Necessary for Accurate Detection of Low Percentages of Mutation. J. Clin. Endocrinol. Metab.
82: 2826-2831
[Abstract][Full Text]
Urhammer, S. A., Hansen, T., Jensen, L. B., O. Clausen, J., Hansen, L., Chui, K. C., Pedersen, O.
(1997). Studies of the Impact of a Liver Glucokinase Promoter Variant on Glucose Tolerance and Insulin Sensitivity Index. J. Clin. Endocrinol. Metab.
82: 1786-1789
[Abstract][Full Text]
Lee, H. c., Song, Y. d., Li, H.-R., Park, J. o., Suh, H. c., Lee, E., Lim, S., Kim, K., Huh, K.
(1997). Mitochondrial Gene Transfer Ribonucleic Acid (tRNA)Leu(UUR) 3243 and tRNALys 8344 Mutations and Diabetes Mellitus in Korea. J. Clin. Endocrinol. Metab.
82: 372-374
[Abstract][Full Text]
Soejima, A., Inoue, K., Takai, D., Kaneko, M., Ishihara, H., Oka, Y., Hayashi, J.-I.
(1996). Mitochondrial DNA Is Required for Regulation of Glucose-stimulated Insulin Secretion in a Mouse Pancreatic Beta Cell Line, MIN6. J. Biol. Chem.
271: 26194-26199
[Abstract][Full Text]
Cooke, C. E., Greenberg, M. D., Coughlin, S. S., Mishark, K., Odawara, M., Yamashita, K., Legha, S. S., Dec, G.W., Fuster, V.
(1995). Idiopathic Dilated Cardiomyopathy. NEJM
332: 1384-1386
[Full Text]
cells in IDDM and mutations in the insulin gene, the insulin-receptor gene,2,3 a gene linked to the adenosine deaminase gene on chromosome 20,4 and the glucokinase gene5,6 in NIDDM. Although defects in both glucose-induced insulin secretion and peripheral insulin sensitivity are generally thought to contribute to the pathogenesis of NIDDM,7 many patients with NIDDM in Japan have decreased insulin responses to glucose even during the preclinical period8; however, the prevalence of mutations in the glucokinase gene appears to be low9. Mitochondrial genes are plausible causative agents of both IDDM and NIDDM, since it has been suggested that oxidative phosphorylation in the mitochondria has a crucial role in the secretion of insulin by pancreatic 
Previous
