The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
Original Article
Brief Report
PreviousPrevious
Volume 330:1276-1278 May 5, 1994 Number 18
NextNext

Molecular Biology and the Early Detection of Carcinoma of the Bladder -- The Case of Hubert H. Humphrey
Ralph H. Hruban, Peter van der Riet, Yener S. Erozan, and David Sidransky

 

Commentary
-Letters

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation
Approximately 52,300 new cases of carcinoma of the bladder were diagnosed in the United States in 19931. These carcinomas struck primarily older men, who often presented with hematuria or increased frequency of urination. Patients whose cancers are detected in an early, localized stage have a 90 percent chance of surviving at least five years. If the cancer is detected after distant spread of the disease, however, the five-year survival rate drops to 9 percent1. Clearly, techniques for the early detection of carcinoma of the bladder can have a major impact on the outcome of the disease2.

Cytologic examination of urine was introduced by Papanicolaou and Marshall in 1945, and it has been successfully used to screen for carcinoma of the bladder3. Although it can detect some preclinical cancers, urinary cytologic examination has a number of limitations. False negative results can be obtained when the specimens are scanty, when the tumors are low grade, and when diagnostic cells are masked by larger numbers of non-neoplastic cells3,4,5,6,7. Furthermore, the success of the technique depends heavily on the expertise of the cytopathologist.

Many of the shortcomings of urinary cytologic examination can be overcome with molecular biologic techniques, particularly the polymerase chain reaction (PCR). Because of their remarkable sensitivity, PCR-based techniques have been used to detect exfoliated neoplastic cells in the stool of patients with colorectal neoplasms8; in the sputum of patients with lung cancer9; in the blood, bile, and stool of patients with pancreatic cancer10,11 (and Caldas C: unpublished data); and in the urine of patients with bladder cancer12. We applied one of these PCR-based techniques to archival tissue from the late Hubert H. Humphrey12.

Case Report

To understand why we chose Humphrey as an example, one must be familiar with his medical history13,14,15,16,17. In May 1967, while he was vice president of the United States, he was admitted to Bethesda Naval Hospital for hematuria. Voided urine specimens were obtained for cytologic examination, and cystoscopy was performed. The condition of his bladder was found to be grossly consistent with chronic proliferative cystitis, and a biopsy revealed only a minute focus of dysplastic change in the transitional epithelium. No cancer was identified grossly by inspection or in the biopsy specimens that were taken. A number of pathologists reviewed the urine-cytology slides (Figure 1), among them Dr. John K. Frost, director of cytopathology at Johns Hopkins Hospital. Frost believed that the cytology slides were, in fact, diagnostic of carcinoma. Other experts apparently did not agree, and a definitive diagnosis was not established. Humphrey was therefore followed with cystoscopy every six months13. A biopsy revealed in situ carcinoma in 1969, but he was asymptomatic until four years later. In 1973 a biopsy of his prostatic urethra revealed a "borderline malignancy" (in situ transitional-cell carcinoma with a small focus of probable microinvasive cancer), for which he received both radiation therapy and intravesicular thiotepa13. In August 1976 recurrent hematuria developed, and a biopsy led to the diagnosis of infiltrating carcinoma of the bladder. A radical cystectomy was performed, revealing widely infiltrative transitional-cell carcinoma of the bladder with lymph-node metastases16,18,19. Humphrey died of the cancer on January 13, 1978.


View larger version (13K):
[in this window]
[in a new window]
 
Figure 1. Urine Specimen Revealing Inflammatory Cells and Poorly Preserved Atypical Epithelial Cells.

The epithelial cells are characterized by enlarged, hyperchromatic nuclei and scanty-to-moderate amounts of cytoplasm. Some nuclei have characteristic features of malignancy, including irregular thickening and thinning of the chromatinic rim and uneven clumping of chromatin with sharp angulations. Prominent nucleoli were also present in other nuclei. (Papanicolaou stain, x1300.).

 
Methods

With the permission of Humphrey's widow, we obtained the formalin-fixed, paraffin-embedded tissue blocks of the infiltrating bladder cancer resected from Humphrey in 1976 and screened the cancer for mutations in the p53 tumor-suppressor gene20. Five-microm sections of this primary carcinoma were microdissected to enrich for neoplastic cells, and exons 5 to 9 of the p53 gene were amplified by PCR12. The PCR products were then isolated and subcloned into bacteriophages, and more than 500 pooled clones were sequenced,12 revealing a transversion from adenine to thymine in codon 227 of the p53 gene in the primary carcinoma.

Next, we obtained two of the Papanicolaou-stained filters (Millipore, Bedford, Mass.) that had been prepared with Humphrey's urine when he presented in May 1967. We isolated DNA from these filters and amplified by PCR a region of 104 base pairs encompassing codon 227 of the p53 gene. The amplification primers for this portion of exon 7 of the p53 gene were 5'GTAGGAATTCCAAGGCGCACTGGCCTC3' and 5'AGGAATTCTTACACATGTAGTTGTAGTGG3'. The PCR conditions and the methods used for cloning into lambda Zap (Strategene, La Jolla, Calif.) were performed as previously described12. We then cloned the PCR products into the bacteriophage vector, transferred them to nylon membranes, and hybridized them with a 32P-labeled oligonucleotide probe (5'GTTGGCTCAGACTGTACC3') specific for the codon 227 mutation found in the resected primary carcinoma12.

Results

Both the invasive bladder carcinoma resected in 1976 and the filters prepared from urine in 1967 were analyzed for p53 mutations. Sequencing of pooled clones of DNA from the cancer resected in 1976 revealed a transversion from adenine to thymine in codon 227 of the p53 gene (Figure 2A). This mutation creates a cryptic splice site in exon 7 of the p53 gene21. Normal splicing of introns permits the correct assembly of exons and the production of a full-sized, functional protein. The hidden splice site created by the mutation in codon 227 results in the loss of several amino acids and in the production of a shortened, mutant p53 protein. This mutation was not present in non-neoplastic tissue obtained from the muscularis propria of Humphrey's resected bladder.


View larger version (11K):
[in this window]
[in a new window]
 
Figure 2. Autoradiographs of Tumor and Urine Specimens.

Panel A shows an autoradiograph of sequencing gel demonstrating an A-to-T (antisense) transversion at codon 227 (arrow) of the p53 gene in Humphrey's primary bladder carcinoma. The residual band in the first lane is from wild-type non-neoplastic DNA. Panel B shows autoradiographs of bacteriophage plaques hybridized to specific p53 oligomers. Many hybridizing plaques were seen when cloned DNA from Humphrey's urine was probed with a wild-type p53 oligomer. A smaller but noteworthy number of plaques from the urine DNA hybridized to the codon 227 mutant-specific oligomer, but not to control DNA without a p53 mutation.

 
Once we had identified the p53 mutation in the resected bladder cancer, we could then probe the 1967 urine specimen for cells harboring the same mutation. A probe specific for the codon 227 mutation was synthesized and used to test clones of DNA from the 1967 filter preparations of urine. Hybridization was detected in 9 percent of the clones (Figure 2B), indicating that a number of cells in Humphrey's urine in May 1967 harbored the same mutation in p53 that was present in the resected primary carcinoma in 1976. Remarkably, the cells harboring p53 mutations in his urine were detectable nine years before Humphrey underwent cystectomy, six years before he received any therapy for bladder disease, two years before a diagnosis of in situ carcinoma was established by biopsy, and at a time when cancer could not be identified grossly in his bladder13.

Discussion

The detection of cells harboring a p53 mutation in Humphrey's urine-cytology specimen from May 1967 has a number of implications. First, although clonal p53 mutations have not been identified in non-neoplastic urothelium, they have been found in approximately 60 percent of bladder carcinomas12,22,23,24. In addition, the mutation in the DNA obtained from Humphrey's urine-cytology specimen was the same as the one identified in his primary carcinoma. These observations suggest that the neoplasm was already present in May 1967. Second, the presence of cells harboring p53 mutations in the urine suggests that, if the importance of the mutation had been known in 1967 and the technology described here had been available, Humphrey's neoplasm could have been detected then. Third, p53 mutations and the associated overexpression of the p53 gene product are generally, but not universally, associated with in situ lesions that tend to progress and with high-grade or advanced-stage carcinomas12,25,26,27,28,29,30. This raises the possibility that Humphrey's neoplasm was already in a phase of aggressive growth in 1967. Had Humphrey known that he had aggressive bladder cancer in 1967, he might have withdrawn from the presidential race14. More important, he and his physicians might have opted for more aggressive, and potentially lifesaving, surgery years earlier.

Although the case presented here is quite dramatic, the techniques we used may not be ideal for screening the general population for bladder cancer. First, p53 mutations may occur late in the course of some bladder cancers12,25,26,27,28,29,30. Second, mutations in p53 are not limited to a single codon, but can involve a number of different sites in the gene, making screening tests based on the detection of p53 mutations technically challenging. Third, approximately 40 percent of bladder cancers do not harbor p53 mutations, and such cancers would not be detected with these techniques. Despite these limitations, the success of PCR-based techniques in this case reinforces the recognition of their powerful potential for the early detection of cancer. For this potential to be fully realized, further studies must define the molecular events responsible for the development of carcinoma of the bladder. The identification of a putative tumor-suppressor gene on chromosome 9 may provide a better molecular test for the early detection of this neoplasm31,32,33,34,35.

Supported in part by a collaborative research arrangement with Oncor, Inc., Gaithersburg, Md.

We are indebted to Shirley Myers, Norman Barker, Claire E. Hruban, Dr. Victor Reuter, Dr. Ted Ganster, Charles Desaulniers of the Millipore Corporation, and Muriel Humphrey-Brown for their assistance.


Source Information

From the Departments of Pathology (R.H.H., Y.S.E.) and Otolaryngology-Head and Neck Surgery (R.H.H., P.R., D.S.), Johns Hopkins Medical Institutions, Baltimore. Presented in part at the annual meeting of the U.S. and Canadian Academy of Pathology, San Francisco, March 16, 1994.

Address reprint requests to Dr. Sidransky at the Department of Otolaryngology-Head and Neck Surgery, 818 Ross Research Bldg., 720 Rutland Ave., Baltimore, MD 21205-2195.

References

  1. Boring CC, Squires TS, Tong T. Cancer statistics, 1993. CA Cancer J Clin 1993;43:7-26. [Medline]
  2. Hopkins SC, Ford KS, Soloway MS. Invasive bladder cancer: support for screening. J Urol 1983;130:61-64. [Medline]
  3. Papanicolaou GN, Marshall VF. Urine sediment smears as a diagnostic procedure in cancers of the urinary tract. Science 1945;101:519-520. [Free Full Text]
  4. Farrow GM, Utz DC, Rife CC. Morphological and clinical observations of patients with early bladder cancer treated with total cystectomy. Cancer Res 1976;36:2495-2501. [Medline]
  5. Murphy WM, Soloway MS, Jukkola AF, Crabtree WN, Ford KS. Urinary cytology and bladder cancer: the cellular features of transitional cell neoplasms. Cancer 1984;53:1555-1565. [CrossRef][Medline]
  6. Sarnacki CT, McCormack LJ, Kiser WS, Hazard JB, McLaughlin TC, Belovich DM. Urinary cytology and the clinical diagnosis of urinary tract malignancy: a clinicopathologic study of 1,400 patients. J Urol 1971;106:761-764. [Medline]
  7. El-Bolkainy MN. Cytology of bladder carcinoma. J Urol 1980;124:20-22. [Medline]
  8. Sidransky D, Tokino T, Hamilton SR, et al. Identification of ras oncogene mutations in the stool of patients with curable colorectal tumors. Science 1992;256:102-105. [Free Full Text]
  9. Mao L, Hruban RH, Boyle JO, Tockman M, Sidransky D. Detection of oncogene mutations in sputum precedes diagnosis of lung cancer. Cancer Res 1994;54:1634-1637. [Free Full Text]
  10. Sorenson GD, Pribish DM, Valone FH, Memoli VA, Bzik DJ, Yao S-L. Soluble normal and mutated DNA sequences from single-copy genes in human blood. Cancer Epidemiol Biomarkers Prev 1994;3:67-71. [Abstract]
  11. Tada M, Omata M, Kawai S, et al. Detection of ras gene mutations in pancreatic juice and peripheral blood of patients with pancreatic adenocarcinoma. Cancer Res 1993;53:2472-2474. [Free Full Text]
  12. Sidransky D, Von Eschenbach A, Tsai YC, et al. Identification of p53 gene mutations in bladder cancers and urine samples. Science 1991;252:706-709. [Free Full Text]
  13. Berman E. Hubert: the triumph and tragedy of the Humphrey I knew. New York: G.P. Putnam, 1979.
  14. Cohn V. We must know about our leader's health. Washington Post. March 26, 1978:C1.
  15. Solberg C. Hubert Humphrey: a biography. New York: W.W. Norton, 1984.
  16. Clark M, Shapiro D. Humphrey's operation. Newsweek. October 18, 1976:87.
  17. H.H.H.'s cystectomy. Time. October 18, 1976:100-2.
  18. Humphrey's bladder wall penetrated by cancer. New York Times. October 16, 1976:6.
  19. Brody JE. Humphrey's bladder removed in surgery. New York Times. October 8, 1976:I11.
  20. Hollstein M, Sidransky D, Vogelstein B, Harris CC. p53 Mutations in human cancers. Science 1991;253:49-53. [Free Full Text]
  21. Senapathy P, Shapiro MB, Harris NL. Splice junctions, branch point sites, and exons: sequence statistics, identification, and applications to genome project. Methods Enzymol 1990;183:252-278. [Medline]
  22. Fujimoto K, Yamada Y, Okajima E, et al. Frequent association of p53 gene mutation in invasive bladder cancer. Cancer Res 1992;52:1393-1398. [Free Full Text]
  23. Oka K, Ishikawa J, Bruner JM, Takahashi R, Saya H. Detection of loss of heterozygosity in the p53 gene in renal cell carcinoma and bladder cancer using the polymerase chain reaction. Mol Carcinog 1991;4:10-13. [Medline]
  24. Spruck CH III, Rideout WM III, Olumi AF, et al. Distinct pattern of p53 mutations in bladder cancer: relationship to tobacco usage. Cancer Res 1993;53:1162-1166. [Erratum, Cancer Res 1993;53:Suppl:2427.] [Free Full Text]
  25. Habuchi T, Ogawa O, Kakehi Y, et al. Allelic loss of chromosome 17p in urothelial cancer: strong association with invasive phenotype. J Urol 1992;148:1595-1599. [Medline]
  26. Olumi AF, Tsai YC, Nichols PW, et al. Allelic loss of chromosome 17p distinguishes high grade from low grade transitional cell carcinomas of the bladder. Cancer Res 1990;50:7081-7083. [Free Full Text]
  27. Sarkis AS, Dalbagni G, Cordon-Cardo C, et al. Nuclear overexpression of p53 protein in transitional cell bladder carcinoma: a marker for disease progression. J Natl Cancer Inst 1993;85:53-59. [Free Full Text]
  28. Spruck CH III, Ohneseit PF, Gonzalez-Zulueta M, et al. Two molecular pathways to transitional cell carcinoma of the bladder. Cancer Res 1994;54:784-788. [Free Full Text]
  29. Baker SJ, Preisinger AC, Jessup JM, et al. p53 Gene mutations occur in combination with 17p allelic deletions as late events in colorectal tumorigenesis. Cancer Res 1990;50:7717-7722. [Free Full Text]
  30. Sarkis AS, Zhang ZF, Cordon-Cardo C, et al. p53 Nuclear overexpression and disease in TA-bladder carcinoma. Int J Oncol 1993;3:355-360.
  31. Tsai YC, Nichols PW, Hiti AL, Williams Z, Skinner DG, Jones PA. Allelic losses of chromosomes 9, 11, and 17 in human bladder cancer. Cancer Res 1990;50:44-47. [Free Full Text]
  32. Sidransky D, Frost P, Von Eschenbach A, Oyasu R, Preisinger AC, Vogelstein B. Clonal origin of bladder cancer. N Engl J Med 1992;326:737-740. [Abstract]
  33. Cairns P, Shaw ME, Knowles MA. Initiation of bladder cancer may involve deletion of a tumour-suppressor gene on chromosome 9. Oncogene 1993;8:1083-1085. [Medline]
  34. Ruppert JM, Tokino K, Sidransky D. Evidence for two bladder cancer suppressor loci on human chromosome 9. Cancer Res 1993;53:5093-5095. [Free Full Text]
  35. Cairns P, Tokino K, Eby Y, Sidransky D. Homozygous deletions of 9p21 in primary human bladder tumors detected by comparative multiplex polymerase chain reaction. Cancer Res 1994;54:1422-1424. [Free Full Text]

 

Commentary
-Letters

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation

Related Letters:

Hubert Humphrey's Bladder Cancer
Homer R. J., Braund W.J., Hruban R. H., van der Riet P., Sidransky D.
Extract | Full Text  
N Engl J Med 1994; 331:880-881, Sep 29, 1994. Correspondence

This article has been cited by other articles:



HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2008 Massachusetts Medical Society. All rights reserved.