Background The renin-angiotensin system is a powerful pressorsystem with a major influence on salt and water homeostasis.Angiotensinogen (also called renin substrate) is a key componentof this system; it is cleaved by renin to yield angiotensinI, which is then cleaved by angiotensin-converting enzyme toyield angiotensin II. The observation that plasma angiotensinogenlevels correlate with blood pressure and track through familiessuggests that angiotensinogen may have a role in essential hypertension.We therefore investigated whether there is linkage between theangiotensinogen gene on chromosome 1q42-43 and essential hypertension.
Methods Samples of DNA from 63 white European families in whichtwo or more members had essential hypertension were tested forlinkage of the angiotensinogen gene to this disorder. Affectedcousins, nephews, nieces, and half-siblings were included whenpossible. To test for linkage, we used as a marker a dinucleotide-repeatsequence flanking this gene, and we employed the affected-pedigree-membermethod of linkage analysis. Two molecular variants of the angiotensinogengene, one encoding threonine instead of methionine at position235 (M235T) and the other encoding methionine rather than threonineat position 174 (T174M), were also tested for possible associationwith essential hypertension.
Results We found significant linkage (t = 5.00, P<0.001)and association (chi-square = 53.3, P<0.001) of the angiotensinogen-genelocus to essential hypertension in the 63 multiplex families.This linkage was consistently maintained in the subgroup ofsubjects with diastolic pressure above 100 mm Hg and in thesubgroups classified according to sex. It has been proposedpreviously that T174M and M235T are associated with essentialhypertension. However, we found no association in our populationbetween either polymorphism and this disorder.
Conclusions This study provides strong and consistent supportfor the linkage to essential hypertension of regions withinor close to the angiotensinogen gene. Precisely how mutationsin this region may result in hypertension remains to be determined.
Essential hypertension represents the upper quintile of theblood-pressure distribution in the general population and isa major risk factor for morbidity and mortality from cardiovascularcauses1. The causes of essential hypertension, which accountsfor 90 percent of high blood pressure, have not yet been determined.Studies of families and twins imply that 20 to 40 percent ofessential hypertension may have a genetic basis2. Epidemiologicstudies indicate a continuous distribution of blood pressurein the population, and the genetic basis of this disorder appearsto be polygenic and therefore does not follow simple mendelianpatterns of inheritance3. It is likely that several genes interactwith environmental stimuli to produce high blood pressure insusceptible persons4.
The renin-angiotensin system influences vascular tone, cardiovascularremodeling, and salt and water homeostasis, and this systemis closely involved in the physiologic regulation of blood pressure5.For these reasons, genes encoding components of this systemare attractive candidates for the investigation of the geneticbasis of essential hypertension. The angiotensinogen gene hasrecently been linked to essential hypertension in affected sibships6.In study populations from France and Utah, 15 DNA polymorphismsof differing frequency were identified in this gene. Two ofthem within exon 2 -- one with threonine instead of methionineat position 235 (M235T) and one with methionine rather thanthreonine at position 174 (T174M) -- were found to be significantlyassociated with hypertension6.
In the investigation of the genetic basis of polygenic disorders,it is critical to be able to substantiate the linkage of candidategenes or markers in pairs of affected relatives in differentpopulations7. We sought to determine whether there was linkageof the angiotensinogen gene to essential hypertension in affectedwhite European families from the United Kingdom. We also setout to develop a simple, reproducible method for analyzing theangiotensinogen-gene variants M235T and T174M and testing whetherthey are associated with hypertension in this population.
Methods
Multiplex Families with Hypertension and Controls
After ethical approval was given in 1990, 63 families containingtwo or more members with essential hypertension were identifiedat the hypertension clinic of St. Bartholomew's Hospital andthree primary care clinics in southeast England. All the subjectswere white Europeans, had begun to have hypertension beforethe age of 60 years, and had had diastolic pressures above 95mm Hg on three occasions or were being treated for essentialhypertension. After the identification of the proband, a familyhistory was taken, and only affected relatives as defined bythe above criteria were studied. To maximize genetic informativeness,affected cousins, nieces, nephews, and half-siblings were includedwhenever possible. Hence, these affected relatives form "multiplex"families rather than simply affected sibling pairs. Familiesin which any member had secondary hypertension as defined byclinical evidence of intrinsic renal disease or renovascularhypertension were excluded. A population-based control groupof 64 white Europeans was identified at primary care clinicsto provide control allele frequencies. Genomic DNA was isolatedby phenol-chloroform extraction from whole blood drawn intotubes containing potassium EDTA8.
Analysis of the Angiotensinogen Dinucleotide GT-Repeat Sequence
The angiotensinogen 3' dinucleotide repeat9 was analyzed byamplification using the polymerase chain reaction (PCR) withprimer pairs 5'AATGGGAAGTTAGGTCAGG3' and 5'TAGGCACTTGCAACTCCAGG3'.PCR was performed on approximately 250 ng of genomic DNA, with50 nmol of one unlabeled primer and approximately 5 nmol ofthe opposite-strand primer that had previously been labeledwith [32P]ATP with T4 polynucleotide kinase (New England Biolabs,Bishops Stortford, United Kingdom)8. The reactions were carriedout in a total volume of 25 microl containing 50 mM potassiumchloride, 2.5 mM magnesium chloride, 10 mM TRIS-hydrochloricacid (pH 9.0), 0.1 percent Triton X-100, 100 µmol of eachdeoxynucleotide triphosphate, and 0.5 U of Taq polymerase. Thisinvolved an initial denaturation at 94 °C, followed by 25cycles of one minute at 94 °C, one minute at 61 °C,and one minute at 72 °C. Radioactive fragments were analyzedby electrophoresis through 5 percent denaturing polyacrylamidegels containing 8 M urea, 89 mM TRIS base, 89 mM boric acid,and 2 mM EDTA. The gels were run for approximately 4 hours ata constant voltage of 1350 V, dried, and exposed for 12 hoursto Kodak XAR-2 film for autoradiography8.
M235T and T174M Genotypes of Angiotensinogen
The M235T and T174M polymorphisms were investigated by PCR amplificationof genomic DNA followed by restriction-endonuclease digestion.Genomic DNA (250 ng) was amplified with 50 nmol of each unlabeledprimer (5'GATGCGCACAAGGTCCTG3' and 5'CAGGGTGCTGTCCACACTGGCTCGC3')in a total volume of 50 microl containing 50 mM potassium chloride,2.5 mM magnesium chloride, 10 mM TRIS-hydrochloric acid (pH9.0), 0.1 percent Triton X-100, 100 µmol of each deoxynucleotidetriphosphate, and 0.5 U of Taq polymerase. There was an initialdenaturation at 94 °C, followed by 25 cycles of one minuteat 94 °C, one minute at 61 °C, and one minute at 72°C. The most 3' guanosine residue in the longer oligonucleotideis mismatched with genomic DNA, which (depending on the sequence)creates an SfaNI restriction site during amplification. If thecodon 235 is ATG (M235), digestion with SfaNI yields a 266-bpproduct relative to the undigested 303-bp product (T235). Afterrestriction-endonuclease digestion, fragments were analyzedby electrophoresis through 5 percent polyacrylamide gels (Figure 1).The T174M genotype was determined by digestion of the same303-bp amplified product with an existing NcoI cutting site.After digestion at 37 °C with NcoI (New England Biolabs),the genotypes of the samples were determined by size fractionationon ethidium-stained 1 percent agarose TRIS borate EDTA gels(Figure 1). All persons were studied for the M235T and T174Mgenotypes in a blinded fashion.
Figure 1. Genotype Determination of M235T and T174M on Ethidium-Stained Gels.
The variant M235 was cut by digestion with SfaNI to form a 266-bp fragment relative to a 303-bp 235T fragment. The 174M variant was cut to form 211- and 92-bp fragments by digestion with NcoI, as described in the Methods section.
Single-Strand Sequencing of Exon 2
Genomic DNA was amplified with 50 ng of each primer pair (biotinylated5'TAAAGGTCAGTTAATAACCACC3' and 5' CCATCTCCAAGGCCTGACTGGC3')in PCR mixture as described above, with cycles of 94 °Cfor three minutes followed by 25 cycles of 94 °C for oneminute, 63 °C for one minute, and 72 °C for one minute.The biotinylated product was purified on M-280 streptavidinparamagnetic beads (Dynabeads, Dynal, Norway), and single-strandedtemplates were prepared by denaturation with 100 mM sodium hydroxide.Once neutralized, the antisense template was subjected to T7sequencing with a Pharmacia kit (Uppsala, Sweden) and the primer5'GATGCGCACAAGTCCTG3'. The sequences of a substantial proportionof the undigested products (i.e., T235 and products from heterozygotes)were analyzed on 5 percent denaturing polyacrylamide gels asdescribed, followed by autoradiography. The genotypes previouslyassigned by restriction analysis were confirmed with 100 percentspecificity.
Statistical Analysis
The affected-pedigree-member method of linkage analysis is anestablished statistical test for the investigation of the geneticbasis of complex traits, such as essential hypertension10,11,12,13.This method was used to compute a t-statistic that tested whetheraffected relatives shared alleles at the angiotensinogen locusmore often than would be expected by chance10,11. This t-statisticbased on allele sharing does not involve parental genotypesand is weighted to permit the excessive sharing of rare allelesto outweigh the sharing of common alleles (the intermediateweighting function 1/[p was used, where p denotes the frequencyof shared marker alleles)10,11.
Such analyses make no explicit assumptions about mode of inheritance,genotype penetrance, or the presence of phenocopies and areparticularly useful for disorders of late onset in which parentalgenotypes may be unavailable10,11,14. This robustness is partlyoffset by the fact that the t-statistics derived by the affected-pedigree-membermethod are influenced by the numbers analyzed and should notbe considered a direct measure of the strength of linkage. Wepresent as an indicator of the strength of linkage the percentageof excess alleles shared in each data set.
The programs Apmmult (version 2.0) and Simmult were used toapply the algorithms devised by Weeks and Lange for use withthe affected-pedigree-member method of linkage analysis10,11.The t-statistic for large data sets (i.e., those with more than20 families) has an approximately normal distribution and isinterpreted in a one-tailed test. Significant results from theApmmult program were checked by computer simulation with theaccompanying Simmult program. Both theoretical and empiricalP values are reported.
The genotypes and allele frequencies for the GT repeat, M235T,and T174M were tested by the chi-square test for their associationwith hypertension in 63 index patients with hypertension andpopulation-based controls. Entire families were not tested inthis case-control comparison, because relatives may share allelesby virtue of their family relationship.
Results
Genetic Linkage of the Angiotensinogen Gene to Essential Hypertension
In the test for linkage, we used a dinucleotide GT-repeat sequencein the 3' flanking region of the angiotensinogen gene with aheterozygosity of 77 percent9. Sixty-three multiplex white Europeanfamilies, including 149 affected relatives with essential hypertensionidentified at a hospital hypertension clinic and three primarycare clinics, were genotyped in a blinded fashion with thisGT repeat. These sibships were selected under strict criteria,as described in the Methods section, and their demographic characteristicsare summarized in Table 1. Control allele frequencies were determinedin a random population of 64 unrelated white Europeans and foundto be similar to published frequencies in the large referencepedigrees of the Centre d'Etude du Polymorphisme Humain9. Thedata were tested for linkage by the affected-pedigree-membermethod, which uses identity-by-state scoring to take accountof allele sharing10,11.
Table 1. Demographic Characteristics of 149 Persons with Essential Hypertension Who Belonged to 63 Multiplex Families.
Linkage was detected among the 63 multiplex families (t = 5.00,P<0.001) (Table 2) after comparison with the marker-allelefrequencies in the 64 control subjects. In 40 of the 63 families,there was a 25.9 percent excess of shared alleles. The affected-pedigree-membermethod is known to be sensitive to marker-allele frequencies;for example, recalculation with the published marker frequenciesyielded a t-statistic of 7.709.
Table 2. Linkage between the Angiotensinogen Dinucleotide Repeat and the Presence of Essential Hypertension in Affected Sibships.
The difference between the observed and the expected frequencydistributions of the family-by-family t-statistics in the 63families can be seen in a histogram (Figure 2). The expecteddistribution was computed under the null hypothesis that affectedfamily members share a proportion of marker alleles that isconsistent with the independent segregation of the marker andthe disease. There is a clear shift to the right for the observeddistribution, supporting the hypothesis of linkage of the angiotensinogenGT-repeat sequence to hypertension.
Figure 2. Distribution of the Observed and Expected Frequencies of Shared Alleles, as Indicated by the t-Statistic, in 63 Multiplex Families with Essential Hypertension.
The t-statistic tests whether affected relatives share alleles at the angiotensinogen locus more often than would be expected by chance. The observed scores are shifted to the right, suggesting a linkage between the angiotensinogen gene and essential hypertension.
Multiple different alleles were shared in excess at this locus,making it unlikely that stratification of the population producedan artificial increase in allele sharing. This is demonstratedby inspecting the genotypes and allele frequencies of the indexpatients with hypertension and the control subjects (Table 3).This comparison of genotypes was tested for association withhypertension by the chi-square test, and a significant associationwas found (chi-square = 53.3, 10 df, P<0.001) (Table 3).
Table 3. Angiotensinogen GT-Repeat Genotypes in 63 Hypertensive Patients and 64 Controls.
In view of the quantitative nature of blood pressure and theprevious finding of a stronger linkage with diastolic bloodpressure greater than 100 mm Hg, we stratified the familiesaccording to the severity of hypertension6. Thirty-one familieshad pairs of affected relatives with diastolic pressures greaterthan 100 mm Hg, and there was evidence of linkage in this subgroup(t = 3.65, P<0.001); they shared alleles at a frequency 25.1percent higher than expected (Table 2). Although 71 percentof the cohort was receiving antihypertensive-drug treatmentat the time of recruitment, we were able to determine pretreatmentblood pressures for 69 percent of the families from primarycare records and from the data base at our hypertension clinic.On the basis of these records, at least 63 percent of the cohorthad diastolic blood pressures higher than 100 mm Hg.
Linkage was also tested according to sex. Despite the smallnumber of male-male pairs (18), linkage remained significant(t = 2.09, P<0.018), with a frequency of shared alleles 17.0percent higher than expected. The 28 female-female pairs alsoshowed linkage between hypertension and the angiotensinogengene (t = 3.73, P<0.001), and allele sharing was 29.1 percenthigher than expected, in contrast with previous findings6 (Table 2).
Angiotensinogen-Gene Variants M235T and T174M
Using restriction enzymes, we determined the frequency of theM235T and T174M genotypes in index patients from the 63 familiesand in 80 control subjects (Figure 1). Only index patients withhypertension were studied, and the genotype of each variantwas determined in those patients and compared with those ofcontrol subjects identified by population screening. Both populationswere in Hardy-Weinberg equilibrium. The allele frequencies forthe two variants were very similar in the hypertensive patientsand the controls, and neither M235T nor T174M was significantlyassociated with hypertension (Table 4). Both M235T and T174Mwere tested for linkage by the affected-pedigree-member methodin the 63 families, and there was no evidence that either polymorphismwas linked to hypertension (t-statistic for M235T, -0.411, P= 0.68; t-statistic for T174M, -0.86313, P = 0.65).
Table 4. Tests of Association between Angiotensinogen Variants and Hypertension.
Discussion
The linkage of the angiotensinogen-gene locus to essential hypertensionprovides valuable confirmation that a susceptibility locus onhuman chromosome lq42-43 may contribute to the development ofhypertension. This has now been shown in two studies, includingthree affected sibships of white European ancestry6. There iscomplementary support for these data in physiologic observationsthat elevated blood pressure tracks with high plasma levelsof angiotensinogen in families15. In addition, hypertensiondevelops in transgenic animal models in association with overexpressionof the angiotensinogen gene16. Interestingly, the same GT-repeatsequence analyzed here has been linked to proteinuric preeclampsiain Scottish and Icelandic families17.
The problems of determining the genetic basis of polygenic diseaseare highlighted in the cases of schizophrenia and atopy, inwhich linkage of putative markers has not thus far been replicatedin other populations18,19. These conflicting findings may reflectdifferences in ascertainment of families, variable penetranceof causative genes, or alternative definitions of the diseasephenotype.
The striking feature of our study is the consistency of thelinkage detected by the affected-pedigree-member method, inthat linkage was detected in both sexes and in a group of moreseverely affected families. In the previous study of this genelocus, sibships were stratified according to the severity ofdiastolic hypertension (>100 mm Hg) or the receipt of twoor more antihypertensive agents. Although these criteria arearbitrary thresholds for severity, there is evidence to suggestthat such stratification may be important6. In the present study,linkage was not more significant for the 31 families with diastolicpressures greater than 100 mm Hg than for the overall cohort.This may be explained by the high median (±SD) diastolicblood pressure of 102 ±7 mm Hg in the 63 families. Thisfinding suggests that even though the subjects in 71 percentof families were receiving drug treatment, the cohort stillcontained persons with markedly elevated diastolic pressure.These observations, in tandem with previous data, imply thatin the genetic study of this quantitative trait it may be criticalto define more severely affected persons in order to link amarker to hypertension6.
The percentage of excess alleles shared offers an indicationof the strength of the linkage in this population, which showsan excess percentage that is consistent among all 63 familiesand among the 31 families with more severely affected pairsof relatives. The positive association of the angiotensinogenGT-repeat sequence with hypertension and the excess sharingof several alleles imply that this locus has a high probabilityof harboring a susceptibility gene for essential hypertension.There may be several different mutations within or close tothe angiotensinogen gene that contribute to the developmentof essential hypertension. Since different alleles of the angiotensinogenrepeat sequence were significantly over- and underrepresentedin the patients, both susceptibility and protective angiotensinogen-genevariants may exist. However, this study does not provide directevidence in support of this concept. These observations raisethe possibility that analysis of other populations may revealimportant differences in the gene variants.
It has previously been suggested that the angiotensinogen-genevariant M235T, or perhaps less likely T174M, may be the factorthat contributes to the hypertension phenotype6. The M235T polymorphismhas also recently been associated with preeclampsia20. Thesepolymorphisms are at some distance from the angiotensin-cleavagesites in the angiotensinogen molecule21. Accordingly, it isunclear how these variants might functionally influence theactivity of the renin-angiotensin system. We did not find significantassociations of either variant with hypertension as comparedwith two population-based control groups. The absence of linkageof M235T and T174M with hypertension reflects the lack of informativenessof these polymorphisms and is not surprising. Furthermore, directsequencing of the region of exon 2 that contains these variantswas used to confirm the genotypes ascribed by restriction analysisto several members of the cohort. Therefore, we cannot concludethat either of these polymorphisms is acting as a marker orplaying a directly causative part in relation to hypertensionin our population.
The renin-angiotensin system includes other candidate genesthat could be implicated in the genetic basis of essential hypertension.In contrast to the promising data from animal models of hypertension,the renin gene and the angiotensin-converting-enzyme gene haveboth been the focus of negative linkage studies in affectedwhite sibships22,23,24,25. Angiotensinogen is a crucial ratedeterminant of this pressor system, and regions within or nearthe angiotensinogen gene on chromosome 1q42-43 have now beenlinked to essential hypertension in two separate investigations6.Our findings suggest that a further search for mutations inthe angiotensinogen gene that might result in hypertension isneeded in this population.
Supported by the Joint Research Board of St. Bartholomew's Hospital,the Medical Research Council of Great Britain, the Fellowshipof Postgraduate Medicine, and the Mason Medical Research Foundation.
We are indebted to the families and doctors from Bersted GreenSurgery in Bognor Regis, St. John's Hill Surgery in Sevenoaks,Queensbridge Road Surgery in Hackney, and the hypertension clinicat St. Bartholomew's Hospital.
Source Information
From the Departments of Clinical Pharmacology (M.C., P.M., M.L., P.T.) and Chemical Endocrinology (P.L., A.J.L.C.), St. Bartholomew's Hospital; and the Medical Research Council Molecular Medicine Group, Royal Postgraduate Medical School (M.F.) -- both in London.
Address reprint requests to Dr. Caulfield at the Department of Clinical Pharmacology, St. Bartholomew's Hospital, London EC1A 7BE, United Kingdom.
References
MacMahon S, Peto R, Cutler J, et al. Blood pressure, stroke and coronary heart disease: part 1, prolonged differences in blood pressure: prospective observational studies corrected for the regression dilution bias. Lancet 1990;335:765-774. [CrossRef][Medline]
Ward R. Familial aggregation and genetic epidemiology of blood pressure. In: Laragh JH, Brenner BM, eds. Hypertension: pathophysiology, diagnosis, and management. Vol. 1. New York: Raven Press, 1990:81-100.
Pickering G. Hyperpiesis: high blood-pressure without evident cause: essential hypertension. BMJ 1965;2:1021-1026.
Williams RR, Hunt SC, Hasstedt SJ, et al. Current knowledge regarding the genetics of human hypertension. J Hypertens Suppl 1989;7:S8-S13. [Medline]
MacGregor GA, Markandu ND, Roulston JE, Jones JC, Morton JJ. Maintenance of blood pressure by the renin-angiotensin system in normal man. Nature 1981;291:329-331. [CrossRef][Medline]
Jeunemaitre X, Soubrier F, Kotelevtsev YV, et al. Molecular basis of human hypertension: role of angiotensinogen. Cell 1992;71:169-180. [CrossRef][Medline]
Kurtz TW, Spence MA. Genetics of essential hypertension. Am J Med 1993;94:77-84. [CrossRef][Medline]
Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1989.
Kotelevtsev YV, Clauser E, Corvol P, Soubrier F. Dinucleotide repeat polymorphism in the human angiotensinogen gene. Nucleic Acids Res 1991;19:6978-6978. [Free Full Text]
Weeks DE, Lange K. The affected-pedigree-member method of linkage analysis. Am J Hum Genet 1988;42:315-326. [Medline]
Weeks DE, Lange K. A multilocus extension of the affected-pedigree-member method of linkage analysis. Am J Hum Genet 1992;50:859-868. [Medline]
Pericak-Vance MA, Bebout JL, Gaskell PC Jr, et al. Linkage studies in familial Alzheimer disease: evidence for chromosome 19 linkage. Am J Hum Genet 1991;48:1034-1050. [Medline]
Hall JM, Lee MK, Newman B, et al. Linkage of early-onset familial breast cancer to chromosome 17q21. Science 1990;250:1684-1689. [Free Full Text]
Bishop DT, Williamson JA. The power of identity-by-state methods for linkage analysis. Am J Hum Genet 1990;46:254-265. [Medline]
Watt GCM, Harrap SB, Foy CJW, et al. Abnormalities of glucocorticoid metabolism and the renin-angiotensin system: a four-corners approach to the identification of genetic determinants of blood pressure. J Hypertens 1992;10:473-482. [Medline]
Kimura S, Mullins JJ, Bunnemann B, et al. High blood pressure in transgenic mice carrying the rat angiotensinogen gene. EMBO J 1992;11:821-827. [Medline]
Arngrimsson R, Purandare S, Connor M, et al. Angiotensinogen: a candidate gene involved in preeclampsia? Nat Genet 1993;4:114-115. [CrossRef][Medline]
Split verdict on schizophrenia. Nat Genet 1992;1:231-232. [Medline]
Marsh DG, Meyers DA. A major gene for allergy -- fact or fancy? Nat Genet 1992;2:252-254. [CrossRef][Medline]
Ward K, Hata A, Jeunemaitre X, et al. A molecular variant of angiotensinogen associated with preeclampsia. Nat Genet 1993;4:59-61. [CrossRef][Medline]
Gaillard I, Clauser E, Corvol P. Structure of human angiotensinogen gene. DNA 1989;8:87-99. [Medline]
Hilbert P, Lindpaintner K, Beckmann JS, et al. Chromosomal mapping of two genetic loci associated with blood-pressure regulation in hereditary hypertensive rats. Nature 1991;353:521-529. [CrossRef][Medline]
Kurtz TW, Simonet L, Kabra PM, et al. Cosegregation of the renin allele of the spontaneously hypertensive rat with an increase in blood pressure. J Clin Invest 1990;85:1328-1332.
Jeunemaitre X, Lifton RP, Hunt SC, Williams RR, Lalouel JM. Absence of linkage between the angiotensin converting enzyme locus and human essential hypertension. Nat Genet 1992;1:72-75. [CrossRef][Medline]
Jeunemaitre X, Rigat B, Charru A, Houot A-M, Soubrier F, Corvol P. Sib pair linkage analysis of renin gene haplotypes in human essential hypertension. Hum Genet 1992;88:301-306. [Medline]
Konoshita, T., Kato, N., Fuchs, S., Mizuno, S., Aoyama, C., Motomura, M., Makino, Y., Wakahara, S., Inoki, I., Miyamori, I., Pinet, F., for the Genomic Disease Outcome Consortium (G-DOC),
(2009). Genetic Variant of the Renin-Angiotensin System and Diabetes Influences Blood Pressure Response to Angiotensin Receptor Blockers. Diabetes Care
32: 1485-1490
[Abstract][Full Text]
Sigmund, C. D.
(2008). A growing chain of evidence linking genetic variation in angiotensinogen with essential hypertension: focus on "A haplotype of human angiotensinogen gene containing -217A increases blood pressure in transgenic mice compared with -217G," by Jain et al.. Am. J. Physiol. Regul. Integr. Comp. Physiol.
295: R1846-R1848
[Full Text]
Alvi, F. M, Hasnain, S.
(2008). Angiotensinogen gene variants in a Pakistani hypertensive population of Punjab. Journal of Renin-Angiotensin-Aldosterone System
9: 27-31
[Abstract]
Pilbrow, A. P., Palmer, B. R., Frampton, C. M., Yandle, T. G., Troughton, R. W., Campbell, E., Skelton, L., Lainchbury, J. G., Richards, A. M., Cameron, V. A.
(2007). Angiotensinogen M235T and T174M Gene Polymorphisms in Combination Doubles the Risk of Mortality in Heart Failure. Hypertension
49: 322-327
[Abstract][Full Text]
Goldenberg, I., Moss, A. J., Ryan, D., McNitt, S., Eberly, S. W., Zareba, W.
(2006). Polymorphism in the Angiotensinogen Gene, Hypertension, and Ethnic Differences in the Risk of Recurrent Coronary Events. Hypertension
48: 693-699
[Abstract][Full Text]
Dickson, M. E., Sigmund, C. D.
(2006). Genetic Basis of Hypertension: Revisiting Angiotensinogen. Hypertension
48: 14-20
[Full Text]
Skov, K., Madsen, J. K., Hansen, H. E., Zagato, L., Frandsen, E., Bianchi, G., Mulvany, M. J.
(2006). Renal Haemodynamics are not Related to Genotypes in Offspring of Parents with Essential Hypertension. Journal of Renin-Angiotensin-Aldosterone System
7: 47-55
[Abstract]
Tabel, Y., Berdeli, A., Mir, S., Serdaroglu, E., Ytlmaz, E.
(2005). Effects of Genetic Polymorphisms of the Renin-Angiotensin System in Children with Nephrotic Syndrome. Journal of Renin-Angiotensin-Aldosterone System
6: 138-144
[Abstract]
Rowan, S., Adrogues, H., Mathur, A., Kamat, D.
(2005). Pediatric Hypertension: A Review for the Primary Care Provider. CLIN PEDIATR
44: 289-296
Shimizu, T., Oishi, T., Omori, A., Sugiura, A., Hirota, K., Aoyama, H., Saito, T., Sugaya, T., Kon, Y., Engel, J. D., Fukamizu, A., Tanimoto, K.
(2005). Identification of cis-Regulatory Sequences in the Human Angiotensinogen Gene by Transgene Coplacement and Site-Specific Recombination. Mol. Cell. Biol.
25: 2938-2945
[Abstract][Full Text]
Sekuri, C., Cam, F S., Ercan, E., Tengiz, I., Sagcan, A., Eser, E., Berdeli, A., Akin, M.
(2005). Renin-angiotensin system gene polymorphisms and premature coronary heart disease. Journal of Renin-Angiotensin-Aldosterone System
6: 38-42
[Abstract]
Bernstein, K. E., Xiao, H. D., Adams, J. W., Frenzel, K., Li, P., Shen, X. Z., Cole, J. M., Fuchs, S.
(2005). Establishing the Role of Angiotensin-Converting Enzyme in Renal Function and Blood Pressure Control through the Analysis of Genetically Modified Mice. J. Am. Soc. Nephrol.
16: 583-591
[Full Text]
Gainer, J. V., Bellamine, A., Dawson, E. P., Womble, K. E., Grant, S. W., Wang, Y., Cupples, L. A., Guo, C.-Y., Demissie, S., O'Donnell, C. J., Brown, N. J., Waterman, M. R., Capdevila, J. H.
(2005). Functional Variant of CYP4A11 20-Hydroxyeicosatetraenoic Acid Synthase Is Associated With Essential Hypertension. Circulation
111: 63-69
[Abstract][Full Text]
Chen, J.-H., Chang, Y.-W., Yao, C.-W., Chiueh, T.-S., Huang, S.-C., Chien, K.-Y., Chen, A., Chang, F.-Y., Wong, C.-H., Chen, Y.-J.
(2004). Plasma proteome of severe acute respiratory syndrome analyzed by two-dimensional gel electrophoresis and mass spectrometry. Proc. Natl. Acad. Sci. USA
101: 17039-17044
[Abstract][Full Text]
Schmidt, H., Aulchenko, Y. S., Schweighofer, N., Schmidt, R., Frank, S., Kostner, G. M., Ott, E., van Duijn, C.
(2004). Angiotensinogen Promoter B-Haplotype Associated With Cerebral Small Vessel Disease Enhances Basal Transcriptional Activity. Stroke
35: 2592-2597
[Abstract][Full Text]
Wu, S.-J., Chiang, F.-T., Chen, W. J., Liu, P.-H., Hsu, K.-L., Hwang, J.-J., Lai, L.-P., Lin, J.-L., Tseng, C.-D., Tseng, Y.-Z.
(2004). Three single-nucleotide polymorphisms of the angiotensinogen gene and susceptibility to hypertension: single locus genotype vs. haplotype analysis. Physiol. Genomics
17: 79-86
[Abstract][Full Text]
Jacobsen, P., Tarnow, L., Carstensen, B., Hovind, P., Poirier, O., Parving, H.-H.
(2003). Genetic Variation in the Renin-Angiotensin System and Progression of Diabetic Nephropathy. J. Am. Soc. Nephrol.
14: 2843-2850
[Abstract][Full Text]
Marques, G. D.M., Quinto, B. M.R., Plavinik, F. L., Krieger, J. E., Marson, O., Casarini, D. E.
(2003). N-Domain Angiotensin I-Converting Enzyme With 80 kDa as a Possible Genetic Marker of Hypertension. Hypertension
42: 693-701
[Abstract][Full Text]
Sethi, A. A., Nordestgaard, B. G., Tybjaerg-Hansen, A.
(2003). Angiotensinogen Gene Polymorphism, Plasma Angiotensinogen, and Risk of Hypertension and Ischemic Heart Disease: A Meta-Analysis. Arterioscler. Thromb. Vasc. Bio.
23: 1269-1275
[Abstract][Full Text]
Freedman, B. I.
(2003). Susceptibility Genes for Hypertension and Renal Failure. J. Am. Soc. Nephrol.
14: S192-194
[Abstract][Full Text]
Cvetkovic, B., Keen, H. L., Zhang, X., Davis, D., Yang, B., Sigmund, C. D.
(2002). Physiological significance of two common haplotypes of human angiotensinogen using gene targeting in the mouse. Physiol. Genomics
11: 253-262
[Abstract][Full Text]
Losito, A., Kalidas, K., Santoni, S., Ceccarelli, L., Jeffery, S.
(2002). Polymorphism of renin-angiotensin system genes in dialysis patients--association with cerebrovascular disease. Nephrol Dial Transplant
17: 2184-2188
[Abstract][Full Text]
WONG, L.-F., POLSON, J. W., MURPHY, D., PATON, J. F. R., KASPAROV, S.
(2002). Genetic and pharmacological dissection of pathways involved in the angiotensin II-mediated depression of baroreflex function. FASEB J.
16: 1595-1601
[Abstract][Full Text]
Marshall, R. P., Webb, S., Bellingan, G. J., Montgomery, H. E., Chaudhari, B., McAnulty, R. J., Humphries, S. E., Hill, M. R., Laurent, G. J.
(2002). Angiotensin Converting Enzyme Insertion/Deletion Polymorphism Is Associated with Susceptibility and Outcome in Acute Respiratory Distress Syndrome. Am. J. Respir. Crit. Care Med.
166: 646-650
[Abstract][Full Text]
Sonna, L. A., Glueck, S. B., Jeunemaitre, X.
(2002). Exercise, genetics, and blood pressure: Focus on "Physical exercise and blood pressure with reference to the angiotensinogen M235T polymorphism" and on "Angiotensinogen M235T polymorphism associates with exercise hemodynamics in postmenopausal women". Physiol. Genomics
10: 45-47
[Full Text]
McCole, S. D., Brown, M. D., Moore, G. E., Ferrell, R. E., Wilund, K. R., Huberty, A., Douglass, L. W., Hagberg, J. M.
(2002). Angiotensinogen M235T polymorphism associates with exercise hemodynamics in postmenopausal women. Physiol. Genomics
10: 63-69
[Abstract][Full Text]
Brasier, A. R., Recinos, A. III, Eledrisi, M. S.
(2002). Vascular Inflammation and the Renin-Angiotensin System. Arterioscler. Thromb. Vasc. Bio.
22: 1257-1266
[Abstract][Full Text]
Sierra, C., Coca, A., Gomez-Angelats, E., Poch, E., Sobrino, J., de la Sierra, A.
(2002). Renin-Angiotensin System Genetic Polymorphisms and Cerebral White Matter Lesions in Essential Hypertension. Hypertension
39: 343-347
[Abstract][Full Text]
Hefler, L. A., Tempfer, C. B., Bashford, M. T., Unfried, G., Zeillinger, R., Schneeberger, C., Koelbl, H., Nagele, F., Huber, J. C.
(2002). Polymorphisms of the angiotensinogen gene, the endothelial nitric oxide synthase gene, and the interleukin-1{beta} gene promoter in women with idiopathic recurrent miscarriage. Mol Hum Reprod
8: 95-100
[Abstract][Full Text]
Francke, S., Manraj, M., Lacquemant, C., Lecoeur, C., Lepretre, F., Passa, P., Hebe, A., Corset, L., Yan, S. L. K., Lahmidi, S., Jankee, S., Gunness, T. K., Ramjuttun, U. S., Balgobin, V., Dina, C., Froguel, P.
(2001). A genome-wide scan for coronary heart disease suggests in Indo-Mauritians a susceptibility locus on chromosome 16p13 and replicates linkage with the metabolic syndrome on 3q27. Hum Mol Genet
10: 2751-2765
[Abstract][Full Text]
Poch, E., Gonzalez, D., Giner, V., Bragulat, E., Coca, A., de la Sierra, A.
(2001). Molecular Basis of Salt Sensitivity in Human Hypertension: Evaluation of Renin-Angiotensin-Aldosterone System Gene Polymorphisms. Hypertension
38: 1204-1209
[Abstract][Full Text]
Sethi, A. A., Tybjaerg-Hansen, A., Gronholdt, M.-L. M., Steffensen, R., Schnohr, P., Nordestgaard, B. G.
(2001). Angiotensinogen Mutations and Risk for Ischemic Heart Disease, Myocardial Infarction, and Ischemic Cerebrovascular Disease: Six Case-Control Studies from the Copenhagen City Heart Study. ANN INTERN MED
134: 941-954
[Abstract][Full Text]
Rodriguez-Perez, J. C., Rodriguez-Esparragon, F., Hernandez-Perera, O., Anabitarte, A., Losada, A., Medina, A., Hernandez, E., Fiuza, D., Avalos, O., Yunis, C., Ferrario, C. M., for the PROCAGENE Study Investigators,
(2001). Association of angiotensinogen m235t and a(-6)g gene polymorphisms with coronary heart disease with independence of essential hypertension: the procagene study. J Am Coll Cardiol
37: 1536-1542
[Abstract][Full Text]
LALOUEL, J.-M., ROHRWASSER, A., TERREROS, D., MORGAN, T., WARD, K.
(2001). Angiotensinogen in Essential Hypertension: From Genetics to Nephrology. J. Am. Soc. Nephrol.
12: 606-615
[Abstract][Full Text]
Sethi, A. A., Nordestgaard, B. G., Agerholm-Larsen, B., Frandsen, E., Jensen, G., Tybjarg-Hansen, A.
(2001). Angiotensinogen Polymorphisms and Elevated Blood Pressure in the General Population : The Copenhagen City Heart Study. Hypertension
37: 875-881
[Abstract][Full Text]
Schmidt, H., Fazekas, F., Kostner, G. M., van Duijn, C. M., Schmidt, R.
(2001). Angiotensinogen Gene Promoter Haplotype and Microangiopathy-Related Cerebral Damage : Results of the Austrian Stroke Prevention Study. Stroke
32: 405-412
[Abstract][Full Text]
Padmanabhan, N., Padmanabhan, S., Connell, J. M.
(2000). Genetic basis of cardiovascular disease -- the renin-angiotensin-aldosterone system as a paradigm. Journal of Renin-Angiotensin-Aldosterone System
1: 316-324
Agarwal, A. K., Giacchetti, G., Lavery, G., Nikkila, H., Palermo, M., Ricketts, M., McTernan, C., Bianchi, G., Manunta, P., Strazzullo, P., Mantero, F., White, P. C., Stewart, P. M.
(2000). CA-Repeat Polymorphism in Intron 1 of HSD11B2 : Effects on Gene Expression and Salt Sensitivity. Hypertension
36: 187-194
[Abstract][Full Text]
Rankinen, T., Gagnon, J., Perusse, L., Chagnon, Y. C., Rice, T., Leon, A. S., Skinner, J. S., Wilmore, J. H., Rao, D. C., Bouchard, C.
(2000). AGT M235T and ACE ID polymorphisms and exercise blood pressure in the HERITAGE Family Study. Am. J. Physiol. Heart Circ. Physiol.
279: H368-H374
[Abstract][Full Text]
Hsueh, W.-C., Mitchell, B. D., Schneider, J. L., Wagner, M. J., Bell, C. J., Nanthakumar, E., Shuldiner, A. R.
(2000). QTL Influencing Blood Pressure Maps to the Region of PPH1 on Chromosome 2q31-34 in Old Order Amish. Circulation
101: 2810-2816
[Abstract][Full Text]
Cooper, R. S., Guo, X., Rotimi, C. N., Luke, A., Ward, R., Adeyemo, A., Danilov, S. M.
(2000). Heritability of Angiotensin-Converting Enzyme and Angiotensinogen : A Comparison of US Blacks and Nigerians. Hypertension
35: 1141-1147
[Abstract][Full Text]
Fatini, C, Abbate, R, Pepe, G, Battaglini, B, Gensini, F, Ruggiano, G, Gensini, G.F, Guazzelli, R
(2000). Searching for a better assessment of the individual coronary risk profile. The role of angiotensin-converting enzyme, angiotensin II type 1 receptor and angiotensinogen gene polymorphisms. Eur Heart J
21: 633-638
[Abstract]
Komiya, I., Yamada, T., Takara, M., Asawa, T., Shimabukuro, M., Nishimori, T., Takasu, N.
(2000). Lys173Arg and -344T/C Variants of CYP11B2 in Japanese Patients With Low-Renin Hypertension. Hypertension
35: 699-703
[Abstract][Full Text]
Cvetkovic, B., Yang, B., Williamson, R. A., Sigmund, C. D.
(2000). Appropriate Tissue- and Cell-specific Expression of a Single Copy Human Angiotensinogen Transgene Specifically Targeted Upstream of the HPRT Locus by Homologous Recombination. J. Biol. Chem.
275: 1073-1078
[Abstract][Full Text]
Dominiczak, A. F., Negrin, D. C., Clark, J. S., Brosnan, M. J., McBride, M. W., Alexander, M. Y.
(2000). Genes and Hypertension : From Gene Mapping in Experimental Models to Vascular Gene Transfer Strategies. Hypertension
35: 164-172
[Abstract][Full Text]
Giner, V., Poch, E., Bragulat, E., Oriola, J., Gonzalez, D., Coca, A., Alejandro de la Sierra,
(2000). Renin-Angiotensin System Genetic Polymorphisms and Salt Sensitivity in Essential Hypertension. Hypertension
35: 512-517
[Abstract][Full Text]
Makino, N., Sugano, M., Ohtsuka, S., Sawada, S., Hata, T.
(1999). Chronic antisense therapy for angiotensinogen on cardiac hypertrophy in spontaneously hypertensive rats. Cardiovasc Res
44: 543-548
[Abstract][Full Text]
Wright, F. A., O'Connor, D. T., Roberts, E., Kutey, G., Berry, C. C., Yoneda, L. U., Timberlake, D., Schlager, G.
(1999). Genome Scan for Blood Pressure Loci in Mice. Hypertension
34: 625-630
[Abstract][Full Text]
Fardella, C., Zamorano, P., Mosso, L., Gomez, L., Pinto, M., Soto, J., Oestreicher, E., Cortes, P., Claverie, X., Montero, J.
(1999). A-6G Variant of Angiotensinogen Gene and Aldosterone Levels in Hypertensives. Hypertension
34: 779-781
[Abstract][Full Text]
Hilgers, K. F., Langenfeld, M. R. W., Schlaich, M., Veelken, R., Schmieder, R. E.
(1999). 1166 A/C Polymorphism of the Angiotensin II Type 1 Receptor Gene and the Response to Short-Term Infusion of Angiotensin II. Circulation
100: 1394-1399
[Abstract][Full Text]
Ishigami, T., Tamura, K., Fujita, T., Kobayashi, I., Hibi, K., Kihara, M., Toya, Y., Ochiai, H., Umemura, S.
(1999). Angiotensinogen Gene Polymorphism Near Transcription Start Site and Blood Pressure : Role of a T-to-C Transition at Intron I. Hypertension
34: 430-434
[Abstract][Full Text]
Nishii, T., Moriguchi, A., Morishita, R., Yamada, K., Nakamura, S., Tomita, N., Kaneda, Y., Fukamizu, A., Mikami, H., Higaki, J., Ogihara, T.
(1999). Angiotensinogen Gene–Activating Elements Regulate Blood Pressure in the Brain. Circ. Res.
85: 257-263
[Abstract][Full Text]
NAGY, Z., BUSJAHN, A., BÄHRING, S., FAULHABER, H.-D., GOHLKE, H.-R., KNOBLAUCH, H., ROSENTHAL, M., MÜLLER-MYHSOK, B., SCHUSTER, H., LUFT, F. C.
(1999). Quantitative Trait Loci for Blood Pressure Exist Near the IGF-1, the Liddle Syndrome, the Angiotensin II-Receptor Gene and the Renin Loci in Man. J. Am. Soc. Nephrol.
10: 1709-1716
[Abstract][Full Text]
van SUYLEN, R. J., WOUTERS, E. F., PENNINGS, H. J., CHERIEX, E. C., van POL, P. E., AMBERGEN, A. W., VERMELIS, A.-M., DAEMEN, M. J.
(1999). The DD Genotype of the Angiotensin Converting Enzyme Gene Is Negatively Associated with Right Ventricular Hypertrophy In Male Patients with Chronic Obstructive Pulmonary Disease. Am. J. Respir. Crit. Care Med.
159: 1791-1795
[Abstract][Full Text]
Corvol, P., Persu, A., Gimenez-Roqueplo, A.-P., Jeunemaitre, X.
(1999). Seven Lessons From Two Candidate Genes in Human Essential Hypertension : Angiotensinogen and Epithelial Sodium Channel. Hypertension
33: 1324-1331
[Abstract][Full Text]
Schinke, M., Baltatu, O., Bohm, M., Peters, J., Rascher, W., Bricca, G., Lippoldt, A., Ganten, D., Bader, M.
(1999). Blood pressure reduction and diabetes insipidus in transgenic rats deficient in brain angiotensinogen. Proc. Natl. Acad. Sci. USA
96: 3975-3980
[Abstract][Full Text]
Kainulainen, K., Perola, M., Terwilliger, J., Kaprio, J., Koskenvuo, M., Syvanen, A.-C., Vartiainen, E., Peltonen, L., Kontula, K.
(1999). Evidence for Involvement of the Type 1 Angiotensin II Receptor Locus in Essential Hypertension. Hypertension
33: 844-849
[Abstract][Full Text]
Niu, T., Yang, J., Wang, B., Chen, W., Wang, Z., Laird, N., Wei, E., Fang, Z., Lindpaintner, K., Rogus, J. J., Xu, X.
(1999). Angiotensinogen Gene Polymorphisms M235T/T174M : No Excess Transmission to Hypertensive Chinese. Hypertension
33: 698-702
[Abstract][Full Text]
St. Lezin, E., Zhang, L., Yang, Y., Wang, J.-M., Wang, N., Qi, N., Steadman, J. S., Liu, W., Kren, V., Zidek, V., Krenova, D., Churchill, P. C., Churchill, M. C., Pravenec, M.
(1999). Effect of Chromosome 19 Transfer on Blood Pressure in the Spontaneously Hypertensive Rat. Hypertension
33: 256-260
[Abstract][Full Text]
Pratt, J. H., Ambrosius, W. T., Tewksbury, D. A., Wagner, M. A., Zhou, L., Hanna, M. P.
(1998). Serum Angiotensinogen Concentration in Relation to Gonadal Hormones, Body Size, and Genotype in Growing Young People. Hypertension
32: 875-879
[Abstract][Full Text]
Hunt, S. C., Cook, N. R., Oberman, A., Cutler, J. A., Hennekens, C. H., Allender, P. S., Walker, W. G., Whelton, P. K., Williams, R. R.
(1998). Angiotensinogen Genotype, Sodium Reduction, Weight Loss, and Prevention of Hypertension : Trials of Hypertension Prevention, Phase II. Hypertension
32: 393-401
[Abstract][Full Text]
Tamura, K., Umemura, S., Nyui, N., Hibi, K., Ishigami, T., Kihara, M., Toya, Y., Ishii, M.
(1998). Activation of angiotensinogen gene in cardiac myocytes by angiotensin II and mechanical stretch. Am. J. Physiol. Regul. Integr. Comp. Physiol.
275: R1-R9
[Abstract][Full Text]
Mazzolai, L., Nussberger, J., Aubert, J.-F., Brunner, D. B., Gabbiani, G., Brunner, H. R., Pedrazzini, T.
(1998). Blood Pressure–Independent Cardiac Hypertrophy Induced by Locally Activated Renin-Angiotensin System. Hypertension
31: 1324-1330
[Abstract][Full Text]
Makino, N., Sugano, M., Ohtsuka, S., Sawada, S.
(1998). Intravenous Injection With Antisense Oligodeoxynucleotides Against Angiotensinogen Decreases Blood Pressure in Spontaneously Hypertensive Rats. Hypertension
31: 1166-1170
[Abstract][Full Text]
Brand, E., Chatelain, N., Keavney, B., Caulfield, M., Citterio, L., Connell, J., Grobbee, D., Schmidt, S., Schunkert, H., Schuster, H., Sharma, A. M., Soubrier, F.
(1998). Evaluation of the Angiotensinogen Locus in Human Essential Hypertension : A European Study. Hypertension
31: 725-729
[Abstract][Full Text]
Kato, N., Sugiyama, T., Nabika, T., Morita, H., Kurihara, H., Yazaki, Y., Yamori, Y.
(1998). Lack of Association Between the {alpha}-Adducin Locus and Essential Hypertension in the Japanese Population. Hypertension
31: 730-733
[Abstract][Full Text]
Yang, G., Sigmund, C. D.
(1998). Regulatory Elements Required for Human Angiotensinogen Expression in HepG2 Cells Are Dispensable in Transgenic Mice. Hypertension
31: 734-740
[Abstract][Full Text]
Rogus, J. J., Moczulski, D., Freire, M. B. S., Yang, Y., Warram, J. H., Krolewski, A. S.
(1998). Diabetic Nephropathy Is Associated With AGT Polymorphism T235 : Results of a Family-Based Study. Hypertension
31: 627-631
[Abstract][Full Text]
Ishigami, T., Umemura, S., Tamura, K., Hibi, K., Nyui, N., Kihara, M., Yabana, M., Watanabe, Y., Sumida, Y., Nagahara, T., Ochiai, H., Ishii, M.
(1997). Essential Hypertension and 5' Upstream Core Promoter Region of Human Angiotensinogen Gene. Hypertension
30: 1325-1330
[Abstract][Full Text]
Kunz, R., Kreutz, R., Beige, J., Distler, A., Sharma, A. M.
(1997). Association Between the Angiotensinogen 235T-Variant and Essential Hypertension in Whites : A Systematic Review and Methodological Appraisal. Hypertension
30: 1331-1337
[Abstract][Full Text]
Yanai, K., Saito, T., Hirota, K., Kobayashi, H., Murakami, K., Fukamizu, A.
(1997). Molecular Variation of the Human Angiotensinogen Core Promoter Element Located between the TATA Box and Transcription Initiation Site Affects Its Transcriptional Activity. J. Biol. Chem.
272: 30558-30562
[Abstract][Full Text]
Corvol, P., Jeunemaitre, X.
(1997). Molecular Genetics of Human Hypertension: Role of Angiotensinogen. Endocr. Rev.
18: 662-677
[Abstract][Full Text]
Kotanko, P., Binder, A., Tasker, J., DeFreitas, P., Kamdar, S., Clark, A. J. L., Skrabal, F., Caulfield, M.
(1997). Essential Hypertension in African Caribbeans Associates With a Variant of the ß2-Adrenoceptor. Hypertension
30: 773-776
[Abstract][Full Text]
Sato, N., Katsuya, T., Rakugi, H., Takami, S., Nakata, Y., Miki, T., Higaki, J., Ogihara, T.
(1997). Association of Variants in Critical Core Promoter Element of Angiotensinogen Gene With Increased Risk of Essential Hypertension in Japanese. Hypertension
30: 321-325
[Abstract][Full Text]
Atwood, L. D., Kammerer, C. M., Samollow, P. B., Hixson, J. E., Shade, R. E., MacCluer, J. W.
(1997). Linkage of Essential Hypertension to the Angiotensinogen Locus in Mexican Americans. Hypertension
30: 326-330
[Abstract][Full Text]
Rotimi, C., Cooper, R., Ogunbiyi, O., Morrison, L., Ladipo, M., Tewksbury, D., Ward, R.
(1997). Hypertension, Serum Angiotensinogen, and Molecular Variants of the Angiotensinogen Gene Among Nigerians. Circulation
95: 2348-2350
[Abstract][Full Text]
Hegele, R. A., Harris, S. B., Hanley, A. J. G., Sun, F., Connelly, P. W., Zinman, B.
(1997). Angiotensinogen Gene Variation Associated With Variation in Blood Pressure in Aboriginal Canadians. Hypertension
29: 1073-1077
[Abstract][Full Text]
Bloem, L. J., Foroud, T. M., Ambrosius, W. T., Hanna, M. P., Tewksbury, D. A., Pratt, J. H.
(1997). Association of the Angiotensinogen Gene to Serum Angiotensinogen in Blacks and Whites. Hypertension
29: 1078-1082
[Abstract][Full Text]
Schunkert, H., Hense, H.-W., Gimenez-Roqueplo, A., Stieber, J., Keil, U., Riegger, G. A.J., Jeunemaitre, X.
(1997). The Angiotensinogen T235 Variant and the Use of Antihypertensive Drugs in a Population-Based Cohort. Hypertension
29: 628-633
[Abstract][Full Text]
Kiema, T.-R., Kauma, H., Rantala, A. O., Lilja, M., Reunanen, A., Kesaniemi, Y. A., Savolainen, M. J.
(1996). Variation at the Angiotensin-Converting Enzyme Gene and Angiotensinogen Gene Loci in Relation to Blood Pressure. Hypertension
28: 1070-1075
[Abstract][Full Text]
Caulfield, M., Lavender, P., Newell-Price, J., Kamdar, S., Farrall, M., Clark, A. J.L.
(1996). Angiotensinogen in Human Essential Hypertension. Hypertension
28: 1123-1125
[Abstract][Full Text]
Hingorani, A. D., Sharma, P., Jia, H., Hopper, R., Brown, M. J.
(1996). Blood Pressure and the M235T Polymorphism of the Angiotensinogen Gene. Hypertension
28: 907-911
[Abstract][Full Text]
McLaughlin, K. J., Harden, P. N., Ueda, S., Boulton-Jones, J. M., Connell, J. M.C., Jardine, A. G.
(1996). The Role of Genetic Polymorphisms of Angiotensin-Converting Enzyme in the Progression of Renal Diseases. Hypertension
28: 912-915
[Abstract][Full Text]
Yanai, K., Nibu, Y., Murakami, K., Fukamizu, A.
(1996). A cis-Acting DNA Element Located between TATA Box and Transcription Initiation Site Is Critical in Response to Regulatory Sequences in Human Angiotensinogen Gene. J. Biol. Chem.
271: 15981-15986
[Abstract][Full Text]
Badenhop, R. F., Wang, X. L., Wilcken, D. E.L.
(1996). Association Between an Angiotensinogen Microsatellite Marker in Children and Coronary Events in Their Grandparents. Circulation
93: 2092-2096
[Abstract][Full Text]
Doria, A., Onuma, T., Gearin, G., Freire, M. B. S., Warram, J. H., Krolewski, A. S.
(1996). Angiotensinogen Polymorphism M235T, Hypertension, and Nephropathy in Insulin-Dependent Diabetes. Hypertension
27: 1134-1139
[Abstract][Full Text]
Gimenez-Roqueplo, A.-P., Leconte, I., Cohen, P., Simon, D., Guyene, T. T., Célerier, Jérôm., Pau, B., Corvol, P., Clauser, E., Jeunemaitre, X.
(1996). The Natural Mutation Y248C of Human Angiotensinogen Leads to Abnormal Glycosylation and Altered Immunological Recognition of the Protein. J. Biol. Chem.
271: 9838-9844
[Abstract][Full Text]
Brasier, A. R., Li, J., Wimbish, K. A.
(1996). Tumor Necrosis Factor Activates Angiotensinogen Gene Expression by the Rel A Transactivator. Hypertension
27: 1009-1017
[Abstract][Full Text]
Brasier, A. R., Li, J.
(1996). Mechanisms for Inducible Control of Angiotensinogen Gene Transcription. Hypertension
27: 465-475
[Abstract][Full Text]
Morishita, R., Higaki, J., Tomita, N., Aoki, M., Moriguchi, A., Tamura, K., Murakami, K., Kaneda, Y., Ogihara, T.
(1996). Role of Transcriptional cis-Elements, Angiotensinogen Gene–Activating Elements, of Angiotensinogen Gene in Blood Pressure Regulation. Hypertension
27: 502-507
[Abstract][Full Text]
Rotimi, C., Puras, A., Cooper, R., McFarlane-Anderson, N., Forrester, T., Ogunbiyi, O., Morrison Ryk Ward, L.
(1996). Polymorphisms of Renin-Angiotensin Genes Among Nigerians, Jamaicans, and African Americans. Hypertension
27: 558-563
[Abstract][Full Text]
Bromberg, J.E.C., Rinkel, G.J.E., Algra, A., van den Berg, U.A.C., Tjin-A-Ton, M.L.R., van Gijn, J.
(1996). Hypertension, Stroke, and Coronary Heart Disease in Relatives of Patients With Subarachnoid Hemorrhage. Stroke
27: 7-9
[Abstract][Full Text]
Postma, D. S., Bleecker, E. R., Amelung, P. J., Holroyd, K. J., Xu, J., Panhuysen, C. I.M., Meyers, D. A., Levitt, R. C.
(1995). Genetic Susceptibility to Asthma -- Bronchial Hyperresponsiveness Coinherited with a Major Gene for Atopy. NEJM
333: 894-900
[Abstract][Full Text]
Teo, K. K
(1995). Angiotensin converting enzyme genotypes and disease. BMJ
311: 763-764
[Full Text]
Hubner, N., Kreutz, R., Takahashi, S., Ganten, D., Lindpaintner, K.
(1995). Altered Angiotensinogen Amino Acid Sequence and Plasma Angiotensin II Levels in Genetically Hypertensive Rats : A Study on Cause and Effect. Hypertension
26: 279-284
[Abstract][Full Text]
Tomita, N., Morishita, R., Higaki, J., Aoki, M., Nakamura, Y., Mikami, H., Fukamizu, A., Murakami, K., Kaneda, Y., Ogihara, T.
(1995). Transient Decrease in High Blood Pressure by In Vivo Transfer of Antisense Oligodeoxynucleotides Against Rat Angiotensinogen. Hypertension
26: 131-136
[Abstract][Full Text]
Lodwick, D., Kaiser, M. A., Harris, J., Cumin, F., Vincent, M., Samani, N. J.
(1995). Analysis of the Role of Angiotensinogen in Spontaneous Hypertension. Hypertension
25: 1245-1251
[Abstract][Full Text]
Kamitani, A., Rakugi, H., Higaki, J., Ohishi, M., Shi, S.-J., Takami, S., Nakata, Y., Higashino, Y., Fujii, K., Mikami, H., Miki, T., Ogihara, T.
(1995). Enhanced Predictability of Myocardial Infarction in Japanese by Combined Genotype Analysis. Hypertension
25: 950-953
[Abstract][Full Text]
Iwai, N., Shimoike, H., Ohmichi, N., Kinoshita, M.
(1995). Angiotensinogen Gene and Blood Pressure in the Japanese Population. Hypertension
25: 688-693
[Abstract][Full Text]
Haber, E.
(1995). Angiotensin-Converting Enzyme and Lipoprotein(a) as Risk Factors for Myocardial Infarction. Circulation
91: 1888-1890
[Full Text]