The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
Original Article
Volume 330:1629-1633 June 9, 1994 Number 23
NextNext

Linkage of the Angiotensinogen Gene to Essential Hypertension
Mark Caulfield, Paul Lavender, Martin Farrall, Patricia Munroe, Mary Lawson, Paul Turner, and Adrian Clark

 

This Article
-Abstract

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation
ABSTRACT

Background The renin-angiotensin system is a powerful pressor system with a major influence on salt and water homeostasis. Angiotensinogen (also called renin substrate) is a key component of this system; it is cleaved by renin to yield angiotensin I, which is then cleaved by angiotensin-converting enzyme to yield angiotensin II. The observation that plasma angiotensinogen levels correlate with blood pressure and track through families suggests that angiotensinogen may have a role in essential hypertension. We therefore investigated whether there is linkage between the angiotensinogen gene on chromosome 1q42-43 and essential hypertension.

Methods Samples of DNA from 63 white European families in which two or more members had essential hypertension were tested for linkage of the angiotensinogen gene to this disorder. Affected cousins, nephews, nieces, and half-siblings were included when possible. To test for linkage, we used as a marker a dinucleotide-repeat sequence flanking this gene, and we employed the affected-pedigree-member method of linkage analysis. Two molecular variants of the angiotensinogen gene, one encoding threonine instead of methionine at position 235 (M235T) and the other encoding methionine rather than threonine at position 174 (T174M), were also tested for possible association with essential hypertension.

Results We found significant linkage (t = 5.00, P<0.001) and association (chi-square = 53.3, P<0.001) of the angiotensinogen-gene locus to essential hypertension in the 63 multiplex families. This linkage was consistently maintained in the subgroup of subjects with diastolic pressure above 100 mm Hg and in the subgroups classified according to sex. It has been proposed previously that T174M and M235T are associated with essential hypertension. However, we found no association in our population between either polymorphism and this disorder.

Conclusions This study provides strong and consistent support for the linkage to essential hypertension of regions within or close to the angiotensinogen gene. Precisely how mutations in this region may result in hypertension remains to be determined.


Essential hypertension represents the upper quintile of the blood-pressure distribution in the general population and is a major risk factor for morbidity and mortality from cardiovascular causes1. The causes of essential hypertension, which accounts for 90 percent of high blood pressure, have not yet been determined. Studies of families and twins imply that 20 to 40 percent of essential hypertension may have a genetic basis2. Epidemiologic studies indicate a continuous distribution of blood pressure in the population, and the genetic basis of this disorder appears to be polygenic and therefore does not follow simple mendelian patterns of inheritance3. It is likely that several genes interact with environmental stimuli to produce high blood pressure in susceptible persons4.

The renin-angiotensin system influences vascular tone, cardiovascular remodeling, and salt and water homeostasis, and this system is closely involved in the physiologic regulation of blood pressure5. For these reasons, genes encoding components of this system are attractive candidates for the investigation of the genetic basis of essential hypertension. The angiotensinogen gene has recently been linked to essential hypertension in affected sibships6. In study populations from France and Utah, 15 DNA polymorphisms of differing frequency were identified in this gene. Two of them within exon 2 -- one with threonine instead of methionine at position 235 (M235T) and one with methionine rather than threonine at position 174 (T174M) -- were found to be significantly associated with hypertension6.

In the investigation of the genetic basis of polygenic disorders, it is critical to be able to substantiate the linkage of candidate genes or markers in pairs of affected relatives in different populations7. We sought to determine whether there was linkage of the angiotensinogen gene to essential hypertension in affected white European families from the United Kingdom. We also set out to develop a simple, reproducible method for analyzing the angiotensinogen-gene variants M235T and T174M and testing whether they are associated with hypertension in this population.

Methods

Multiplex Families with Hypertension and Controls

After ethical approval was given in 1990, 63 families containing two or more members with essential hypertension were identified at the hypertension clinic of St. Bartholomew's Hospital and three primary care clinics in southeast England. All the subjects were white Europeans, had begun to have hypertension before the age of 60 years, and had had diastolic pressures above 95 mm Hg on three occasions or were being treated for essential hypertension. After the identification of the proband, a family history was taken, and only affected relatives as defined by the above criteria were studied. To maximize genetic informativeness, affected cousins, nieces, nephews, and half-siblings were included whenever possible. Hence, these affected relatives form "multiplex" families rather than simply affected sibling pairs. Families in which any member had secondary hypertension as defined by clinical evidence of intrinsic renal disease or renovascular hypertension were excluded. A population-based control group of 64 white Europeans was identified at primary care clinics to provide control allele frequencies. Genomic DNA was isolated by phenol-chloroform extraction from whole blood drawn into tubes containing potassium EDTA8.

Analysis of the Angiotensinogen Dinucleotide GT-Repeat Sequence

The angiotensinogen 3' dinucleotide repeat9 was analyzed by amplification using the polymerase chain reaction (PCR) with primer pairs 5'AATGGGAAGTTAGGTCAGG3' and 5'TAGGCACTTGCAACTCCAGG3'. PCR was performed on approximately 250 ng of genomic DNA, with 50 nmol of one unlabeled primer and approximately 5 nmol of the opposite-strand primer that had previously been labeled with [32P]ATP with T4 polynucleotide kinase (New England Biolabs, Bishops Stortford, United Kingdom)8. The reactions were carried out in a total volume of 25 microl containing 50 mM potassium chloride, 2.5 mM magnesium chloride, 10 mM TRIS-hydrochloric acid (pH 9.0), 0.1 percent Triton X-100, 100 µmol of each deoxynucleotide triphosphate, and 0.5 U of Taq polymerase. This involved an initial denaturation at 94 °C, followed by 25 cycles of one minute at 94 °C, one minute at 61 °C, and one minute at 72 °C. Radioactive fragments were analyzed by electrophoresis through 5 percent denaturing polyacrylamide gels containing 8 M urea, 89 mM TRIS base, 89 mM boric acid, and 2 mM EDTA. The gels were run for approximately 4 hours at a constant voltage of 1350 V, dried, and exposed for 12 hours to Kodak XAR-2 film for autoradiography8.

M235T and T174M Genotypes of Angiotensinogen

The M235T and T174M polymorphisms were investigated by PCR amplification of genomic DNA followed by restriction-endonuclease digestion. Genomic DNA (250 ng) was amplified with 50 nmol of each unlabeled primer (5'GATGCGCACAAGGTCCTG3' and 5'CAGGGTGCTGTCCACACTGGCTCGC3') in a total volume of 50 microl containing 50 mM potassium chloride, 2.5 mM magnesium chloride, 10 mM TRIS-hydrochloric acid (pH 9.0), 0.1 percent Triton X-100, 100 µmol of each deoxynucleotide triphosphate, and 0.5 U of Taq polymerase. There was an initial denaturation at 94 °C, followed by 25 cycles of one minute at 94 °C, one minute at 61 °C, and one minute at 72 °C. The most 3' guanosine residue in the longer oligonucleotide is mismatched with genomic DNA, which (depending on the sequence) creates an SfaNI restriction site during amplification. If the codon 235 is ATG (M235), digestion with SfaNI yields a 266-bp product relative to the undigested 303-bp product (T235). After restriction-endonuclease digestion, fragments were analyzed by electrophoresis through 5 percent polyacrylamide gels (Figure 1). The T174M genotype was determined by digestion of the same 303-bp amplified product with an existing NcoI cutting site. After digestion at 37 °C with NcoI (New England Biolabs), the genotypes of the samples were determined by size fractionation on ethidium-stained 1 percent agarose TRIS borate EDTA gels (Figure 1). All persons were studied for the M235T and T174M genotypes in a blinded fashion.


View larger version (8K):
[in this window]
[in a new window]
 
Figure 1. Genotype Determination of M235T and T174M on Ethidium-Stained Gels.

The variant M235 was cut by digestion with SfaNI to form a 266-bp fragment relative to a 303-bp 235T fragment. The 174M variant was cut to form 211- and 92-bp fragments by digestion with NcoI, as described in the Methods section.

 
Single-Strand Sequencing of Exon 2

Genomic DNA was amplified with 50 ng of each primer pair (biotinylated 5'TAAAGGTCAGTTAATAACCACC3' and 5' CCATCTCCAAGGCCTGACTGGC3') in PCR mixture as described above, with cycles of 94 °C for three minutes followed by 25 cycles of 94 °C for one minute, 63 °C for one minute, and 72 °C for one minute. The biotinylated product was purified on M-280 streptavidin paramagnetic beads (Dynabeads, Dynal, Norway), and single-stranded templates were prepared by denaturation with 100 mM sodium hydroxide. Once neutralized, the antisense template was subjected to T7 sequencing with a Pharmacia kit (Uppsala, Sweden) and the primer 5'GATGCGCACAAGTCCTG3'. The sequences of a substantial proportion of the undigested products (i.e., T235 and products from heterozygotes) were analyzed on 5 percent denaturing polyacrylamide gels as described, followed by autoradiography. The genotypes previously assigned by restriction analysis were confirmed with 100 percent specificity.

Statistical Analysis

The affected-pedigree-member method of linkage analysis is an established statistical test for the investigation of the genetic basis of complex traits, such as essential hypertension10,11,12,13. This method was used to compute a t-statistic that tested whether affected relatives shared alleles at the angiotensinogen locus more often than would be expected by chance10,11. This t-statistic based on allele sharing does not involve parental genotypes and is weighted to permit the excessive sharing of rare alleles to outweigh the sharing of common alleles (the intermediate weighting function 1/[p was used, where p denotes the frequency of shared marker alleles)10,11.

Such analyses make no explicit assumptions about mode of inheritance, genotype penetrance, or the presence of phenocopies and are particularly useful for disorders of late onset in which parental genotypes may be unavailable10,11,14. This robustness is partly offset by the fact that the t-statistics derived by the affected-pedigree-member method are influenced by the numbers analyzed and should not be considered a direct measure of the strength of linkage. We present as an indicator of the strength of linkage the percentage of excess alleles shared in each data set.

The programs Apmmult (version 2.0) and Simmult were used to apply the algorithms devised by Weeks and Lange for use with the affected-pedigree-member method of linkage analysis10,11. The t-statistic for large data sets (i.e., those with more than 20 families) has an approximately normal distribution and is interpreted in a one-tailed test. Significant results from the Apmmult program were checked by computer simulation with the accompanying Simmult program. Both theoretical and empirical P values are reported.

The genotypes and allele frequencies for the GT repeat, M235T, and T174M were tested by the chi-square test for their association with hypertension in 63 index patients with hypertension and population-based controls. Entire families were not tested in this case-control comparison, because relatives may share alleles by virtue of their family relationship.

Results

Genetic Linkage of the Angiotensinogen Gene to Essential Hypertension

In the test for linkage, we used a dinucleotide GT-repeat sequence in the 3' flanking region of the angiotensinogen gene with a heterozygosity of 77 percent9. Sixty-three multiplex white European families, including 149 affected relatives with essential hypertension identified at a hospital hypertension clinic and three primary care clinics, were genotyped in a blinded fashion with this GT repeat. These sibships were selected under strict criteria, as described in the Methods section, and their demographic characteristics are summarized in Table 1. Control allele frequencies were determined in a random population of 64 unrelated white Europeans and found to be similar to published frequencies in the large reference pedigrees of the Centre d'Etude du Polymorphisme Humain9. The data were tested for linkage by the affected-pedigree-member method, which uses identity-by-state scoring to take account of allele sharing10,11.

View this table:
[in this window]
[in a new window]
 
Table 1. Demographic Characteristics of 149 Persons with Essential Hypertension Who Belonged to 63 Multiplex Families.

 
Linkage was detected among the 63 multiplex families (t = 5.00, P<0.001) (Table 2) after comparison with the marker-allele frequencies in the 64 control subjects. In 40 of the 63 families, there was a 25.9 percent excess of shared alleles. The affected-pedigree-member method is known to be sensitive to marker-allele frequencies; for example, recalculation with the published marker frequencies yielded a t-statistic of 7.709.

View this table:
[in this window]
[in a new window]
 
Table 2. Linkage between the Angiotensinogen Dinucleotide Repeat and the Presence of Essential Hypertension in Affected Sibships.

 
The difference between the observed and the expected frequency distributions of the family-by-family t-statistics in the 63 families can be seen in a histogram (Figure 2). The expected distribution was computed under the null hypothesis that affected family members share a proportion of marker alleles that is consistent with the independent segregation of the marker and the disease. There is a clear shift to the right for the observed distribution, supporting the hypothesis of linkage of the angiotensinogen GT-repeat sequence to hypertension.


View larger version (15K):
[in this window]
[in a new window]
 
Figure 2. Distribution of the Observed and Expected Frequencies of Shared Alleles, as Indicated by the t-Statistic, in 63 Multiplex Families with Essential Hypertension.

The t-statistic tests whether affected relatives share alleles at the angiotensinogen locus more often than would be expected by chance. The observed scores are shifted to the right, suggesting a linkage between the angiotensinogen gene and essential hypertension.

 
Multiple different alleles were shared in excess at this locus, making it unlikely that stratification of the population produced an artificial increase in allele sharing. This is demonstrated by inspecting the genotypes and allele frequencies of the index patients with hypertension and the control subjects (Table 3). This comparison of genotypes was tested for association with hypertension by the chi-square test, and a significant association was found (chi-square = 53.3, 10 df, P<0.001) (Table 3).

View this table:
[in this window]
[in a new window]
 
Table 3. Angiotensinogen GT-Repeat Genotypes in 63 Hypertensive Patients and 64 Controls.

 
In view of the quantitative nature of blood pressure and the previous finding of a stronger linkage with diastolic blood pressure greater than 100 mm Hg, we stratified the families according to the severity of hypertension6. Thirty-one families had pairs of affected relatives with diastolic pressures greater than 100 mm Hg, and there was evidence of linkage in this subgroup (t = 3.65, P<0.001); they shared alleles at a frequency 25.1 percent higher than expected (Table 2). Although 71 percent of the cohort was receiving antihypertensive-drug treatment at the time of recruitment, we were able to determine pretreatment blood pressures for 69 percent of the families from primary care records and from the data base at our hypertension clinic. On the basis of these records, at least 63 percent of the cohort had diastolic blood pressures higher than 100 mm Hg.

Linkage was also tested according to sex. Despite the small number of male-male pairs (18), linkage remained significant (t = 2.09, P<0.018), with a frequency of shared alleles 17.0 percent higher than expected. The 28 female-female pairs also showed linkage between hypertension and the angiotensinogen gene (t = 3.73, P<0.001), and allele sharing was 29.1 percent higher than expected, in contrast with previous findings6 (Table 2).

Angiotensinogen-Gene Variants M235T and T174M

Using restriction enzymes, we determined the frequency of the M235T and T174M genotypes in index patients from the 63 families and in 80 control subjects (Figure 1). Only index patients with hypertension were studied, and the genotype of each variant was determined in those patients and compared with those of control subjects identified by population screening. Both populations were in Hardy-Weinberg equilibrium. The allele frequencies for the two variants were very similar in the hypertensive patients and the controls, and neither M235T nor T174M was significantly associated with hypertension (Table 4). Both M235T and T174M were tested for linkage by the affected-pedigree-member method in the 63 families, and there was no evidence that either polymorphism was linked to hypertension (t-statistic for M235T, -0.411, P = 0.68; t-statistic for T174M, -0.86313, P = 0.65).

View this table:
[in this window]
[in a new window]
 
Table 4. Tests of Association between Angiotensinogen Variants and Hypertension.

 
Discussion

The linkage of the angiotensinogen-gene locus to essential hypertension provides valuable confirmation that a susceptibility locus on human chromosome lq42-43 may contribute to the development of hypertension. This has now been shown in two studies, including three affected sibships of white European ancestry6. There is complementary support for these data in physiologic observations that elevated blood pressure tracks with high plasma levels of angiotensinogen in families15. In addition, hypertension develops in transgenic animal models in association with overexpression of the angiotensinogen gene16. Interestingly, the same GT-repeat sequence analyzed here has been linked to proteinuric preeclampsia in Scottish and Icelandic families17.

The problems of determining the genetic basis of polygenic disease are highlighted in the cases of schizophrenia and atopy, in which linkage of putative markers has not thus far been replicated in other populations18,19. These conflicting findings may reflect differences in ascertainment of families, variable penetrance of causative genes, or alternative definitions of the disease phenotype.

The striking feature of our study is the consistency of the linkage detected by the affected-pedigree-member method, in that linkage was detected in both sexes and in a group of more severely affected families. In the previous study of this gene locus, sibships were stratified according to the severity of diastolic hypertension (>100 mm Hg) or the receipt of two or more antihypertensive agents. Although these criteria are arbitrary thresholds for severity, there is evidence to suggest that such stratification may be important6. In the present study, linkage was not more significant for the 31 families with diastolic pressures greater than 100 mm Hg than for the overall cohort. This may be explained by the high median (±SD) diastolic blood pressure of 102 ±7 mm Hg in the 63 families. This finding suggests that even though the subjects in 71 percent of families were receiving drug treatment, the cohort still contained persons with markedly elevated diastolic pressure. These observations, in tandem with previous data, imply that in the genetic study of this quantitative trait it may be critical to define more severely affected persons in order to link a marker to hypertension6.

The percentage of excess alleles shared offers an indication of the strength of the linkage in this population, which shows an excess percentage that is consistent among all 63 families and among the 31 families with more severely affected pairs of relatives. The positive association of the angiotensinogen GT-repeat sequence with hypertension and the excess sharing of several alleles imply that this locus has a high probability of harboring a susceptibility gene for essential hypertension. There may be several different mutations within or close to the angiotensinogen gene that contribute to the development of essential hypertension. Since different alleles of the angiotensinogen repeat sequence were significantly over- and underrepresented in the patients, both susceptibility and protective angiotensinogen-gene variants may exist. However, this study does not provide direct evidence in support of this concept. These observations raise the possibility that analysis of other populations may reveal important differences in the gene variants.

It has previously been suggested that the angiotensinogen-gene variant M235T, or perhaps less likely T174M, may be the factor that contributes to the hypertension phenotype6. The M235T polymorphism has also recently been associated with preeclampsia20. These polymorphisms are at some distance from the angiotensin-cleavage sites in the angiotensinogen molecule21. Accordingly, it is unclear how these variants might functionally influence the activity of the renin-angiotensin system. We did not find significant associations of either variant with hypertension as compared with two population-based control groups. The absence of linkage of M235T and T174M with hypertension reflects the lack of informativeness of these polymorphisms and is not surprising. Furthermore, direct sequencing of the region of exon 2 that contains these variants was used to confirm the genotypes ascribed by restriction analysis to several members of the cohort. Therefore, we cannot conclude that either of these polymorphisms is acting as a marker or playing a directly causative part in relation to hypertension in our population.

The renin-angiotensin system includes other candidate genes that could be implicated in the genetic basis of essential hypertension. In contrast to the promising data from animal models of hypertension, the renin gene and the angiotensin-converting-enzyme gene have both been the focus of negative linkage studies in affected white sibships22,23,24,25. Angiotensinogen is a crucial rate determinant of this pressor system, and regions within or near the angiotensinogen gene on chromosome 1q42-43 have now been linked to essential hypertension in two separate investigations6. Our findings suggest that a further search for mutations in the angiotensinogen gene that might result in hypertension is needed in this population.

Supported by the Joint Research Board of St. Bartholomew's Hospital, the Medical Research Council of Great Britain, the Fellowship of Postgraduate Medicine, and the Mason Medical Research Foundation.

We are indebted to the families and doctors from Bersted Green Surgery in Bognor Regis, St. John's Hill Surgery in Sevenoaks, Queensbridge Road Surgery in Hackney, and the hypertension clinic at St. Bartholomew's Hospital.


Source Information

From the Departments of Clinical Pharmacology (M.C., P.M., M.L., P.T.) and Chemical Endocrinology (P.L., A.J.L.C.), St. Bartholomew's Hospital; and the Medical Research Council Molecular Medicine Group, Royal Postgraduate Medical School (M.F.) -- both in London.

Address reprint requests to Dr. Caulfield at the Department of Clinical Pharmacology, St. Bartholomew's Hospital, London EC1A 7BE, United Kingdom.

References

  1. MacMahon S, Peto R, Cutler J, et al. Blood pressure, stroke and coronary heart disease: part 1, prolonged differences in blood pressure: prospective observational studies corrected for the regression dilution bias. Lancet 1990;335:765-774. [CrossRef][Medline]
  2. Ward R. Familial aggregation and genetic epidemiology of blood pressure. In: Laragh JH, Brenner BM, eds. Hypertension: pathophysiology, diagnosis, and management. Vol. 1. New York: Raven Press, 1990:81-100.
  3. Pickering G. Hyperpiesis: high blood-pressure without evident cause: essential hypertension. BMJ 1965;2:1021-1026.
  4. Williams RR, Hunt SC, Hasstedt SJ, et al. Current knowledge regarding the genetics of human hypertension. J Hypertens Suppl 1989;7:S8-S13. [Medline]
  5. MacGregor GA, Markandu ND, Roulston JE, Jones JC, Morton JJ. Maintenance of blood pressure by the renin-angiotensin system in normal man. Nature 1981;291:329-331. [CrossRef][Medline]
  6. Jeunemaitre X, Soubrier F, Kotelevtsev YV, et al. Molecular basis of human hypertension: role of angiotensinogen. Cell 1992;71:169-180. [CrossRef][Medline]
  7. Kurtz TW, Spence MA. Genetics of essential hypertension. Am J Med 1993;94:77-84. [CrossRef][Medline]
  8. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1989.
  9. Kotelevtsev YV, Clauser E, Corvol P, Soubrier F. Dinucleotide repeat polymorphism in the human angiotensinogen gene. Nucleic Acids Res 1991;19:6978-6978. [Free Full Text]
  10. Weeks DE, Lange K. The affected-pedigree-member method of linkage analysis. Am J Hum Genet 1988;42:315-326. [Medline]
  11. Weeks DE, Lange K. A multilocus extension of the affected-pedigree-member method of linkage analysis. Am J Hum Genet 1992;50:859-868. [Medline]
  12. Pericak-Vance MA, Bebout JL, Gaskell PC Jr, et al. Linkage studies in familial Alzheimer disease: evidence for chromosome 19 linkage. Am J Hum Genet 1991;48:1034-1050. [Medline]
  13. Hall JM, Lee MK, Newman B, et al. Linkage of early-onset familial breast cancer to chromosome 17q21. Science 1990;250:1684-1689. [Free Full Text]
  14. Bishop DT, Williamson JA. The power of identity-by-state methods for linkage analysis. Am J Hum Genet 1990;46:254-265. [Medline]
  15. Watt GCM, Harrap SB, Foy CJW, et al. Abnormalities of glucocorticoid metabolism and the renin-angiotensin system: a four-corners approach to the identification of genetic determinants of blood pressure. J Hypertens 1992;10:473-482. [Medline]
  16. Kimura S, Mullins JJ, Bunnemann B, et al. High blood pressure in transgenic mice carrying the rat angiotensinogen gene. EMBO J 1992;11:821-827. [Medline]
  17. Arngrimsson R, Purandare S, Connor M, et al. Angiotensinogen: a candidate gene involved in preeclampsia? Nat Genet 1993;4:114-115. [CrossRef][Medline]
  18. Split verdict on schizophrenia. Nat Genet 1992;1:231-232. [Medline]
  19. Marsh DG, Meyers DA. A major gene for allergy -- fact or fancy? Nat Genet 1992;2:252-254. [CrossRef][Medline]
  20. Ward K, Hata A, Jeunemaitre X, et al. A molecular variant of angiotensinogen associated with preeclampsia. Nat Genet 1993;4:59-61. [CrossRef][Medline]
  21. Gaillard I, Clauser E, Corvol P. Structure of human angiotensinogen gene. DNA 1989;8:87-99. [Medline]
  22. Hilbert P, Lindpaintner K, Beckmann JS, et al. Chromosomal mapping of two genetic loci associated with blood-pressure regulation in hereditary hypertensive rats. Nature 1991;353:521-529. [CrossRef][Medline]
  23. Kurtz TW, Simonet L, Kabra PM, et al. Cosegregation of the renin allele of the spontaneously hypertensive rat with an increase in blood pressure. J Clin Invest 1990;85:1328-1332.
  24. Jeunemaitre X, Lifton RP, Hunt SC, Williams RR, Lalouel JM. Absence of linkage between the angiotensin converting enzyme locus and human essential hypertension. Nat Genet 1992;1:72-75. [CrossRef][Medline]
  25. Jeunemaitre X, Rigat B, Charru A, Houot A-M, Soubrier F, Corvol P. Sib pair linkage analysis of renin gene haplotypes in human essential hypertension. Hum Genet 1992;88:301-306. [Medline]

 

This Article
-Abstract

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation

This article has been cited by other articles:



HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  TERMS OF USE  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved.