The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
Original Article
PreviousPrevious
Volume 330:249-255 January 27, 1994 Number 4
NextNext

Abnormalities of PIG-A Transcripts in Granulocytes from Patients with Paroxysmal Nocturnal Hemoglobinuria
Toshio Miyata, Norio Yamada, Yoshiyasu Iida, Junichi Nishimura, Junji Takeda, Teruo Kitani, and Taroh Kinoshita

 

This Article
-Abstract

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation
ABSTRACT

Background Paroxysmal nocturnal hemoglobinuria (PNH) is an acquired disorder in which there is a deficiency in the synthesis by hematopoietic cells of the glycosyl-phosphatidylinositol molecules that anchor proteins to the cell membrane. Recently, we demonstrated that a gene termed PIG-A (for phosphatidylinositol glycan class A), a component of glycosyl-phosphatidylinositol biosynthesis, was responsible for PNH in two patients. The present study was undertaken to elucidate whether PIG-A is the gene responsible for all cases of PNH and to characterize further the somatically acquired abnormalities of this gene.

Methods We studied granulocytes from 15 patients with PNH. The cell content of CD55 and CD59 was assessed by fluorescence-activated flow cytometry. PIG-A transcripts were reverse-transcribed, amplified by the polymerase chain reaction, and cloned into plasmids. The structure of the cloned complementary DNA was analyzed by nucleotide sequencing, and its function was assessed on the basis of its ability to restore to normal the abnormal phenotype of a PIG-A-deficient cell line after transfection.

Results Three patients had size abnormalities of PIG-A transcripts with different patterns, and in one patient a very low level of the PIG-A transcript was found. Eleven patients had transcripts of normal size, but the transfection assay revealed that in each patient some of them were nonfunctional. The percentage of nonfunctional PIG-A transcripts was correlated with the percentage of affected granulocytes (P<0.001). Sequence analysis demonstrated somatic mutations in two of the patients.

Conclusions PIG-A is the gene responsible for PNH in all patients studied to date.


Paroxysmal nocturnal hemoglobinuria (PNH) is an acquired disorder of blood cells in which the affected cells originate from an abnormal hematopoietic stem cell; the condition is characterized by nocturnal hemoglobinuria, chronic hemolytic anemia, and thrombosis1,2. Complement-mediated hemolysis is a prominent feature of the disease and is due to deficient cell-surface expression of decay-accelerating factor (CD55) and CD59, which protect blood cells from the action of complement3. The fundamental cause of these deficiencies is defective synthesis of the molecules of glycosyl-phosphatidylinositol that anchor these and many other proteins to the cell membrane4,5.

We have shown that cell lines from two patients with PNH and a chemically induced mutant cell line deficient in glycosyl-phosphatidylinositol had the same defective gene6. We termed this gene PIG-A, for phosphatidylinositol glycan class A, because the mutant belonged to class A of complementation groups of glycosyl-phosphatidylinositol-deficient mutant cells7. We isolated its complementary DNA (cDNA) and found that it is involved in the synthesis of the first intermediate compound in glycosyl-phosphatidylinositol biosynthesis7. Recently, we found that PIG-A cDNA corrected the deficient phenotype of cell lines affected by PNH, and we identified a somatic mutation that caused loss of function of PIG-A in one patient8. The location of the PIG-A gene on the X chromosome accounted for the phenotypic expression of this mutation8.

In this study, we used granulocytes from peripheral blood or bone marrow obtained from 15 patients to analyze the structure and function of PIG-A messenger RNA (mRNA) in patients with PNH. Fluorescence-activated flow cytometry revealed granulocytes with deficient surface expression of proteins anchored by glycosyl-phosphatidylinositol. The PIG-A mRNA from granulocytes affected by PNH was subjected to reverse transcription, and the resulting cDNA was amplified with the polymerase chain reaction (PCR) and then cloned. The structure of the cDNA was analyzed by gel electrophoresis and nucleotide sequencing; the assessment of function was based on the ability of the cDNA to correct the phenotype of a PIG-A-deficient cell line after transfection. Abnormalities in the PIG-A mRNA transcripts were found in all 15 patients. We conclude that PIG-A is the gene responsible for the causal somatic mutation in most if not all patients with PNH.

Methods

Patients and Blood Samples

We examined blood samples from 15 Japanese patients with PNH. All the patients had a positive Ham's test, which detects erythrocytes abnormally sensitive to complement. One patient (Patient 12) had aplastic anemia, but the other patients had no other hematologic disorders. With the informed consent of the patients, peripheral-blood samples, which were treated with heparin, or bone marrow cells were obtained. Granulocytes were isolated from the blood after other cell types had been eliminated by sedimentation in 6 percent dextran and Ficoll-Hypaque centrifugation (Pharmacia, Uppsala, Sweden). An additional patient, Patient 16, and an affected B-lymphoblastoid cell line established from Patient 16 have been described elsewhere9.

Fluorescence-Activated Flow Cytometry

Cells were stained for CD55 and CD59 with biotinylated IA1010 and 5H8 (a gift from Drs. M. Tomita and Y. Sugita) monoclonal antibodies, respectively, and with phycoerythrin-conjugated streptavidin (Biomeda, Foster City, Calif.). The cells were then analyzed by flow cytometry (FACScan, Becton Dickinson, Lincoln Park, N.J.).

Reverse Transcription and PCR

RNA11 isolated from granulocytes and the cell line from Patient 16 was subjected to reverse transcription with primer 13 (AATGATATAGAGGTAGCATAAC) (Figure 1A), as described elsewhere8. The coding region of PIG-A was then amplified with primers 11 (ACCAGAGCTCGGTTGCTCTAAGAACTGATGTC) and 12 (ACCAGGTACCTCTTACAATCTAGGCTTCCTTC) for 25 cycles of incubation; each cycle consisted of one minute of denaturation at 93 °C, one minute annealing at 55 °C, and two minutes of extension at 72 °C. The PCR products were labeled with 32P-labeled deoxycitidine triphosphate ([32P]dCTP) (Amersham, Buckinghamshire, United Kingdom), separated by agarose-gel electrophoresis, and visualized by autoradiography. In some experiments, parts of the coding region of PIG-A were amplified with different sets of primers -- i.e., primers A1 (ACATTTACCAGCTCTCTCAGTGC), A2 (ACAGCCACGACCCTCTTTCACAG), and B3 (TTCAGTGCTGCTCTTAGTACAG) (Figure 1A).


View larger version (48K):
[in this window]
[in a new window]
 
Figure 1. Analysis of PIG-A mRNA in Granulocytes from Patients with PNH.

Panel A shows the oligonucleotide primers used (arrowheads). The box indicates the coding region. Panel B, Panel C, and Panel D show the analysis of PIG-A mRNA from granulocytes, using reverse transcription and PCR. The radiolabeled products were analyzed by electrophoresis in 2 percent agarose gel and visualized by autoradiography. M denotes an amplification product from authentic PIG-A cDNA; 16, the affected cell line from Patient 16; 1 to 14, samples from the corresponding patients; and N1 and N2, samples from normal subjects.

 
The amplified products from the coding region of PIG-A were cloned into plasmids for transfection and sequencing. In this stage, the amplification reaction was repeated 35 times without [32P]dCTP with primers 11 and 12, which contained SacI and KpnI restriction sites, respectively. The products were cloned into a SacI- and KpnI-digested expression vector (pEB)12 based on Epstein-Barr virus or into SacI- and KpnI-digested pBluescript (Stratagene, La Jolla, Calif.).

To quantify the expression of PIG-A mRNA, the entire RNA was subjected to reverse transcription with random primers (Takara, Kyoto, Japan), and PIG-A and {beta}-actin cDNA was amplified by PCR using [32P]dCTP. During the initial six cycles of the reactions, in which each cycle consisted of one minute of denaturation at 93 °C, one minute of annealing at 55 °C, and two minutes of extension at 72 °C, only PIG-A cDNA was amplified with primers 10 (GAAGTCAGGGACATTGCCAGCTCCAGAAAACATCCATAACAT) and 13 (Figure 1A). Primers betaA1 (TACATGGCTGGGGTGTTGAA) and betaA2 (AAGAGAGGCATCCTCACCCT) for beta-actin were added, and PCR was continued for 36 more cycles to amplify both beta-actin and PIG-A. Samples removed after every three cycles were resolved by agarose-gel electrophoresis and visualized by autoradiography.

Transfection

To determine whether the cloned PIG-A cDNA prepared from the patients' granulocytes was functional, we transfected 10 µg of DNA from the pEB vector bearing PIG-A cDNA into PIG-A-deficient JY5 cells13 (2 x 106 cells in 0.8 ml of HeBS transfection buffer14) by electroporation at 250 V and 960 microF with a gene pulser (Bio-Rad, Hercules, Calif.). After 10 days of culture and selection with 400 µg of hygromycin B per milliliter, the transfected cells were stained for CD55 and CD59 and studied by flow cytometry.

Nucleotide Sequencing

Both strands of the cloned products of reverse transcription and PCR were sequenced with a dye-terminator kit and an automatic DNA sequencer (Applied Biosystems, Foster City, Calif.). Ten clones from each patient were sequenced, and mutations were confirmed by sequencing clones obtained from a second PCR amplification.

Results

All 15 patients studied had erythrocytes and granulocytes deficient in CD55 and CD59 (Table 1). We sought to determine whether this was due to abnormalities in the PIG-A gene. The coding region of the PIG-A transcripts from granulocytes was amplified by reverse transcription and PCR (Figure 1A). RNA from granulocytes of normal subjects yielded three amplification products (Figure 1D, lanes N1 and N2). The largest band (1500 base pairs [bp]) contained the entire coding region and aligned with an amplification product from authentic PIG-A cDNA (Figure 1B, lane M). The second and third largest bands (1200 bp and 850 bp, respectively) had a 374-bp deletion from nucleotide 342 to nucleotide 715 and a 658-bp deletion from nucleotide 58 to nucleotide 715. These shorter transcripts were probably produced by alternative splicing, because the deleted regions, which reside within an exon, both had potential 5'-splice sites (a guanine-thymine [GT] dinucleotide) at their 5' ends and because their 3' ends (at position 715) correspond to the 3' end of the exon.

View this table:
[in this window]
[in a new window]
 
Table 1. Results of the Analyses of PIG-A mRNA in Patients with PNH.

 
Most of the products obtained from the granulocytes affected by PNH by reverse transcription and PCR were of normal size and abundance (Figure 1B and Figure 1C, lanes 3 to 13), but the products from two patients (Patients 1 and 2; Figure 1B, lanes 1 and 2) were of abnormal size. In one patient (Patient 14; Figure 1C, lane 14), the ratios between the three amplification products were highly skewed.

Abnormalities in Size

The products of reverse transcription and PCR from Patient 2 (Figure 1B, lane 2) consisted of a major band of approximately 1300 bp and some smaller bands, but only a very small amount of the normal 1500-bp band. Because 90 percent of granulocytes in this patient were deficient in CD59 (Table 1), the 1300-bp band must have been derived from the affected granulocytes. We cloned this product and determined its nucleotide sequence. It had a 207-bp deletion from position 982 to position 1188 (Figure 2), which would result in a nonfunctional protein with a deletion of 69 amino acids. This 207-bp deletion was the same as that in the affected cells from Patient 16,8 and it corresponds to an entire exon8. Patient 2 was male, so there was no normal allele of PIG-A.


View larger version (28K):
[in this window]
[in a new window]
 
Figure 2. Alterations in PIG-A mRNA in Granulocytes from Three Patients with PNH.

Each panel shows the coding region of PIG-A cDNA, with nucleotide numbers, restriction-endonuclease sites, and the relevant region of the nucleotide sequence indicated. Regions unshaded in the cDNA and marked by arrows in the sequences have been spliced out. Small vertical bars indicate the normal reading frames. Stop codons generated by a frame shift are underlined. H denotes HindIII, S SalI, P PstI, RI EcoRI, and RV EcoRV.

 
Patient 1 also had a large, abnormal band of about 1400 bp (Figure 1B, lane 1) and little of the normal 1500-bp band. Since this patient had only CD59-deficient granulocytes (Table 1), the abnormal band must have been derived from those granulocytes. Sequence analysis of the cloned product demonstrated a 133-bp deletion from position 849 to position 981 (Figure 2), which would result in a frame shift and the appearance of a stop codon (TAA). This 133-bp region corresponds to an entire exon (unpublished data). This patient was female, so the active X chromosome must contain the affected PIG-A gene.

The products of reverse transcription and PCR from Patient 14 (Figure 1C, lane 14) showed an intense band at 850 bp and weaker bands at 1500 bp and 1200 bp. This pattern, together with the finding by flow cytometry that 43 percent of granulocytes were deficient in CD59, indicated that the 850-bp band was the major product of the affected cells and that the pattern of PIG-A transcripts was skewed. The 658-bp deletion in the 850-bp product causes a frame shift and the appearance of a stop codon (TAA) downstream.

Transfection of these three types of PIG-A cDNA with deletions into PIG-A-deficient JY5 cells did not restore the surface expression of CD59 (Table 1), confirming that the three types of cDNA are nonfunctional.

Point Mutations

To determine the function of the normal-sized PIG-A products of reverse transcription and PCR (Figure 1B and Figure 1C, lanes 3 to 13), we transfected the cloned products into PIG-A-deficient JY5 cells and tested for complementation of the deficient phenotype. Of 20 independent clones of cDNA derived from Patient 11, 5 restored the deficient surface expression of CD59 to normal. Fifteen clones (75 percent) did not, however, a proportion consistent with the percentage of deficient granulocytes (83 percent) in this patient (Table 1). In Patient 9, in whom 95 percent of the granulocytes were deficient in CD55 and CD59, all 20 clones failed to restore the defect in the JY5 cells (Table 1). We suggest, therefore, that some alterations in the nucleotide sequences resulted in nonfunctional PIG-A mRNA.

To confirm this, we determined the nucleotide sequences of cDNA clones from Patients 9 and 11. All 10 clones of nonfunctional PIG-A cDNA from Patient 11 had a deletion of one base (thymine) at position 408 (Figure 3A); this mutation was not found in functional PIG-A cDNA clones from this patient or in those from normal subjects. The deletion of thymine causes a frame shift and a stop codon (TAA) 106 bp downstream. Since this deletion eliminates an NlaIII restriction site, the PCR products from Patient 11 that were amplified with primers A2 and B3 were digested with NlaIII (Figure 3B). The product derived from a functional PIG-A cDNA clone from this patient (Figure 3B, lane 1) was sensitive to NlaIII, whereas that from a nonfunctional clone (Figure 3B, lane 2) was not. Overall, the PCR products amplified from reverse-transcribed RNA from this patient's granulocytes were partially sensitive to NlaIII (Figure 3B, lane 3). The apparent ratio of the insensitive to the sensitive fraction was about 3 to 1, a proportion consistent with the results of the flow-cytometric and transfection analyses, which showed, respectively, that 83 percent of granulocytes were CD59-deficient and that 75 percent of the cloned cDNA was nonfunctional.


View larger version (16K):
[in this window]
[in a new window]
 
Figure 3. Point Mutations of PIG-A mRNA in Granulocytes from Two Patients with PNH.

Panel A shows nucleotide sequences of the portion of mRNA that contains a mutation in Patients 11 and 9, with the corresponding normal sequences shown below. Sites of restriction endonucleases are shown, and horizontal arrows indicate PCR primers. Panel B shows the sensitivity of the PCR products to digestion by restriction endonucleases. The PCR products from Patient 11, as amplified with primers A2 and B3, and from Patient 9, as amplified with primers A1 and B3, were digested with NlaIII and HpaI, respectively. The digests were resolved by electrophoresis in an 8 percent acrylamide gel and stained with ethidium bromide. The templates used contained cloned PCR products with functional activity (lane 1), cloned products with no activity (lanes 2 and 5), all PCR products (lanes 3 and 6), and authentic PIG-A cDNA (lane 4).

 
In Patient 9, all 10 clones of nonfunctional PIG-A cDNA had an insertion of one base (adenine) between positions 245 and 246 (Figure 3A). Because this insertion of adenine generates a stop codon (TAA) and creates a new HpaI restriction site, the PCR products from Patient 9 amplified with primers A1 and B3 were digested with HpaI (Figure 3B). The PCR product from a nonfunctional PIG-A cDNA clone was sensitive to HpaI (Figure 3B, lane 5), whereas that from authentic PIG-A cDNA (Figure 3B, lane 4) was not. Almost all the PCR products amplified from RNA from granulocytes of this patient that had been subjected to reverse transcription were sensitive to HpaI (Figure 3B, lane 6), a result consistent with the analyses by flow cytometry and transfection.

We also performed transfections with samples from nine other patients with normal patterns when analyzed by reverse transcription and PCR (Figure 1B). In all these patients we detected a higher percentage of nonfunctional PIG-A clones than was found in normal subjects (Table 1). The correlation between the percentage of nonfunctional clones and that of granulocytes deficient in CD55 or CD59 was significant (P<0.001) (Figure 4), suggesting that the nonfunctional PIG-A mRNA was derived from the affected granulocytes. Twenty percent of the clones derived from granulocytes obtained from normal subjects were nonfunctional (Table 1). The reason for this is unknown, but either it is due to an experimental artifact, such as an error in PCR technique, or a fraction of normal-sized PIG-A transcripts may be aberrant.


View larger version (15K):
[in this window]
[in a new window]
 
Figure 4. Correlation between the Percentage of Granulocytes Deficient in CD59 or CD55, as Determined by Flow Cytometry, and the Percentage of Nonfunctional Clones of the PIG-A PCR Products.

Triangles indicate normal subjects.

 
Quantitative Abnormality in the Amplification of PIG-A Transcripts

In Patient 15, the analysis by reverse transcription and PCR used in other patients yielded no transcript (data not shown). We therefore compared the level of PIG-A mRNA expression with that of {beta}-actin mRNA. {beta}-Actin was amplified at similar rates in granulocytes from Patient 15 and in those from a normal subject, whereas PIG-A was amplified at a very low rate in granulocytes from Patient 15 (Figure 5). Since this patient had a few normal granulocytes, the small amount of PIG-A transcript amplified was thought to be derived from them.


View larger version (31K):
[in this window]
[in a new window]
 
Figure 5. Analysis of PIG-A mRNA in Granulocytes from Patient 15 and a Normal Subject.

RNA was subjected to reverse transcription with random primers and was formed into templates. During PCR, the radiolabeled amplification products were removed after every three cycles, separated by electrophoresis in 2 percent agarose gel, and visualized by autoradiography. The bands corresponding to PIG-A and {beta}-actin are shown. Lanes 1 and 7 were obtained after 24 cycles, lanes 2 and 8 after 27 cycles, lanes 3 and 9 after 30 cycles, lanes 4 and 10 after 33 cycles, lanes 5 and 11 after 33 cycles, and lanes 6 and 12 after 36 cycles.

 
Discussion

We have demonstrated abnormalities in the PIG-A gene transcripts of affected granulocytes from 15 Japanese patients with PNH. In three patients the abnormalities had different patterns with regard to size, but they all resulted in nonfunctional PIG-A proteins. In one patient the level of PIG-A transcripts was very low. In 11 patients the size and abundance of PIG-A transcripts were normal, but some transcripts of the normally sized coding region were found by transfection to be nonfunctional, suggesting that the affected cells from these patients also had mutations of PIG-A. In fact, in two patients we identified point mutations that led to nonfunctional PIG-A transcripts.

In our previous study with affected B-lymphoblastoid cell lines established from two other Japanese patients with PNH, the level of PIG-A transcripts in one patient was very low, and in the other a deletion of one base in a donor splice site caused abnormal splicing8. Therefore, all 17 Japanese patients with PNH studied so far have defects in the PIG-A gene. In addition, affected cell lines established from four British patients with PNH15 had PIG-A deficiencies (unpublished data), and affected cell lines in four patients from Germany and one patient with PNH from the Dominican Republic share the defective gene with the glycosyl-phosphatidylinositol-deficient mutant of complementation class A16. Since PIG-A is the gene defective in class A mutants,7 those cell lines must have PIG-A deficiencies. In all 26 patients with PNH who have been characterized so far, PIG-A is the responsible gene. When one considers that 10 or more genes are involved in the biosynthesis of glycosyl-phosphatidylinositol,17,18 the uniformity of these findings is remarkable. We have localized the PIG-A gene on p22.1 of the X chromosome,8 so the gene is haploid in somatic cells in males as well as in females because of the phenomenon of X inactivation. This uniformity is not surprising if all genes other than PIG-A are autosomal.

Supported by grants from the Ministry of Education, Science, and Culture of Japan and the Ono Medical Research Foundation.

We are indebted to Drs. T. Kageyama, Y. Kurata, Y. Kanayama, K. Yasunaga, Y. Kishimoto, T. Fujita, T. Masaoka, A. Kanamaru, K. Moriwaki, H. Fujii, N. Takemori, and K. Hirai for providing us with blood samples from patients, and to Ms. Maria Lourdes Parumog for excellent technical assistance.


Source Information

From the Departments of Immunoregulation (T.M., J.T., T. Kinoshita) and Internal Medicine (J.N., T. Kitani), Research Institute for Microbial Diseases, Osaka University, Osaka; and the Department of Internal Medicine, the Branch Hospital, Nagoya University School of Medicine, Nagoya (N.Y., Y.I.) -- both in Japan.

Address reprint requests to Dr. Kinoshita at the Department of Immunoregulation, Research Institute for Microbial Diseases, Osaka University, 3-1 Yamada-oka, Suita, Osaka 565, Japan.

References

  1. Rosse WF. Paroxysmal nocturnal hemoglobinuria: the biochemical defects and the clinical syndrome. Blood Rev 1989;3:192-200. [Medline]
  2. Rotoli B, Luzzatto L. Paroxysmal nocturnal haemoglobinuria. Baillieres Clin Haematol 1989;2:113-138. [CrossRef][Medline]
  3. Rosse WF. Dr. Ham's test revisited. Blood 1991;78:547-550. [Free Full Text]
  4. Mahoney JF, Urakaze M, Hall S, et al. Defective glycosylphosphatidylinositol anchor synthesis in paroxysmal nocturnal hemoglobinuria granulocytes. Blood 1992;79:1400-1403. [Free Full Text]
  5. Hirose S, Ravi L, Prince GM, et al. Synthesis of mannosylglucosaminylinositol phospholipids in normal but not paroxysmal nocturnal hemoglobinuria cells. Proc Natl Acad Sci U S A 1992;89:6025-6029. [Free Full Text]
  6. Takahashi M, Takeda J, Hirose S, et al. Deficient biosynthesis of N-acetylglucosaminyl-phosphatidylinositol, the first intermediate of glycosyl phosphatidylinositol anchor biosynthesis, in cell lines established from patients with paroxysmal nocturnal hemoglobinuria. J Exp Med 1993;177:517-521. [Free Full Text]
  7. Miyata T, Takeda J, Iida Y, et al. The cloning of PIG-A, a component in the early step of GPI-anchor biosynthesis. Science 1993;259:1318-1320. [Free Full Text]
  8. Takeda J, Miyata T, Kawagoe K, et al. Deficiency of the GPI anchor caused by a somatic mutation of the PIG-A gene in paroxysmal nocturnal hemoglobinuria. Cell 1993;73:703-711. [CrossRef][Medline]
  9. Ueda E, Nishimura J, Kitani T, et al. Deficient surface expression of glycosylphosphatidylinositol-anchored proteins in B cell lines established from patients with paroxysmal nocturnal hemoglobinuria. Int Immunol 1992;4:1263-1271. [Free Full Text]
  10. Kinoshita T, Medof ME, Silber R, Nussenzweig V. Distribution of decay-accelerating factor in the peripheral blood of normal individuals and patients with paroxysmal nocturnal hemoglobinuria. J Exp Med 1985;162:75-92. [Free Full Text]
  11. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156-159. [Medline]
  12. Margolskee RF, Kavathas P, Berg P. Epstein-Barr virus shuttle vector for stable episomal replication of cDNA expression libraries in human cells. Mol Cell Biol 1988;8:2837-2847. [Free Full Text]
  13. Hollander N, Selvaraj P, Springer TA. Biosynthesis and function of LFA-3 in human mutant cells deficient in phosphatidylinositol-anchored proteins. J Immunol 1988;141:4283-4290. [Abstract]
  14. Chu G, Hayakawa H, Berg P. Electroporation for the efficient transfection of mammalian cells with DNA. Nucleic Acids Res 1987;15:1311-1326. [Free Full Text]
  15. Hillmen P, Bessler M, Crawford DH, Luzzatto L. Production and characterization of lymphoblastoid cells lines with the paroxysmal nocturnal hemoglobinuria phenotype. Blood 1993;81:193-199. [Free Full Text]
  16. Armstrong C, Schubert J, Ueda E, et al. Affected paroxysmal nocturnal hemoglobinuria T lymphocytes harbor a common defect in assembly of N-acetyl-d-glucosamine inositol phospholipid corresponding to that in class A Thy-1- murine lymphoma mutants. J Biol Chem 1992;267:25347-25351. [Free Full Text]
  17. Masterson WJ, Doering TL, Hart GW, Englund PT. A novel pathway for glycan assembly: biosynthesis of the glycosyl-phosphatidylinositol anchor of the trypanosome variant surface of glycoprotein. Cell 1989;56:793-800. [CrossRef][Medline]
  18. Tartakoff AM, Singh N. How to make glycoinositol phospholipid anchor. Trends Biochem Sci 1992;17:470-473. [CrossRef][Medline]

 

This Article
-Abstract

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation

This article has been cited by other articles:



HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  TERMS OF USE  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved.