Background Children with type 1 neurofibromatosis (NF-1) areat increased risk for malignant myeloid disorders. Analysisof the NF-1 gene (NF1) suggests that the function of its product,neurofibromin, is reduced in affected persons and that NF1 belongsto the tumor-suppressor class of recessive cancer genes. Thismodel is consistent with evidence that neurofibromin acceleratesthe intrinsic guanosine triphosphate-hydrolyzing activity ofthe Ras family of regulatory proteins. Loss of constitutionalheterozygosity has not been reported in the benign tumors associatedwith NF-1, however, and has only been detected in a few malignantneural-crest tumors and in some tumor-derived cell lines.
Methods We studied DNA extracted from the bone marrow of 11children with NF-1 in whom malignant myeloid disorders developedand from parental leukocytes. We used a series of polymorphicmarkers within and near NF1 to determine whether leukemogenesiswas associated with structural alterations of the gene.
Results Bone marrow samples from five patients showed loss ofheterozygosity. In each case, the NF1 allele was inherited froma parent with NF-1 and the normal allele was deleted.
Conclusions These data provide evidence that NF1 may functionas a tumor-suppressor allele in malignant myeloid diseases inchildren with NF-1 and that neurofibromin is a regulator ofRas in early myelopoiesis.
Proteins encoded by the RAS family of proto-oncogenes regulatecellular growth and differentiation by cycling between an activestate in which they are bound to guanosine triphosphate (Ras-GTP)and an inactive state in which they are bound to guanosine diphosphate(Ras-GDP)1,2. During the development of cancer in humans, thesegenes commonly acquire activating point mutations that perturbthe biochemical activity of Ras proteins by elevating the levelof Ras-GTP3. Yeast and mammalian GTPase-activating proteinsnormally regulate the biologic activity of Ras proteins by acceleratingthe hydrolysis of GTP. Because it is Ras-GTP that actively transducessignals, GTPase-activating proteins act (at least in part) asnegative regulators of Ras function.
Neurofibromin, the protein encoded by the gene that is mutatedin patients with the autosomal dominant genetic disorder neurofibromatosistype 1 (NF-1), shows sequence homology with yeast and mammalianGTPase-activating proteins4,5,6. Moreover, the GTPase-activatingprotein domain of neurofibromin binds to Ras and acceleratesthe hydrolysis of GTP at physiologically relevant concentrations4,7,8.Patients with NF-1 are at increased risk for certain benignand malignant neoplasms; these tumors primarily arise in cellsderived from the embryonic neural crest9. Taken together, thestrong association of activating RAS mutations with oncogenesis,the increased risk of certain malignant conditions in patientswith NF-1, and the biochemical activity of neurofibromin onRas proteins suggest that NF1 belongs to the tumor-suppressorclass of recessive cancer genes10. This model predicts thatacquired genetic alterations that inactivate the single normalNF1 allele contribute to the formation of cancer in personswith NF-1. Recent data derived from structural and biochemicalstudies of malignant tumors removed from patients with NF-1support the hypothesis that NF1 functions as a tumor suppressorin neural-crest cells11,12,13,14,15,16,17.
Children with NF-1 are predisposed to malignant myeloid diseases,particularly preleukemic myelodysplastic syndrome and myeloproliferativesyndrome (MPS). These disorders are characterized by deregulatedclonal proliferation of immature hematopoietic cells that showsome myeloid differentiation in vivo18. Juvenile chronic myelogenousleukemia and monosomy 7 syndrome of the bone marrow accountfor most cases of MPS in children. These two disorders sharemany features, including a similar age of onset, a tendencyto affect boys, prominent enlargement of liver and spleen, leukocytosis,the absence of the Philadelphia chromosome, and a poor prognosis,with either progression to acute myelogenous leukemia (AML)or death from intercurrent problems18. Although MPS is an uncommoncomplication of NF-1 in childhood, NF-1 constitutes as manyas 10 percent of the spontaneous cases of MPS in children18,19,20,21.The association between NF-1 and MPS in childhood is particularlyintriguing because these malignant conditions typically appearearly in life and affect a cell line not derived from neural-crestcells, and because oncogenic RAS mutations occur frequentlyin MPS and AML but not in neural-crest tumors3,22. We have examinedDNA samples from 11 families in which a malignant myeloid disorderdeveloped in a child with NF-1 and present data implicatingNF1 as a tumor suppressor in hematopoietic cells of the myeloidlineage.
Methods
We studied 10 boys and 1 girl with NF-1 and MPS (9 patients)or AML (2 patients) who were treated at pediatric referral centers.Parental DNA was used for comparison studies. The epidemiologicand clinical features of the patients are summarized in Table 1.Bone marrow samples from the four patients with monosomy7 (Patients 3, 4, 5, and 6) were studied previously with probeslinked to NF1, and none showed loss of heterozygosity21. Weexamined bone marrow samples from all children with NF-1 andmalignant myeloid disorders for whom parental DNA was availablefor comparison studies. The patients were referred by pediatriconcologists throughout North America between 1989 and 1993.The experimental procedures were approved by the institutionalreview board of the University of California, San Francisco,and informed consent was obtained from the families who participated.
Table 1. Features of Children with NF-1 and Malignant Myeloid Disorders.
We prepared DNA from peripheral-blood samples from the parentsand from bone marrow from the patients using standard methods,as described elsewhere21,23. Southern blotting and hybridizationwith complementary DNA probes were performed as previously described,21,23except that we transferred digested DNA samples from agarosegels to nylon membranes (Hybond N+ membranes, Amersham) underalkaline conditions according to the manufacturer's instructions.The membranes were rinsed twice in 2 x saline sodium citratebuffer (0.3 M sodium chloride and 0.03 M sodium citrate) beforethey were hybridized.
We examined five sequence polymorphisms within NF1: probes AE2524and EVI-2B25 identify restriction-fragment-length polymorphismson Southern blots, whereas EVI-20 and the markers describedby Xu and associates26 and Andersen et al.27 consist of variablenumbers of short nucleotide repeats and are detected by oligonucleotide-directedamplification with the polymerase chain reaction (PCR), followedby gel electrophoresis. A sixth marker, UT172, is a polymorphicAlu repeat located approximately 1.5 Mb centromeric of NF1.We also used two markers from the short arm of chromosome 17to examine blood and marrow samples from these families: probeYNZ22 is located near the p53 tumor-suppressor gene,28 and apair of oligonucleotide primers detect an intragenic p53 polymorphismby PCR29. The investigation of these samples for loss of heterozygositywas complicated by the fact that very little DNA was availablefrom some patients and by the fact that we had no source ofnormal tissues in most cases and therefore assessed loss ofheterozygosity by comparing parental DNA with patient DNA obtainedfrom bone marrow.
DNA samples were amplified in a DNA Thermocycle machine (Perkin-ElmerCetus). We performed PCR in reaction mixtures that included10 pM each of 3' and 5' primers, 100 ng of target genomic DNA,1 unit of Taq polymerase (AmpliTaq, Cetus), and 100 micro M(final concentration) of deoxynucleotides in a final reactionvolume of 50 microl. We incorporated [33P]deoxy-ATP into theDNA fragments generated in the PCR procedure by adding 2 microl(10 micro Ci) of [33P]deoxy-ATP per 500 microl of the reactionmixtures and by decreasing the concentrations of unlabeled deoxy-ATPto 50 mM. In some experiments, we end-labeled the 5' oligonucleotideprimer with [32P]-ATP before performing PCR instead of incorporating[33P]deoxy-ATP during the amplification process. Labeled PCRproducts were separated on sequencing gels (measuring 0.4 mmby 20 mm by 60 mm) run at 60 to 80 W of constant power for twoto four hours. The gels were placed in plastic wrap and exposedto x-ray film for one to five days at room temperature.
The EVI-20 polymorphism was detected with forward primer 5'CCCATACCTAGTTCTTAAAGTCTGT3'and reverse primer 5'TAACAATTGTGGAACTGCAGCAATTATT3'. Amplificationconsisted of 26 cycles of denaturation at 94 °C for oneminute, annealing at 67 °C for one minute, and extensionat 72 °C for one minute; the magnesium chloride concentrationwas 2 mM, and the alleles were detected on a gel containing5 percent acrylamide, 6 M urea, and 32 percent deionized formamide.We tested the amplification products on a 5 percent acrylamideminigel (measuring 1.0 mm by 10 cm by 10 cm) before loadingthe large gels and performed four to eight additional cyclesof PCR if the products were not visualized. This procedure minimizedthe amplification of background products. EVI-20 detects fourcommon alleles ranging from 200 to 210 base pairs (bp). TheUT172 polymorphism was detected with forward primer 5'GGTGAAAGAGCAAGACTCTGTCAC3'and reverse primer 5'CCCCTTGATTGTAAGCNACAGAAAC3'. Amplificationconsisted of 32 cycles of denaturation at 94 °C for 45 seconds,annealing at 52 °C for 45 seconds, and extension at 72 °Cfor 45 seconds; the magnesium chloride concentration was 2.5mM, and the alleles were detected on a gel containing 6 percentacrylamide, 6 M urea, and 10 percent deionized formamide. UT172detects four common alleles ranging from 100 to 120 bp. To detectthe other loci, we used amplification techniques described byXu et al.,26 Andersen et al.,27 and Futreal et al.,29 as recommendedby the authors.
Results
Analysis of DNA from all 11 families was informative at oneor more polymorphic sites within NF1. Analysis of bone marrowshowed that heterozygosity was retained in six patients (Patients3, 4, 5, 7, 9, and 10) and that a parental NF1 allele was lostin five others (Patients 1, 2, 6, 8, and 11 in Table 1) (Figure 1).All five children with loss of heterozygosity had familialNF-1, and in each case the bone marrow retained the NF1 alleleinherited from the affected parent. The bone marrow of Patient1 had loss of heterozygosity at all five intragenic loci (Figure 1A).The absence of the normal paternal AE25 fragment in thebone marrow from this patient with juvenile chronic myelogenousleukemia directly demonstrates a structural deletion affectingthe NF1 coding region. Two of the five bone marrow samples showingloss of heterozygosity within NF1 (Patients 6 and 8) also showedloss of heterozygosity at UT172; analysis of the other threesamples with this marker was uninformative.
Figure 1. Loss of Heterozygosity within and near NF1 in Bone Marrow Samples from the Patients.
In Panel A, DNA extracted from a bone marrow sample from Patient 1 and from a blood sample from his parents was digested with EcoRI, hybridized with probe EVI-2B (top blot), and amplified with primers that detect a polymorphic NF1 Alu repeat26 (bottom blot). The patient's DNA shows only the mutant maternal NF1 gene. In Panel B, DNA from Patient 2 and his parents was amplified with primers that detect the EVI-20 repeat (top blot) and the sequence polymorphism described by Andersen et al.27 (bottom blot). In the patient's DNA, the normal maternal NF1 gene is lost and the mutant paternal allele is retained. In Panel C, DNA from Patient 6 and his parents was amplified with primers that detect the EVI-20 (top blot) and UT172 (bottom blot) polymorphisms. The mutant maternal NF1 allele is retained in this patient with monosomy 7 (Mo 7) of the bone marrow. In Panel D, DNA from Patient 8 and his parents was amplified with primers that detect the UT172 polymorphism. The normal maternal allele is present in the bone marrow of Patient 8. In Panel E, DNA from Patient 11 and her parents was amplified with primers that detect the EVI-20 polymorphism (top blot) and the polymorphism described by Andersen et al.27 (bottom blot). The maternal NF1 allele is deleted in the patient. JCML denotes juvenile chronic myelogenous leukemia, and CMML chronic myelomonocytic leukemia.
The p53 tumor-suppressor gene, located on the short arm of chromosome17, is the most common target for loss-of-function mutationsin human cancers30. NF1 is also on chromosome 17, at band q11.2.We therefore examined bone marrow samples from the patientswith probe YNZ2228 (located near p53) and at a polymorphic sitewithin p5329. As shown in Table 1, analysis of 9 of 11 bonemarrow samples (including all 5 showing loss of heterozygosityat NF1) with one of these markers was informative, and all demonstratedheterozygosity.
These results in patients with NF-1 suggested that NF1 mightbe a target for acquired mutations in children with MPS andAML who do not have NF-1. To address this question, we usedthe four NF1 polymorphisms that can be detected by PCR to study27 consecutive children with MPS and monosomy 7. Analysis of25 of the samples was informative. All 25 bone marrow samplesretained both parental alleles (data not shown).
Discussion
Our results provide evidence that NF1 acts as a tumor suppressorin myeloid cells in vivo, since bone marrow samples from childrenwith NF-1 and malignant myeloid disorders showed a high frequencyof loss of heterozygosity at NF1, consistently retained themutant NF1 allele of a parent with clinical neurofibromatosis,and remained heterozygous in the p53 region. These data suggestthat neurofibromin is essential for growth regulation in a cellline not derived from neural-crest cells. Our results providea coherent model that accounts for three independent clinicaland experimental observations in childhood MPS. First, dataimplicating NF1 as a tumor-suppressor allele in the pathogenesisof these leukemias readily explain the markedly increased incidenceof MPS in children with NF-118,19,20,21. Second, activatingRAS mutations are common in both AML and adult preleukemia3,22and have been reported in some children with MPS31,32. Mutationsof the NF1 and RAS genes might have the same biochemical consequencesfor cell growth (i.e., increased levels of Ras-GTP). Third,bone marrow cells from children with juvenile chronic myelogenousleukemia and monosomy 7 exhibit abnormal growth characteristicsin culture systems that support the development of coloniesderived from hematopoietic progenitors33,34,35. Cells obtainedfrom patients with juvenile chronic myelogenous leukemia andmonosomy 7 form colonies in the absence of exogenous growthfactors. Recent data indicate that these cells also have pronouncedand selective hypersensitivity to granulocyte-macrophage colony-stimulatingfactor34,35. Stimulation with this factor increases the levelof Ras-GTP in hematopoietic cell lines36. We have not foundloss of heterozygosity in the bone marrow of children with preleukemiaand AML who do not have NF-1. However, our data are restrictedto children with monosomy 7, and further investigation is requiredto ascertain whether somatic alterations of NF1 occur in theother malignant myeloid disorders.
Investigation of neurofibrosarcomas and neurofibrosarcoma celllines derived from patients with NF-1 has shown loss of constitutionalheterozygosity, decreased in vitro activity of GTPase-activatingproteins, and elevated levels of Ras-GTP11,12,13,15,16. Legiuset al.17 identified a 200-kb deletion of NF1 in a fibrosarcomawith loss of heterozygosity at all chromosome 17 alleles tested.Loss of heterozygosity with retention of the mutant NF1 allelehas also been reported in pheochromocytomas from a few patientswith NF-114. Finally, recent data indicating that cultured neuroblastoma37and melanoma38 cell lines frequently show homozygous inactivationof NF1 provide further evidence that loss of neurofibromin functionconfers a growth advantage in cells derived from the neuralcrest. Although these data are consistent with our results inchildhood MPS and AML, there are important differences betweenneural-crest tumors and myeloid leukemia. In contrast to ourfindings, when loss of heterozygosity occurs in neural-cresttumors it usually affects both p53 and NF112,13,17. In addition,point mutations were detected in the single p53 allele retainedin two neurofibrosarcomas,12 and it is likely that alterationsof both p53 and NF1 contribute to the loss of growth controlin neurofibrosarcomas. Our data suggest that loss of heterozygosityat NF1, but not at p53, is involved in the pathogenesis of MPSand AML in children with NF-1. Activating RAS mutations arecommon in malignant myeloid disorders but are infrequent inneural-crest tumors3,22,32. Moreover, there is evidence thatsignaling through Ras proteins promotes differentiation, ratherthan proliferation, of neural-crest cells39,40,41. Taken together,these results suggest that the cellular context (neural crestor hematopoietic) in which the loss of NF1 function occurs influencesthe way in which these mutations alter growth regulation.
The association of NF-1 with preleukemia is highly specificwith respect to cell lineage and age. It is striking that adultswith NF-1 are not at increased risk for preleukemia or AML,particularly given the lifelong self-renewing capacity of hematopoieticcells. These observations suggest that neurofibromin activityis not required to control the proliferation of myeloid cellsbeyond early childhood. It is possible that a critical growth-limitingactivity of neurofibromin could be overcome by maturation toa more differentiated "adult type" of myeloid progenitor, bya progressive increase in the activity of p120 GTPase-activatingprotein or other related proteins, or by developmental changesin the extracellular signals that stimulate or inhibit growth.The dramatic and usually transient MPS seen in some infantswith Down's syndrome provides clinical evidence that the balancebetween the proliferation and differentiation of hematopoieticcells is tenuous early in life42. Characterization of the roleof neurofibromin in fetal and neonatal hematopoiesis shouldprovide insights into the way in which this process is developmentallyregulated.
The incidence of preleukemia is much lower in children withNF-1 than is the risk of cancer in patients who carry germ-linemutations that predispose them to Wilms' tumor and retinoblastoma10.It is possible that the loss of the normal NF1 allele is necessarybut not sufficient for leukemic transformation in children withNF-1. The presence of nonrandom cytogenetic abnormalities suchas monosomy 7 in the bone marrow of some children with NF-1and MPS provides evidence that leukemogenesis is a multistepprocess. In addition, epidemiologic data implicate epigeneticmechanisms in the pathogenesis of these disorders. ChildhoodMPS shows a strong male preponderance, particularly during thefirst year of life. We observed loss of heterozygosity at NF1in the only girl in our series. This finding suggests that themechanism by which germ-line NF1 mutations predispose childrento leukemia is the same in boys and girls, although the riskis much higher in boys. Our finding that either mutant maternalor paternal NF-1 alleles were retained in the bone marrow ofchildren with familial NF-1 provides evidence that NF1 is notimprinted in hematopoietic cells.
Germ-line NF1 mutations are associated with a variety of malignantneoplasms of neural-crest origin. This observation and biochemicaldata from studies of cultured cell lines derived from tumorcells implicate neurofibromin as a major regulator of Ras proteinsin these tissues. Our data suggest that neurofibromin has animportant role in controlling the growth of myeloid cells andsuggest that hyperactive Ras proteins contribute to the abnormalcellular proliferation seen in childhood MPS.
Supported in part by grants from the National NeurofibromatosisFoundation and the Children's Cancer Research Fund, by the U.S.Navy Clinical Investigation Center Program (protocols 90-48-2807and 90-018), by an American Cancer Society Junior Faculty ResearchAward (JFRA-471, to Dr. Shannon), and by a grant from the NationalCancer Institute to the Children's Cancer Group. The opinionsand assertions expressed in this work are those of the authorsand do not necessarily reflect the views of the Children's CancerResearch Fund or the Department of the Navy.
We are indebted to Dr. Y.W. Kan for ongoing advice and support;to Drs. Irwin Bernstein and Franklin Smith, who direct the Children'sCancer Group Acute Myelogenous Leukemia Reference Laboratory;to Drs. Beverly J. Lange and Greg Thomas for encouragement andsamples from patients; to Dr. Robert Weiss for the primer sequencesfor EVI-20; to Dr. Ray White for the primer sequences for UT172;to Susan Tarle, Dr. Francis Collins, and Dr. Lone Andersen foroligonucleotide primer sequences and for their gift of probesAE25 and EVI-2B; to Drs. Gideon Bollag, Simon Cook, and MarcHansen for helpful conversations; to Drs. Sarah Chaffee, L.C.Chan, Peter Emanuel, Steve Feig, Carolyn Felix, Jack Kelleher,Margaret Masterson, Jack Priest, Narayan Shah, Eric Sievers,Peter Steinherz, Brian Wickland, and Jan Watterson for providingsamples from patients; and to the families who participated.
Source Information
From the Department of Pediatrics, University of California, San Francisco (K.M.S., D.P., K.O.); the Department of Pathology, University of Texas Health Science Center, San Antonio (P.O.); Onyx Pharmaceuticals, Richmond, Calif. (G.A.M., F.M.); and the Division of Pediatric Oncology, Children's National Medical Center, Washington, D.C. (P.D.).
Address reprint requests to Dr. Shannon at the Department of Pediatrics, University of California, Rm. U-432, San Francisco, CA 94143-0724.
References
Bourne HR, Sanders DA, McCormick F. The GTPase superfamily: a conserved switch for diverse cell functions. Nature 1990;348:125-132. [CrossRef][Medline]
Hall A. The cellular functions of small GTP-binding proteins. Science 1990;249:635-640. [Free Full Text]
Rodenhuis S. ras And human tumors. Semin Cancer Biol 1992;3:241-247. [Medline]
Ballester R, Marchuk D, Boguski M, et al. The NF1 locus encodes a protein functionally related to mammalian GAP and yeast IRA proteins. Cell 1990;63:851-859. [CrossRef][Medline]
Buchberg AM, Cleveland LS, Jenkins NA, Copeland NG. Sequence homology shared by neurofibromatosis type-1 gene and IRA-1 and IRA-2 negative regulators of the RAS cyclic AMP pathway. Nature 1990;347:291-294. [CrossRef][Medline]
Xu GF, O'Connell P, Viskochil D, et al. The neurofibromatosis type 1 gene encodes a protein related to GAP. Cell 1990;62:599-608. [CrossRef][Medline]
Martin GA, Viskochil D, Bollag G, et al. The GAP-related domain of the neurofibromatosis type 1 gene product interacts with ras p21. Cell 1990;63:843-849. [CrossRef][Medline]
Xu GF, Lin B, Tanaka K, et al. The catalytic domain of the neurofibromatosis type 1 gene product stimulates ras GTPase and complements ira mutants of S. cerevisiae. Cell 1990;63:835-841. [CrossRef][Medline]
Riccardi VM, Eichner JE. Neurofibromatosis: phenotype, natural history, and pathogenesis. Baltimore: Johns Hopkins University Press, 1986.
Weinberg RA. Tumor suppressor genes. Science 1991;254:1138-1146. [Free Full Text]
Skuse GR, Kosciolek BA, Rowley PT. Molecular genetic analysis of tumors in von Recklinghausen neurofibromatosis: loss of heterozygosity for chromosome 17. Genes Chromosomes Cancer 1989;1:36-41. [Medline]
Menon AG, Anderson KM, Riccardi VM, et al. Chromosome 17p deletions and p53 gene mutations associated with the formation of malignant neurofibrosarcomas in von Recklinghausen neurofibromatosis. Proc Natl Acad Sci U S A 1990;87:5435-5439. [Free Full Text]
Glover TW, Stein CK, Legius E, Andersen LB, Brereton A, Johnson S. Molecular and cytogenetic analysis of tumors in von Recklinghausen neurofibromatosis. Genes Chromosomes Cancer 1991;3:62-70. [Medline]
Xu W, Mulligan LM, Ponder MA, et al. Loss of NF1 alleles in phaeochromocytomas from patients with type 1 neurofibromatosis. Genes Chromosomes Cancer 1992;4:337-342. [Medline]
Basu TN, Gutmann DH, Fletcher JA, Glover TW, Collins FS, Downward J. Aberrant regulation of ras proteins in malignant tumour cells from type 1 neurofibromatosis patients. Nature 1992;356:713-715. [CrossRef][Medline]
DeClue JE, Papageorge AG, Fletcher JA, et al. Abnormal regulation of mammalian p21ras contributes to malignant tumor growth in von Recklinghausen (type 1) neurofibromatosis. Cell 1992;69:265-273. [CrossRef][Medline]
Legius E, Marchuk DA, Collins FS, Glover TW. Somatic deletion of the neurofibromatosis type 1 gene in a neurofibrosarcoma supports a tumour suppressor gene hypothesis. Nat Genet 1993;3:122-126. [CrossRef][Medline]
Gadner H, Haas OA. Experience in pediatric myelodysplastic syndromes. Hematol Oncol Clin North Am 1992;6:655-672. [Medline]
Bader JL, Miller RW. Neurofibromatosis and childhood leukemia. J Pediatr 1978;92:925-929. [CrossRef][Medline]
Castro-Malaspina H, Schaison G, Passe S, et al. Subacute and chronic myelomonocytic leukemia in children (juvenile CML): clinical and hematologic observations, and identification of prognostic factors. Cancer 1984;54:675-686. [CrossRef][Medline]
Shannon KM, Watterson J, Johnson P, et al. Monosomy 7 myeloproliferative disease in children with neurofibromatosis, type 1: epidemiology and molecular analysis. Blood 1992;79:1311-1318. [Free Full Text]
Vogelstein B, Civin CI, Preisinger AC, et al. RAS gene mutations in childhood acute myeloid leukemia: a Pediatric Oncology Group study. Genes Chromosomes Cancer 1990;2:159-162. [Medline]
Shannon KM, Turhan AG, Chang SSY, et al. Familial bone marrow monosomy 7: evidence that the predisposing locus is not on the long arm of chromosome 7. J Clin Invest 1989;84:984-989.
Andersen LB, Wallace MR, Marchuk DA, et al. A highly polymorphic cDNA probe in the NF1 gene. Nucleic Acids Res 1991;19:3754-3754.abstract [Free Full Text]
Andersen LB, Wallace MR, Marchuk DA, et al. A polymorphic cDNA probe on chromosome 17q11.2 located within the NF1 gene [D17S376]. Nucleic Acids Res 1991;19:197-197.abstract [Free Full Text]
Xu GF, Nelson L, O'Connell P, White R. An Alu polymorphism intragenic to the neurofibromatosis type 1 gene (NF1). Nucleic Acids Res 1991;19:3764-3764. [Free Full Text]
Andersen LB, Tarle SA, Marchuk DA, Legius E, Collins FS. A compound nucleotide repeat in the neurofibromatosis (NF1) gene. Hum Mol Genet 1993;2:1083-1083.abstract [Free Full Text]
Nakamura Y, Ballard L, Leppert M, et al. Isolation and mapping of a polymorphic DNA sequence (pYNZ22) on chromosome 17p [D17S30]. Nucleic Acids Res 1988;16:5707-5707.abstract [Free Full Text]
Futreal PA, Barrett JC, Wiseman RW. An Alu polymorphism intragenic to the TP53 gene. Nucleic Acids Res 1991;19:6977-6977.abstract [Free Full Text]
Hollstein M, Sidransky D, Vogelstein B, Harris CC. p53 Mutations in human cancers. Science 1991;253:49-53. [Free Full Text]
Lubbert M, Mirro J Jr, Kitchingman G, et al. Prevalence of N-ras mutations in children with myelodysplastic syndromes and acute myeloid leukemia. Oncogene 1992;7:263-268. [Medline]
Neubauer A, Shannon K, Liu E. Mutations of the ras proto-oncogenes in childhood monosomy 7. Blood 1991;77:594-598. [Free Full Text]
Weiss K, Stass S, Williams D, et al. Childhood monosomy 7 syndrome: clinical and in vitro studies. Leukemia 1987;1:97-104. [Medline]
Freedman MH, Cohen A, Grunberger T, et al. Central role of tumor necrosis factor, GM-CSF, and interleukin 1 in the pathogenesis of juvenile chronic myelogenous leukaemia. Br J Haematol 1992;80:40-48. [Medline]
Emanuel PD, Bates LJ, Castleberry RP, Gualtieri RJ, Zuckerman KS. Selective hypersensitivity to granulocyte-macrophage colony-stimulating factor by juvenile chronic myeloid leukemia hematopoietic progenitors. Blood 1991;77:925-929. [Free Full Text]
Satoh T, Nakafuku M, Miyajima A, Kaziro Y. Involvement of ras p21 protein in signal-transduction pathways from interleukin 2, interleukin 3, and granulocyte/macrophage colony-stimulating factor, but not from interleukin 4. Proc Natl Acad Sci U S A 1991;88:3314-3318. [Free Full Text]
The I, Murthy AE, Hannigan GE, et al. Neurofibromatosis type 1 gene mutations in neuroblastoma. Nat Genet 1993;3:62-66. [CrossRef][Medline]
Andersen LB, Fountain JW, Gutmann DH, et al. Mutations in the neurofibromatosis 1 gene in sporadic malignant melanoma cell lines. Nat Genet 1993;3:118-121. [CrossRef][Medline]
Noda M, Ko M, Ogura A, et al. Sarcoma viruses carrying ras oncogenes induce differentiation-associated properties in a neuronal cell line. Nature 1985;318:73-75. [CrossRef][Medline]
Bar-Sagi D, Feramisco JR. Microinjection of the ras oncogene protein into PC12 cells induces morphological differentiation. Cell 1985;42:841-848. [CrossRef][Medline]
Qui MS, Green SH. PC12 cell neuronal differentiation is associated with prolonged p21ras activity and consequent prolonged ERK activity. Neuron 1992;9:705-717. [CrossRef][Medline]
Fong C-t, Brodeur GM. Down's syndrome and leukemia: epidemiology, genetics, cytogenetics and mechanisms of leukemogenesis. Cancer Genet Cytogenet 1987;28:55-76. [CrossRef][Medline]
Sievert, A. J., Fisher, M. J.
(2009). Pediatric Low-Grade Gliomas. J Child Neurol
24: 1397-1408
[Abstract]
Boley, S., Sloan, J. L., Pemov, A., Stewart, D. R.
(2009). A Quantitative Assessment of the Burden and Distribution of Lisch Nodules in Adults with Neurofibromatosis Type 1. IOVS
50: 5035-5043
[Abstract][Full Text]
Yang, Z., Kondo, T., Voorhorst, C. S., Nabinger, S. C., Ndong, L., Yin, F., Chan, E. M., Yu, M., Wurstlin, O., Kratz, C. P., Niemeyer, C. M., Flotho, C., Hashino, E., Chan, R. J.
(2009). Increased c-Jun Expression and Reduced GATA2 Expression Promote Aberrant Monocytic Differentiation Induced by Activating PTPN11 Mutants. Mol. Cell. Biol.
29: 4376-4393
[Abstract][Full Text]
Koenigsmann, J., Rudolph, C., Sander, S., Kershaw, O., Gruber, A. D., Bullinger, L., Schlegelberger, B., Carstanjen, D.
(2009). Nf1 haploinsufficiency and Icsbp deficiency synergize in the development of leukemias. Blood
113: 4690-4701
[Abstract][Full Text]
Denayer, E, de Ravel, T., Legius, E
(2008). Clinical and molecular aspects of RAS related disorders. J. Med. Genet.
45: 695-703
[Abstract][Full Text]
Braun, B. S., Shannon, K.
(2008). Targeting Ras in Myeloid Leukemias. Clin. Cancer Res.
14: 2249-2252
[Abstract][Full Text]
De Luca, A, Bottillo, I, Dasdia, M C, Morella, A, Lanari, V, Bernardini, L, Divona, L, Giustini, S, Sinibaldi, L, Novelli, A, Torrente, I, Schirinzi, A, Dallapiccola, B
(2007). Deletions of NF1 gene and exons detected by multiplex ligation-dependent probe amplification. J. Med. Genet.
44: 800-808
[Abstract][Full Text]
Stewart, D. R., Cogan, J. D., Kramer, M. R., Miller, W. T. Jr, Christiansen, L. E., Pauciulo, M. W., Messiaen, L. M., Tu, G. S., Thompson, W. H., Pyeritz, R. E., Ryu, J. H., Nichols, W. C., Kodama, M., Meyrick, B. O., Ross, D. J.
(2007). Is Pulmonary Arterial Hypertension in Neurofibromatosis Type 1 Secondary to a Plexogenic Arteriopathy?. Chest
132: 798-808
[Abstract][Full Text]
Pearn, L., Fisher, J., Burnett, A. K., Darley, R. L.
(2007). The role of PKC and PDK1 in monocyte lineage specification by Ras. Blood
109: 4461-4469
[Abstract][Full Text]
Chan, R. J., Feng, G.-S.
(2007). PTPN11 is the first identified proto-oncogene that encodes a tyrosine phosphatase. Blood
109: 862-867
[Abstract][Full Text]
Stephens, K., Weaver, M., Leppig, K. A., Maruyama, K., Emanuel, P. D., Le Beau, M. M., Shannon, K. M.
(2006). Interstitial uniparental isodisomy at clustered breakpoint intervals is a frequent mechanism of NF1 inactivation in myeloid malignancies. Blood
108: 1684-1689
[Abstract][Full Text]
Maertens, O., Prenen, H., Debiec-Rychter, M., Wozniak, A., Sciot, R., Pauwels, P., De Wever, I., Vermeesch, J. R., de Raedt, T., De Paepe, A., Speleman, F., van Oosterom, A., Messiaen, L., Legius, E.
(2006). Molecular pathogenesis of multiple gastrointestinal stromal tumors in NF1 patients. Hum Mol Genet
15: 1015-1023
[Abstract][Full Text]
Bowen, D. T., Frew, M. E., Hills, R., Gale, R. E., Wheatley, K., Groves, M. J., Langabeer, S. E., Kottaridis, P. D., Moorman, A. V., Burnett, A. K., Linch, D. C.
(2005). RAS mutation in acute myeloid leukemia is associated with distinct cytogenetic subgroups but does not influence outcome in patients younger than 60 years. Blood
106: 2113-2119
[Abstract][Full Text]
Yang, G., Khalaf, W., van de Locht, L., Jansen, J. H., Gao, M., Thompson, M. A., van der Reijden, B. A., Gutmann, D. H., Delwel, R., Clapp, D. W., Hiebert, S. W.
(2005). Transcriptional Repression of the Neurofibromatosis-1 Tumor Suppressor by the t(8;21) Fusion Protein. Mol. Cell. Biol.
25: 5869-5879
[Abstract][Full Text]
Chan, R. J., Leedy, M. B., Munugalavadla, V., Voorhorst, C. S., Li, Y., Yu, M., Kapur, R.
(2005). Human somatic PTPN11 mutations induce hematopoietic-cell hypersensitivity to granulocyte-macrophage colony-stimulating factor. Blood
105: 3737-3742
[Abstract][Full Text]
Le, D. T., Kong, N., Zhu, Y., Lauchle, J. O., Aiyigari, A., Braun, B. S., Wang, E., Kogan, S. C., Le Beau, M. M., Parada, L., Shannon, K. M.
(2004). Somatic inactivation of Nf1 in hematopoietic cells results in a progressive myeloproliferative disorder. Blood
103: 4243-4250
[Abstract][Full Text]
Mattocks, C, Baralle, D, Tarpey, P, ffrench-Constant, C, Bobrow, M, Whittaker, J
(2004). Automated comparative sequence analysis identifies mutations in 89% of NF1 patients and confirms a mutation cluster in exons 11-17 distinct from the GAP related domain. J. Med. Genet.
41: e48-e48
[Full Text]
Hiatt, K., Ingram, D. A., Huddleston, H., Spandau, D. F., Kapur, R., Clapp, D. W.
(2004). Loss of the Nf1 Tumor Suppressor Gene Decreases Fas Antigen Expression in Myeloid Cells. Am. J. Pathol.
164: 1471-1479
[Abstract][Full Text]
Loh, M. L., Vattikuti, S., Schubbert, S., Reynolds, M. G., Carlson, E., Lieuw, K. H., Cheng, J. W., Lee, C. M., Stokoe, D., Bonifas, J. M., Curtiss, N. P., Gotlib, J., Meshinchi, S., Le Beau, M. M., Emanuel, P. D., Shannon, K. M.
(2004). Mutations in PTPN11 implicate the SHP-2 phosphatase in leukemogenesis. Blood
103: 2325-2331
[Abstract][Full Text]
Castle, B, Baser, M E, Huson, S M, Cooper, D N, Upadhyaya, M
(2003). Evaluation of genotype-phenotype correlations in neurofibromatosis type 1. J. Med. Genet.
40: e109-109
[Full Text]
Krammer, U., Wimmer, K., Wiesbauer, P., Rasse, M., Lang, S., Mullner-Eidenbock, A., Frisch, H.
(2003). Neurofibromatosis 1: A Novel NF1 Mutation in an 11-Year-Old Girl With a Giant Cell Granuloma. J Child Neurol
18: 371-373
[Abstract]
Ingram, D. A., Wenning, M. J., Shannon, K., Clapp, D. W.
(2003). Leukemic potential of doubly mutant Nf1 and Wv hematopoietic cells. Blood
101: 1984-1986
[Abstract][Full Text]
Darley, R. L., Pearn, L., Omidvar, N., Sweeney, M., Fisher, J., Phillips, S., Hoy, T., Burnett, A. K.
(2002). Protein kinase C mediates mutant N-Ras-induced developmental abnormalities in normal human erythroid cells. Blood
100: 4185-4192
[Abstract][Full Text]
Ingram, D. A., Zhang, L., McCarthy, J., Wenning, M. J., Fisher, L., Yang, F.-C., Clapp, D. W., Kapur, R.
(2002). Lymphoproliferative defects in mice lacking the expression of neurofibromin: functional and biochemical consequences of Nf1 deficiency in T-cell development and function. Blood
100: 3656-3662
[Abstract][Full Text]
Leonard, D. G. B., Travis, L. B., Addya, K., Dores, G. M., Holowaty, E. J., Bergfeldt, K., Malkin, D., Kohler, B. A., Lynch, C. F., Wiklund, T., Stovall, M., Hall, P., Pukkala, E., Slater, D. J., Felix, C. A.
(2002). p53 Mutations in Leukemia and Myelodysplastic Syndrome after Ovarian Cancer. Clin. Cancer Res.
8: 973-985
[Abstract][Full Text]
Arceci, R. J., Longley, B. J., Emanuel, P. D.
(2002). Atypical Cellular Disorders. ASH Education Book
2002: 297-314
[Abstract][Full Text]
Blaydes, S. M., Kogan, S. C., Truong, B.-T. H., Gilbert, D. J., Jenkins, N. A., Copeland, N. G., Largaespada, D. A., Brannan, C. I.
(2001). Retroviral Integration at the Epi1 Locus Cooperates with Nf1 Gene Loss in the Progression to Acute Myeloid Leukemia. J. Virol.
75: 9427-9434
[Abstract][Full Text]
Yavorkovsky, L. L., Cook, P., Greenberg, P., Anderson, J., Estey, E., Fenaux, P., Hamblin, T., Hellstrom-Lindberg, E., List, A., Ohyashiki, K., Sanz, G., Sanz, M.
(2001). Classifying Chronic Myelomonocytic Leukemia. JCO
19: 3790-3792
[Full Text]
Sweetser, D. A., Chen, C.-S., Blomberg, A. A., Flowers, D. A., Galipeau, P. C., Barrett, M. T., Heerema, N. A., Buckley, J., Woods, W. G., Bernstein, I. D., Reid, B. J.
(2001). Loss of heterozygosity in childhood de novo acute myelogenous leukemia. Blood
98: 1188-1194
[Abstract][Full Text]
Appelbaum, F. R., Rowe, J. M., Radich, J., Dick, J. E.
(2001). Acute Myeloid Leukemia. ASH Education Book
2001: 62-86
[Abstract][Full Text]
Korf, B. R.
(2000). Malignancy in Neurofibromatosis Type 1. The Oncologist
5: 477-485
[Abstract][Full Text]
Cooper, L. J. N., Shannon, K. M., Loken, M. R., Weaver, M., Stephens, K., Sievers, E. L.
(2000). Evidence that juvenile myelomonocytic leukemia can arise from a pluripotential stem cell. Blood
96: 2310-2313
[Abstract][Full Text]
Reuter, C. W. M., Morgan, M. A., Bergmann, L.
(2000). Targeting the Ras signaling pathway: a rational, mechanism-based treatment for hematologic malignancies?. Blood
96: 1655-1669
[Abstract][Full Text]
Emanuel, P. D., Snyder, R. C., Wiley, T., Gopurala, B., Castleberry, R. P.
(2000). Inhibition of juvenile myelomonocytic leukemia cell growth in vitro by farnesyltransferase inhibitors. Blood
95: 639-645
[Abstract][Full Text]
Ingram, D. A., Yang, F.-C., Travers, J. B., Wenning, M. J., Hiatt, K., New, S., Hood, A., Shannon, K., Williams, D. A., Clapp, D. W.
(2000). Genetic and Biochemical Evidence That Haploinsufficiency of the Nf1 Tumor Suppressor Gene Modulates Melanocyte and Mast Cell Fates in Vivo. JEM
191: 181-188
[Abstract][Full Text]
Dorschner, M. O., Sybert, V. P., Weaver, M., Pletcher, B. A., Stephens, K.
(2000). NF1 microdeletion breakpoints are clustered at flanking repetitive sequences. Hum Mol Genet
9: 35-46
[Abstract][Full Text]
Mahgoub, N., Taylor, B. R., Gratiot, M., Kohl, N. E., Gibbs, J. B., Jacks, T., Shannon, K. M.
(1999). In Vitro and In Vivo Effects of a Farnesyltransferase Inhibitor on Nf1-Deficient Hematopoietic Cells. Blood
94: 2469-2476
[Abstract][Full Text]
Beaupre, D. M., Talpaz, M., Marini, F. C. III, Cristiano, R. J., Roth, J. A., Estrov, Z., Albitar, M., Freedman, M. H., Kurzrock, R.
(1999). Autocrine Interleukin-1{beta} Production in Leukemia: Evidence for the Involvement of Mutated RAS6. Cancer Res.
59: 2971-2980
[Abstract][Full Text]
Felix, C. A., Lange, B. J.
(1999). Leukemia in Infants. The Oncologist
4: 225-240
[Abstract][Full Text]
Mahgoub, N., Taylor, B. R., Beau, M. M. L., Gratiot, M., Carlson, K. M., Atwater, S. K., Jacks, T., Shannon, K. M.
(1999). Myeloid Malignancies Induced by Alkylating Agents in Nf1 Mice. Blood
93: 3617-3623
[Abstract][Full Text]
Valk, P. J. M., Vankan, Y., Joosten, M., Jenkins, N. A., Copeland, N. G., Löwenberg, B., Delwel, R.
(1999). Retroviral Insertions in Evi12, a Novel Common Virus Integration Site Upstream of Tra1/Grp94, Frequently Coincide with Insertions in the Gene Encoding the Peripheral Cannabinoid Receptor Cnr2. J. Virol.
73: 3595-3602
[Abstract][Full Text]
Beaupre, D. M., Kurzrock, R.
(1999). RAS and Leukemia: From Basic Mechanisms to Gene-Directed Therapy. JCO
17: 1071-1071
[Abstract][Full Text]
Luna-Fineman, S., Shannon, K. M., Atwater, S. K., Davis, J., Masterson, M., Ortega, J., Sanders, J., Steinherz, P., Weinberg, V., Lange, B. J.
(1999). Myelodysplastic and Myeloproliferative Disorders of Childhood: A Study of 167 Patients. Blood
93: 459-466
[Abstract][Full Text]
Side, L. E., Emanuel, P. D., Taylor, B., Franklin, J., Thompson, P., Castleberry, R. P., Shannon, K. M.
(1998). Mutations of the NF1 Gene in Children With Juvenile Myelomonocytic Leukemia Without Clinical Evidence of Neurofibromatosis, Type 1 . Blood
92: 267-272
[Abstract][Full Text]
Zhang, Y.-Y., Vik, T. A., Ryder, J. W., Srour, E. F., Jacks, T., Shannon, K., Wade Clapp, D.
(1998). Nf1 Regulates Hematopoietic Progenitor Cell Growth and Ras Signaling in Response to Multiple Cytokines. JEM
187: 1893-1902
[Abstract][Full Text]
Rosenbaum, T., Patrie, K. M., Ratner, N.
(1997). Neurofibromatosis Type 1: Genetic and Cellular Mechanisms of Peripheral Nerve Tumor Formation. Neuroscientist
3: 412-420
[Abstract]
Arico, M., Biondi, A., Pui, C.-H.
(1997). Juvenile Myelomonocytic Leukemia. Blood
90: 479-488
[Full Text]
Side, L., Taylor, B., Cayouette, M., Conner, E., Thompson, P., Luce, M., Shannon, K.
(1997). Homozygous Inactivation of the NF1 Gene in Bone Marrow Cells from Children with Neurofibromatosis Type 1 and Malignant Myeloid Disorders. NEJM
336: 1713-1720
[Abstract][Full Text]
Niemeyer, C.M., Arico, M., Basso, G., Biondi, A., Rajnoldi, A. C., Creutzig, U., Haas, O., Harbott, J., Hasle, H., Kerndrup, G., Locatelli, F., Mann, G., Stollmann-Gibbels, B., van`t Veer-Korthof, E.Th., van Wering, E., Zimmermann, M.
(1997). Chronic Myelomonocytic Leukemia in Childhood: A Retrospective Analysis of 110 Cases. Blood
89: 3534-3543
[Abstract][Full Text]
Bollag, G., Adler, F., elMasry, N., McCabe, P. C., Conner, E. Jr., Thompson, P., McCormick, F., Shannon, K.
(1996). Biochemical Characterization of a Novel KRAS Insertion Mutation from a Human Leukemia. J. Biol. Chem.
271: 32491-32494
[Abstract][Full Text]
Gutmann, D. H., Gurney, J. G., Shannon, K. M.
(1996). Juvenile Xanthogranuloma, Neurofibromatosis 1, and Juvenile Chronic Myeloid Leukemia. Arch Dermatol
132: 1390-1390
[Abstract]
Smith, M., Abrams, J., Trimble, E. L., Ungerleider, R. S.
(1996). Dose Intensity of Chemotherapy for Childhood Cancers. The Oncologist
1: 293-304
[Abstract][Full Text]
Bryant, S. S., Mitchell, A. L., Collins, F., Miao, W., Marshall, M., Jove, R.
(1996). N-terminal Sequences Contained in the Src Homology 2 and 3 Domains of p120 GTPase-activating Protein Are Required for Full Catalytic Activity Toward Ras. J. Biol. Chem.
271: 5195-5199
[Abstract][Full Text]
Zvulunov, A., Barak, Y., Metzker, A.
(1995). Juvenile Xanthogranuloma, Neurofibromatosis, and Juvenile Chronic Myelogenous Leukemia: World Statistical Analysis. Arch Dermatol
131: 904-908
[Abstract]
Brodeur, G. M.
(1994). The NF1 Gene in Myelopoiesis and Childhood Myelodysplastic Syndromes. NEJM
330: 637-639
[Full Text]
Sherman, L. S., Atit, R., Rosenbaum, T., Cox, A. D., Ratner, N.
(2000). Single Cell Ras-GTP Analysis Reveals Altered Ras Activity in a Subpopulation of Neurofibroma Schwann Cells but Not Fibroblasts. J. Biol. Chem.
275: 30740-30745
[Abstract][Full Text]