The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
Original Article
PreviousPrevious
Volume 331:974-980 October 13, 1994 Number 15
NextNext

A Novel Mutation in the Cystic Fibrosis Gene in Patients with Pulmonary Disease but Normal Sweat Chloride Concentrations
W. Edward Highsmith, Lauranell H. Burch, Zhaoqing Zhou, John C. Olsen, Thomas E. Boat, Alexander Spock, Jack D. Gorvoy, Lynne Quittell, Kenneth J. Friedman, Lawrence M. Silverman, Richard C. Boucher, and Michael R. Knowles

 

This Article
-Abstract

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation
ABSTRACT

Background Many patients with chronic pulmonary disease similar to that seen in cystic fibrosis have normal (or nondiagnostic) sweat chloride values. It has been difficult to make the diagnosis of cystic fibrosis in these patients because no associated mutation in the cystic fibrosis transmembrane conductance regulator (CFTR) gene has been identified.

Methods We evaluated 23 patients with pulmonary disease characteristic of cystic fibrosis but with sweat chloride concentrations in the normal range. Mutations in the CFTR gene were sought by direct sequencing of polymerase chain reaction-amplified nasal epithelial messenger RNA and by testing the functioning of affected epithelium.

Results A cytidine phosphate guanosine dinucleotide C-to-T point mutation in intron 19 of the CFTR gene, termed 3849+10 kb C to T, was identified in 13 patients from eight unrelated families. This mutation was found in patients from three different ethnic groups with three different extended haplotypes. The mutation leads to the creation of a partially active splice site in intron 19 and to the insertion into most CFTR transcripts of a new 84-base-pair "exon," containing an in-frame stop codon, between exons 19 and 20. Normally spliced transcripts were also detected at a level approximately 8 percent of that found in normal subjects. This mutation is associated with abnormal nasal epithelial and sweat acinar epithelial function.

Conclusions We have identified a point mutation in intron 19 of CFTR and abnormal epithelial function in patients who have cystic fibrosis-like lung disease but normal sweat chloride values. The identification of this mutation indicates that this syndrome is a form of cystic fibrosis. Screening for the mutation should prove diagnostically useful in this population of patients.

Cystic fibrosis is an autosomal recessive genetic disorder that reflects mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene,1,2,3 which codes for a cyclic AMP (cAMP)-regulated chloride channel4,5. The disorder has a broad range of severity but has traditionally been manifested by chronic pulmonary disease, pancreatic exocrine insufficiency, elevated concentrations of chloride in sweat, and identified mutations, most commonly {Delta}F5083,6.

There is a group of patients, however, who have chronic lung disease similar to that seen in cystic fibrosis but who have normal sweat chloride values6. These patients have no common mutation in the CFTR gene detectable by conventional genetic analysis of genomic DNA and thus present a diagnostic problem. To evaluate the diagnosis of cystic fibrosis in such patients, we characterized the physiologic functioning of epithelium in affected organs and sought mutations in the CFTR gene by direct sequencing of messenger RNA (mRNA) transcripts obtained from nasal epithelium and amplified by the polymerase chain reaction (PCR).

Methods

Patients

We evaluated 23 patients in 13 families who had disease resembling cystic fibrosis (obstructive airways disease and characteristic microbiologic contents of sputum, i.e., Staphylococcus aureus, Pseudomonas aeruginosa, or both) but who had sweat chloride values7 in the nondiagnostic or normal range8 (<60 mmol per liter in patients older than 15 years and <40 mmol per liter in patients 15 years old or younger, calculated as the median of at least three determinations). Pancreatic exocrine function was assessed by the measurement of stool fat during a 72-hour period (normal, <7 g per day per 100 g of fat ingested) or by clinical features and the measurement of serum vitamin E (normal, 5 to 20 mg per milliliter of solution), serum trypsinogen (normal, 10 to 57 ng per milliliter of solution), or both. Each patient was screened for 29 different mutations of CFTR9. The study protocol was approved by the institutional review board of the University of North Carolina, and informed consent was obtained.

Identification and Characterization of the Mutation in Intron 19

Total RNA was prepared by the method of Chirgwin et al.10 or the Ultraspect system (Biotecx, Houston) from nasal epithelial cells (5 x 105) obtained by scraping the inferior turbinates with a Rhinoprobe11. For the sequence analysis, reverse transcription was performed with CFTR-specific primers and avian moloney virus reverse transcriptase (Red Module, Invitrogen, San Diego, Calif.). The complementary DNA (cDNA) was amplified (for 35 cycles) to yield segments of cDNA of approximately 1 kilobase (kb). Each first-round PCR product was reamplified (for 35 cycles) with nested primers, resulting in overlapping products of 400 to 600 base pairs (bp). The second-round products were purified on low-melting-temperature agarose gels; single-stranded DNA was prepared by asymmetric PCR12 and purified by two rounds of spin dialysis (Centricon 100, Amicon, Beverly, Mass.). Dideoxy sequencing was done with Sequenase (United States Biochemical, Cleveland).

The region of CFTR cDNA spanning exon 18 to exon 20 was amplified with a primer complementary to bases 3552 to 3596 (exon 18) and a primer complementary to the junction of exons 20 and 21 (bases 3991 to 4009). After electrophoresis in composite gels consisting of 3 percent NuSieve agarose and 1 percent Seakem agarose (FMC Bioproducts, Rockland, Me.), the amplified fragment was detected by Southern hybridization with 32P-labeled oligonucleotide complementary to bases 3600 through 3619. EcoRI digests of phage clones (TE24II and TE28), which together span intron 19, were analyzed by the Southern blot assay with an insert-bearing PCR product (542 bp). The primers (forward primer, 5'TTGACTTGTCATCTTGATTTC3'; reverse primer, 5'CATTTTAATACTGCAACAGAT3') derived from the insert sequence (as described in the next section) were used to amplify DNA from a plasmid subclone (pTE24II-6) to provide sequences in regions flanking the 84-bp insert. In sequencing key regions of intron 19, primers were used to amplify a 437-bp PCR product from genomic DNA (forward primer 4712, 5'AGGCTTCTCAGTGATCTGTTG3'; reverse primer 4713, 5'GAATCATTCAGTGGGTATAAGCAG3').

Quantitation of CFTR mRNA

Total RNA was prepared from nasal epithelium with the Ultraspect system (Biotecx). Two microgs of total RNA was used to synthesize cDNA (in 20-microl reactions) with reverse transcriptase (Super Script, Life Technologies, Gaithersburg, Md.). After 20-fold dilution in water, 10-microl aliquots of cDNA were included in the 50-microl PCR reactions. The normal CFTR sequence was amplified with primer 051193-1 and a primer complementary to the junction of exons 19 and 20 (bases 3843 to 3867). Amplification of {gamma}-actin sequences was performed in parallel with primers HAG3 and HAG413. CFTR and {gamma}-actin sequences were amplified by 25 cycles of PCR (94 °C for 30 seconds, 65 °C for 30 seconds, and 72 °C for 1 minute) with the rapid-initiation technique (HotStart AmpliWax paraffin beads, Perkin-Elmer, Norwalk, Conn.). Plasmids carrying the CFTR sequence (pCFTR474) or the {gamma}-actin sequence (pHF1)14 were amplified in parallel; the initial copy number of each plasmid was increased serially (10-fold, from 10 to 105). Amplification products were analyzed by Southern blot hybridization with 32P-labeled oligonucleotides complementary to CFTR (bases 3600 to 3619) or {gamma}-actin15 (bases 1072 to 1096). The DNA fragments were quantitated by phosphor-screen autoradiography (PhosphorImager, Molecular Dynamics, Sunnyvale, Calif.).

Haplotype Determination

Extended haplotypes were constructed from an analysis of PCR-amplified DNA for the diallelic markers XV.2c and KM-1916 and the marker loci J44, GATT, M470, and TUB1817.

Sweat-Gland and Nasal Epithelial Function

Sweat ductal function was assessed by measurement of sweat chloride7 and by measurement of the potential difference (PD), or voltage, across the epithelium of the sweat duct18,19. Sweat acinar epithelial chloride secretion mediated by cAMP was assessed by measuring sweat formation after an intradermal injection of isoproterenol, aminophylline, and atropine20,21,22. We tested the nasal PD and the response to sequential superfusion with amiloride (10-4 M), chloride-free amiloride (in which the chloride is replaced by gluconate), and a combination of isoproterenol (10-5 M) and chloride-free amiloride23,24,25. The chloride-diffusion PD (an index of basal chloride permeability) indicates the change with chloride-free superfusion; values reported here are corrected (by adding -9 mV) for the change in voltage caused by the replacement of chloride by gluconate. The change in PD with isoproterenol correlates with the cAMP-activated permeability of chloride; a negative value indicates chloride secretion.

Results

Clinical Phenotype of Patients

The patients referred for study had obstructive lung disease, chest radiographs consistent with cystic fibrosis, and characteristic microbiologic features of sputum -- that is, mucoid P. aeruginosa, S. aureus, or both. Thirteen patients from eight families (Table 1) had at least one copy of the mutation in intron 19, as described below. Except for Patient 8A, these patients tended to have lung disease similar to or milder than that expected for their age as compared with a large population of patients with cystic fibrosis who were homozygous for {Delta}F50827. Six of these study patients had never been hospitalized for their lung disease. Their sweat chloride values were nondiagnostic of cystic fibrosis, and the median value on multiple sweat tests was within the normal range. Most of the patients (10 of 13) had preservation of pancreatic exocrine function. One adult man (Patient 6A) who underwent fertility testing had an undeveloped vas deferens and obstructive azoospermia.

View this table:
[in this window]
[in a new window]
  		Table 1. Clinical Features and Genotype of Patients with Pulmonary Disease and Normal Sweat Chloride Levels.

 
Sweat-Gland and Nasal Epithelial Function

Eight patients underwent physiologic assessment of epithelial function. Sweat ductal PD measurements for all eight were normal (Table 2), in a manner consistent with effective sweat chloride absorption and normal sweat chloride concentrations. In contrast, the assessment of sweat acinar epithelial chloride secretory function revealed that none of these patients secreted chloride in response to the {beta}-agonist isoproterenol, a pattern typical of classic cystic fibrosis. The patients' nasal bioelectric properties were also abnormal, similar to those seen in patients homozygous for {Delta}F508 (Table 2): the base-line PD and amiloride-sensitive PD were greater than normal, and the chloride diffusion PD (an index of chloride permeability) and the cAMP-mediated chloride secretory response to isoproterenol were smaller than normal.

View this table:
[in this window]
[in a new window]
  		Table 2. Physiologic Studies of Sweat-Gland and Nasal Epithelial Function in Eight Patients with Pulmonary Disease and the Mutation in Intron 19 of CFTR.

 
Genetic Analysis of Patients

The initial studies were of a 20-year-old woman (Patient 1 in Table 1). She was homozygous for the B haplotype16 and was the product of consanguineous mating (her paternal grandparents were first cousins, as were her parents). No mutation was identified when the coding region of her CFTR gene was sequenced. However, PCR amplification of cDNA spanning from exon 18 to exon 20 revealed two products that hybridized to an oligonucleotide complementary to exon 19 (Figure 1A). The smaller product (474 bp), found in both normal subjects and the sample from the homozygous patient, corresponded to the normal CFTR sequence. The larger species (558 bp), found only in the sample from the patient, contained an 84-bp insert between exons 19 and 20 that included an in-frame TAA stop codon (Figure 1B). Hybridization of the relevant PCR product to EcoRI digests of phage clones TE24II and TE28 revealed, in addition to the expected bands overlapping exons 19 and 20, a 6.0-kb fragment common to both clones (Figure 1C). This fragment begins approximately 10 kb downstream of exon 19. Sequence analysis of DNA flanking the 84-bp insert from the 6.0-kb fragment revealed cryptic splice lariat and acceptor sequences 5' to the insert and a consensus splice-donor site 3' to the insert, except for the C residue at position 2 (Figure 1D).


View larger version (19K):
[in this window]
[in a new window]
  		Figure 1. Identification and Characterization of the Mutation in Intron 19.

Panel A shows an autoradiograph of PCR products from the region spanning exon 18 to exon 20 of CFTR cDNA from a normal subject (lane 1) and a patient with cystic fibrosis who is homozygous for the mutation in intron 19 (lane 2). The 474-bp product is the normal CFTR sequence, and the 558-bp product contains the 84-bp insert from intron 19. Panel B shows the sequence of the 84-base insert; the in-frame stop codon TAA appears in capital letters. The diagram shows alternative splicing (above) and normal splicing (below); the hatched box represents the 84-bp insert, and the solid boxes represent exon 19 and exon 20. Panel C shows an EcoRI restriction map of CFTR intron 19 and a schematic drawing of Southern blot analysis of EcoRI-digested phage clones TE24II and TE28, with an insert-bearing PCR product used as the hybridization probe; the heavy lines indicate hybridization to the probe. R denotes EcoRI recognition site. Panel D shows sequences flanking the 84-bp insert in intron 19. The flanking regions demonstrate homology to splice lariat, acceptor, and donor sites; the bases matching the consensus sequence are capitalized. The index patient had a C-to-T mutation in the second base 3' of the insert sequence (arrow).

 
The sequence of genomic DNA (Figure 2) revealed that the inbred patient had a T residue two bases downstream of the 84-bp insert, whereas a C residue was present in the normal subject. The father was heterozygous for the C-to-T mutation at this position. This substitution creates a sequence with strong homology to a splice-donor site (Figure 1D).


View larger version (336K):
[in this window]
[in a new window]
  		Figure 2. Sequence of the PCR Product from Intron 19 in the Index Patient, Her Father, and a Normal Control.

The patient is homozygous for a G-to-A mutation (arrow) on the antisense strand. Her father is a heterozygous carrier.

 
The C-to-T mutation in intron 19 is termed a 3849+10 kb C-to-T mutation (3849 is the number of the last base in exon 19, and 10 kb indicates that the mutation is approximately 10 kb downstream from 3849). The mutation creates a new HphI restriction site, and we used HphI restriction digestion to screen the other patients with cystic fibrosis who had normal sweat chloride values. Thirteen patients had at least one copy of the mutation in intron 19 (Table 1): two were homozygous for the mutation, nine were compound heterozygotes with {Delta}F508, and two siblings were compound heterozygotes with W1282X. The mutation in intron 19 was associated with three different ethnic origins (Pakistani, Ashkenazi Jewish, and northern European white) and at least three different extended haplotypes (data not shown).

Correlation of Mutation with Disease

One patient who was homozygous for the mutation in intron 19 (Patient 2 in Table 1) was homozygous for the C haplotype; although consanguinity could not be documented, both parents traced their ancestry to the same Jewish community in Eastern Europe. The pedigree of this patient's family shows the correlation of the disease with the mutation in intron 19 (Figure 3); neither of two clinically unaffected sisters was homozygous for the mutation. Sixteen siblings or parents of affected persons were genotyped, and the mutation in intron 19 was associated with known cystic fibrosis mutations only in persons who had clinical disease compatible with cystic fibrosis. We screened 137 cystic fibrosis chromosomes with unidentified mutations from patients with cystic fibrosis who had clearly elevated sweat chloride values and 60 non-cystic fibrosis chromosomes derived from obligate carriers. No mutations in intron 19 were found.


View larger version (157K):
[in this window]
[in a new window]
  		Figure 3. Detection of the 3849+10 kb C-to-T Mutation by PCR and HphI Digestion.

The figure shows the pedigree of a patient (Patient 2 in Table 1) who is homozygous for the 3849+10 kb C-to-T mutation. The square denotes a male family member, circles female family members, the solid symbol a homozygous family member, the open symbol a normal family member, and half-solid symbols heterozygous family members. DNA from each family member was amplified with primers 4712 and 4713 and digested with HphI. The normal allele has one HphI site, yielding bands of 349 and 88 bp (the noncarrier sister, lane 6). The C-to-T mutation creates a new HphI restriction site, and the mutant allele shows bands of 222, 127, and 88 bp (lane 4). Plus and minus signs indicate whether samples were treated with HphI. Lane 1 shows a sample of undigested DNA from the patient.

 
Expression of Normally Spliced CFTR mRNA

Normally spliced CFTR mRNA was detected in the nasal epithelial sample from one patient homozygous for the mutation in intron 19 (Figure 4A, lanes 1 through 5) relative to the normal sample (Figure 4A, lanes 6 through 10). The amount of normal CFTR mRNA in the sample from the patient was only 8 percent of that in the normal sample (Figure 4B). Similar results were obtained by an alternative method using quantitative competitive PCR with other samples from this patient. The amount of normal CFTR mRNA was only 5 to 10 percent of that in nasal epithelial samples from three normal subjects.


View larger version (74K):
[in this window]
[in a new window]
  		Figure 4. Quantitation of Normally Spliced CFTR mRNA Expressed in Nasal Epithelial Cells from a Patient with the Intron 19 Mutation.

Panel A shows an autoradiograph of a Southern blot assay of PCR products from parallel reactions of CFTR cDNA and {gamma}-actin cDNA from a patient with cystic fibrosis who was homozygous for the point mutation in intron 19 (lanes 1 through 5), a normal subject (lanes 6 through 10), and plasmid standards with sequential 10-fold increases (from 10 to 105) in the initial target copy numbers (lanes 11 through 15). Panel B shows the relative expression of normal CFTR mRNA in the sample from the patient who was homozygous for the mutation in intron 19, as compared with the sample from the normal subject. The level of expression was determined by a quantitative analysis of the hybridization in Panel A using phosphor-screen autoradiography. CFTR expression was standardized to {gamma}-actin expression.

 
Discussion

Patients with clinical disease compatible with cystic fibrosis who do not have diagnostic sweat chloride values are commonly evaluated at cystic fibrosis centers6,26,28,29. It has been difficult to establish firmly the diagnosis of cystic fibrosis in these patients, because testing for specific biologic markers for cystic fibrosis18,23,24 is not widely available and only one mutation in CFTR (G551S), found infrequently in such patients, has been associated with this syndrome22.

We identified a change in a single base pair in intron 19, termed a 3849+10 kb C-to-T mutation, in 13 patients who had this syndrome of cystic fibrosis-like lung disease and normal sweat chloride values. The C-to-T mutation in intron 19 leads to novel alternative splicing through the partial activation of a cryptic splice site and the insertion into most CFTR transcripts of a new 84-bp "exon," complete with an in-frame stop codon between exons 19 and 20 (Figure 1B). The C residue at position 2 of the cryptic (nonfunctional) splice-donor site in normal genomic DNA (Figure 1D) is part of a cytidine phosphate guanosine dinucleotide, which is the site of frequent point mutations30. No other sequence variant was found in the coding region of a patient who was homozygous for the mutation in intron 19. This mutation was not found in 60 normal chromosomes or in 137 cystic fibrosis chromosomes associated with elevated sweat chloride values. These findings, along with the correlation of this change of a base pair with the disease, demonstrates that these 13 patients have a form of cystic fibrosis.

The molecular nature of the mutation in intron 19 is compatible with the exon-shuffling theory,31 which proposes that point mutations that create or destroy splice sites can cause the insertion or deletion of clusters of amino acids ("exons"), thereby increasing the rate at which proteins can evolve. A similar intronic mutation has been described in the small second intervening sequence of the beta-globin gene32. Such splice mutations are not easily detected with genomic DNA, and an approach using mRNA offers a better opportunity to identify them. Once they are identified, the presence of new unique restriction sites permits rapid diagnosis based on DNA analysis.

The 3849+10 kb C-to-T mutation is found in patients with sufficient sweat-duct epithelial chloride absorption to produce normal sweat. Patients with the mutation in intron 19 also appear to have milder pulmonary disease than do patients homozygous for {Delta}F508, although the varying severity of pulmonary disease among patients with the same genotype27 precludes a definitive analysis in our small and prospectively selected population. In this small group there was no obvious difference in clinical phenotype between patients homozygous for the mutation in intron 19 and those heterozygous for the mutation.

A clue to the molecular basis of the variant phenotype was provided by the analysis of mRNA transcripts expressed in these patients. No full-length CFTR protein is expected to be translated from the mRNA containing the 84-bp insert with the in-frame stop codon, but mRNA without the insert (occurring at approximately 8 percent of the normal level in respiratory epithelium) would be associated with the synthesis of normal CFTR protein. Whereas these patients have lung disease, Chu et al. have reported that some people with in-frame splice skipping of exon 9 have no lung disease and only 8 to 12 percent of normal CFTR transcripts (i.e., those containing exon 9) in bronchial epithelium33. The apparent difference between these two studies is probably due to technical and molecular considerations.

Modulation of the clinical phenotype associated with the reduced production of a normal protein has been reported. Mutations in the regulatory elements of the beta-globin gene leading to reduced amounts of normal beta chain (i.e., beta-thalassemia) are associated with milder disease than are mutations leading to nonfunctional or absent beta chains34. With respect to these patients with cystic fibrosis-like lung disease and normal sweat chloride values, the differences in disease expression at the organ level, such as abnormal airway epithelial function as compared with normal sweat ductal function, may reflect quantitative differences in the requirement for functional CFTR protein, differences in tissue-specific RNA splicing, or both.

The identification of a mutation in the CFTR gene in patients with normal sweat chloride concentrations has several implications for diagnosis and treatment. First, consideration of the diagnosis of cystic fibrosis must extend to patients with suppurative pulmonary disease and normal sweat chloride values. The mutation in intron 19 may be relatively common, because it was seen in three ethnic groups and on three different extended haplotypes. Furthermore, this mutation has been noted on 104 chromosomes reported to the Cystic Fibrosis Gene Analysis Consortium since our initial report,35 and it accounts for about 4 percent of the mutations in Ashkenazi patients with cystic fibrosis in Israel36. Whereas this mutation is common in patients with cystic fibrosis and normal sweat chloride values, it has also been reported in patients with borderline or raised sweat chloride concentrations37,38.

Second, patients with the mutation in intron 19 have low levels of normal CFTR mRNA. Future ability to quantitate the expression of CFTR protein in patients with cystic fibrosis and this mutation will provide information about the levels of CFTR expression needed to achieve a normal phenotype in a variety of affected epithelial sites. This information may provide a better understanding of CFTR function and serve as a guide for protein or gene therapy.

Finally, increased understanding of CFTR gene regulation, mRNA splicing, and protein expression may give patients with the mutation in intron 19 therapeutic alternatives: the up-regulation of CFTR gene expression, the inhibition of alternative splicing, and the stabilization of CFTR protein would presumably all improve the defense mechanisms of the lung.

Note added in proof: Since submitting this manuscript, we have identified 6 of approximately 45 men known to have this mutation who do not have obstructive azoospermia according to semen analysis or who have fathered children, or both, including one of our patients (Patient 7A in Table 1)37 (and Bowman M, Cutting G, Dreyfus D, McCoy K, Gelfand E, Bethel R: personal communication). This is higher than the expected prevalence of fertility (<1 percent) in men with other mutations in CFTR.

Supported by grants (HL34322 and RR000046) from the National Institutes of Health, grants (R06 and Z440) from the Cystic Fibrosis Foundation, and a grant (R6041L) from the American Lung Association of North Carolina

We are indebted to Drs. John Bloom, Rebecca Buckley, Gerald Fernald, Frank Kellogg, Peter Manos, Nathan Seriss, and Gerald Strope for providing information about patients; to Lynn Bonitz, R.N., B.S., for assistance in acquiring blood samples from patients; to Dr. Lloyd Edwards for statistical advice; to Drs. Michael Swift and William Marzluff for thoughtful discussions; to Drs. Lap-Chee Tsui and Joanna Rommens for providing phage clones TE28 and TE24II and plasmid pTE24II6, and for valuable discussions; to Nancy Callanan, M.S., for assistance in developing the family pedigrees; to Nina Church, M.Sc., Joe Robinson, M.Sc., and Beverly M. Wood, M.T. (A.S.C.P.), for technical assistance; and to Lisa Brown for editorial assistance.


Source Information

From the Applied Technology Genetics Corp., Malvern, Pa. (W.E.H.); the Department of Medicine (L.H.B., Z.Z., J.C.O., R.C.B., M.R.K.) and the Division of Molecular Pathology (Z.Z., K.J.F., L.M.S.), University of North Carolina, Chapel Hill; Children's Hospital Medical Center, Cincinnati (T.E.B.); the Department of Pediatrics, Duke University, Durham, N.C. (A.S.); Schneider Children's Hospital-Long Island Jewish Medical Center, New Hyde Park, N.Y. (J.D.G.); and the Pediatric Pulmonary Division, Columbia-Presbyterian Medical Center, New York (L.Q.).

Address reprint requests to Dr. Knowles at the Division of Pulmonary Diseases, 724 Burnett-Womack Bldg., CB 7020, University of North Carolina at Chapel Hill, Chapel Hill, NC 27599-7020.

References

  1. Riordan JR, Rommens JM, Kerem B, et al. Identification of the cystic fibrosis gene: cloning and characterization of complementary DNA. Science 1989;245:1066-1073. [Erratum, Science 1989;245:1437.] [Free Full Text]
  2. Kerem B, Rommens JM, Buchanan JA, et al. Identification of the cystic fibrosis gene: genetic analysis. Science 1989;245:1073-1080. [Free Full Text]
  3. Collins FS. Cystic fibrosis: molecular biology and therapeutic implications. Science 1992;256:774-779. [Free Full Text]
  4. Anderson MP, Gregory RJ, Thompson S, et al. Demonstration that CFTR is a chloride channel by alteration of its anion selectivity. Science 1991;253:202-205. [Free Full Text]
  5. Bear CE, Li C, Kartner N, et al. Purification and functional reconstitution of the cystic fibrosis transmembrane conductance regulator (CFTR). Cell 1992;68:809-818. [CrossRef][Medline]
  6. Boat TF, Welsh MJ, Beaudet AL. Cystic fibrosis. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic basis of inherited disease. Vol. 2. 6th ed. New York: McGraw-Hill, 1989:2649-80.
  7. Gibson LE, Cooke RE. A test for concentration of electrolytes in sweat in cystic fibrosis of the pancreas utilizing pilocarpine by iontophoresis. Pediatrics 1959;23:545-549. [Free Full Text]
  8. Davis PB, Del Rio S, Muntz JA, Dieckman L. Sweat chloride concentration in adults with pulmonary diseases. Am Rev Respir Dis 1983;128:34-37. [Medline]
  9. Friedman KJ, Highsmith WE Jr, Silverman LM. Detecting multiple cystic fibrosis mutations by polymerase chain reaction-mediated site-directed mutagenesis. Clin Chem 1991;37:753-755. [Free Full Text]
  10. Chirgwin JM, Przybyla AE, MacDonald RJ, Rutter WJ. Isolation of biologically active ribonucleic acid from sources enriched in ribonuclease. Biochemistry 1979;18:5294-5299. [CrossRef][Medline]
  11. Knowles MR, Carson JL, Collier AM, Gatzy JT, Boucher RC. Measurements of nasal transepithelial electric potential differences in normal human subjects in vivo. Am Rev Respir Dis 1981;124:484-490. [Medline]
  12. Gyllensten UB, Erlich HA. Generation of single-stranded DNA by the polymerase chain reaction and its application to direct sequencing of the HLA-DQA locus. Proc Natl Acad Sci U S A 1988;85:7652-7656. [Free Full Text]
  13. Trapnell BC, Chu C-S, Paakko PK, et al. Expression of the cystic fibrosis transmembrane conductance regulator gene in the respiratory tract of normal individuals and individuals with cystic fibrosis. Proc Natl Acad Sci U S A 1991;88:6565-6569. [Free Full Text]
  14. Gunning P, Ponte P, Okayama H, Engel J, Blau H, Kedes L. Isolation and characterization of full-length cDNA clones for human alpha-, beta-, and gamma-actin mRNAs: skeletal but not cytoplasmic actins have an amino-terminal cysteine that is subsequently removed. Mol Cell Biol 1983;3:787-795. [Free Full Text]
  15. Erba HP, Gunning P, Kedes L. Nucleotide sequence of the human gamma cytoskeletal actin mRNA: anomalous evolution of vertebrate non-muscle actin genes. Nucleic Acids Res 1986;14:5275-5294. [Free Full Text]
  16. Beaudet AL, Spence JE, Montes M, et al. Experience with new DNA markers for the diagnosis of cystic fibrosis. N Engl J Med 1988;318:50-51. [Medline]
  17. Dork T, Neumann T, Wulbrand U, et al. Intra- and extragenic marker haplotypes of CFTR mutations in cystic fibrosis families. Hum Genet 1992;88:417-425. [CrossRef][Medline]
  18. Quinton PM, Bijman J. Higher bioelectric potentials due to decreased chloride absorption in the sweat glands of patients with cystic fibrosis. N Engl J Med 1983;308:1185-1189. [Abstract]
  19. Bijman J, Quinton PM. Influence of abnormal Cl- impermeability on sweating in cystic fibrosis. Am J Physiol 1984;247:C3-C9. [Free Full Text]
  20. Sato K, Sato F. Defective beta adrenergic response of cystic fibrosis sweat glands in vivo and in vitro. J Clin Invest 1984;73:1763-1771.
  21. Sato K, Sato F. Variable reduction in beta-adrenergic sweat secretion in cystic fibrosis heterozygotes. J Lab Clin Med 1988;111:511-518. [Medline]
  22. Strong TV, Smit LS, Turpin SV, et al. Cystic fibrosis gene mutation in two sisters with mild disease and normal sweat electrolyte levels. N Engl J Med 1991;325:1630-1634. [Medline]
  23. Knowles M, Gatzy J, Boucher R. Increased bioelectric potential difference across respiratory epithelia in cystic fibrosis. N Engl J Med 1981;305:1489-1495. [Abstract]
  24. Knowles M, Gatzy J, Boucher R. Relative ion permeability of normal and cystic fibrosis nasal epithelium. J Clin Invest 1983;71:1410-1417.
  25. Knowles M, Gatzy J, Boucher R. Modulation of nasal epithelial ion permeability in normal and cystic fibrosis subjects in vivo. Clin Res 1983;31:858A-858A.abstract 
  26. Davis PB, Hubbard VS, Di Sant'Agnese PA. Low sweat electrolytes in a patient with cystic fibrosis. Am J Med 1980;69:643-646. [CrossRef][Medline]
  27. Kerem E, Corey M, Kerem B-S, et al. The relation between genotype and phenotype in cystic fibrosis -- analysis of the most common mutation ({Delta}F508). N Engl J Med 1990;323:1517-1522. [Abstract]
  28. Shwachman H. The heterogeneity of cystic fibrosis. In: Bergsma D, ed. The Fourth Conference on the Clinical Delineation of Birth Defects: Part XIII: G.I. tract including liver and pancreas. Birth defects: original article series. Baltimore: Williams & Wilkins, 1972:102-7.
  29. Stern RC, Boat TF, Abramowsky CR, Matthews LW, Wood RE, Doershuk CF. Intermediate-range sweat chloride concentration and Pseudomonas bronchitis: a cystic fibrosis variant with preservation of exocrine pancreatic function. JAMA 1978;239:2676-2680. [Abstract]
  30. Cooper DN, Krawczak M. The mutational spectrum of single base-pair substitutions causing human genetic disease: patterns and predictions. Hum Genet 1990;85:55-74. [Medline]
  31. Gilbert W. Why genes in pieces? Nature 1978;271:501-501. [CrossRef][Medline]
  32. Cheng T-C, Orkin SH, Antonarakis SE, et al. {beta}-Thalassemia in Chinese: use of in vivo RNA analysis and oligonucleotide hybridization in systematic characterization of molecular defects. Proc Natl Acad Sci U S A 1984;81:2821-2825. [Free Full Text]
  33. Chu C-S, Trapnell BC, Curristin SM, Cutting GR, Crystal RG. Extensive posttranscriptional deletion of the coding sequences for part of nucleotide-binding fold 1 in respiratory epithelial mRNA transcripts of the cystic fibrosis transmembrane conductance regulator gene is not associated with the clinical manifestations of cystic fibrosis. J Clin Invest 1992;90:785-790.
  34. Weatherall DJ, Clegg JB, Higgs DR, Wood WG. The hemoglobinopathies. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic basis of inherited disease. Vol. 2. 6th ed. New York: McGraw-Hill, 1989:2281-339.
  35. The Cystic Fibrosis Genetic Analysis Consortium. Population variation of common cystic fibrosis mutations. Hum Mutat 1994;4:167-177. [CrossRef][Medline]
  36. Abeliovich D, Lavon IP, Lerer I, et al. Screening for five mutations detects 97% of cystic fibrosis (CF) chromosomes and predicts a carrier frequency of 1:29 in the Jewish Ashkenazi population. Am J Hum Genet 1992;51:951-956. [Medline]
  37. Gilbert F, Giampietro P, Li Z, Rosales N, NY CF Research Network. Genotype/phenotype correlations in CF: lessons from the mutation 3849+10. Pediatr Pulmonol 1992;14:Suppl 8:240-240.abstract 
  38. Augarten A, Kerem B-S, Yahav Y, et al. Mild cystic fibrosis and normal or borderline sweat test in patients with the 3849 + 10 kb C-to-T mutation. Lancet 1993;342:25-26. [CrossRef][Medline]

 

This Article
-Abstract

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation

This article has been cited by other articles:


HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2008 Massachusetts Medical Society. All rights reserved.