Estrogen Resistance Caused by a Mutation in the Estrogen-Receptor Gene in a Man
Eric P. Smith, Jeff Boyd, Graeme R. Frank, Hiroyuki Takahashi, Robert M. Cohen, Bonny Specker, Timothy C. Williams, Dennis B. Lubahn, and Kenneth S. Korach
Background and Methods Mutations in the estrogen-receptor genehave been thought to be lethal. A 28-year-old man whose estrogenresistance was caused by a disruptive mutation in the estrogen-receptorgene underwent studies of pituitary-gonadal function and bonedensity and received transdermal estrogen for six months. Estrogen-receptorDNA, extracted from lymphocytes, was evaluated by analysis ofsingle-strand-conformation polymorphisms and by direct sequencing.
Results The patient was tall (204 cm [80.3 in.]) and had incompleteepiphyseal closure, with a history of continued linear growthinto adulthood despite otherwise normal pubertal development.He was normally masculinized and had bilateral axillary acanthosisnigricans. Serum estradiol and estrone concentrations were elevated,and serum testosterone concentrations were normal. Serum follicle-stimulatinghormone and luteinizing hormone concentrations were increased.Glucose tolerance was impaired, and hyperinsulinemia was present.The bone mineral density of the lumbar spine was 0.745 g persquare centimeter, 3.1 SD below the mean for age-matched normalwomen; there was biochemical evidence of increased bone turnover.
The patient had no detectable response to estrogen administration,despite a 10-fold increase in the serum free estradiol concentration.Conformation analysis of his estrogen-receptor gene revealeda variant banding pattern in exon 2. Direct sequencing of exon2 revealed a cytosine-to-thymine transition at codon 157 ofboth alleles, resulting in a premature stop codon. The patient'sparents were heterozygous carriers of this mutation, and pedigreeanalysis revealed consanguinity.
Conclusions Disruption of the estrogen receptor in humans neednot be lethal. Estrogen is important for bone maturation andmineralization in men as well as women.
The actions of adrenal and gonadal steroids, thyroid hormone,and vitamin D are mediated by receptors encoded by a familyof related genes. Mutations of glucocorticoid, androgen, thyroidhormone, and vitamin D receptors leading to syndromes of hormoneresistance have been reported1,2,3,4. It has been thought thatmutation of the estrogen-receptor gene would be lethal, affectingembryo implantation in particular5. Recent insertional disruptionof the mouse estrogen-receptor gene6 and two case reports,7,8however, raise questions about the validity of the lethalityhypothesis and reveal intriguing phenotypes. In mice with disruptedestrogen-receptor genes, both sexes are viable. The affectedfemale mice have hypoplastic breasts and uteri, hyperemic cysticovaries without corpora lutea, infertility, and decreased skeletalmineralization; the male mice have decreased skeletal mineralizationand low sperm counts.
The first case report7 involving decreased estrogen synthesisdescribed a female patient with pseudohermaphroditism due toplacental aromatase deficiency, suggesting that, at least beginninglate in the first trimester, excess androgen with low or absentestrogen in the female fetus is compatible with life. The secondcase report8 described a karyotypically female patient withpseudohermaphroditism caused by a null mutation in the aromatasecytochrome P-450 gene. At puberty progressive virilization withoutbreast development or growth acceleration was noted. Estrogentreatment resulted in normal breast development, a pubertalgrowth spurt, and menarche, suggesting that androgen is relativelyineffective in stimulating pubertal growth.
In this report, we describe a man with estrogen resistance whohad osteoporosis, unfused epiphyses, and continuing linear growthin adulthood. He also had elevated serum estrogen concentrations,abnormal gonadotropin secretion, and no target-tissue responsesto estrogen therapy. Analysis of the estrogen-receptor generevealed a change in a single base pair in the second exon,generating a premature stop codon. These findings indicate thatestrogen-receptor mutations need not be lethal and that estrogenis important in the male, as it is in the female, for normalskeletal growth and development.
Case Report
A 28-year-old white man presented to an orthopedic surgeon withtall stature and a four-to-five-year history of progressivegenu valgum. Because radiologic evaluation revealed unfusedepiphyses, he was referred for further evaluation. His birthweight and early growth and development were within normal limits,and his stature was in the average range. He first noted pubicand axillary hair at 12 to 13 years of age and started shavingregularly at age 17 to 18 years of age but had no recollectionof associated growth acceleration. His height at the age of16 was approximately 178 cm (70 in.) according to informationprovided on his driver's license (Figure 1). His legs and feetcontinued to grow slowly after adolescence.
Figure 1. Growth Chart of a 28-Year-Old Man with Estrogen Resistance and Radiographs of the Left Hand and Wrist and Left Knee.
Anthropometric measurements made at the age of 28 years are also shown.
Review of the family history revealed four sisters who wereaverage in stature (160 to 165 cm [63 to 65 in.]). His motherwas 162 cm (64 in.) tall, and his father was 180 cm (71 in.).His mother was given a diagnosis of non-insulin-dependent diabetesmellitus at the age of 45 years. A paternal uncle had coloncancer, two maternal cousins had insulin-dependent diabetesmellitus (one of whom was given the diagnosis in infancy), anda niece had XO/XY mixed gonadal dysgenesis.
The patient had a history of Osgood-Schlatter disease, whichwas diagnosed when he was 20 years of age and was treated withrest. At the age of 24, a meniscal tear in the right knee requiredarthroscopic surgery and the results of a glucose-tolerancetest were reportedly slightly abnormal. There was no historyof polyuria, polydipsia, blurred vision, or nocturia. The patientdid not recall any change in facial structure, thickening oroiliness of the skin, excessive diaphoresis, skin tags, or changesin his voice. He did remember noticing increased pigment inthe skin of each axilla starting at the age of 23. Though unmarried,he reported no history of gender-identity disorder. He indicatedstrong heterosexual interests and had normal functioning, includingmorning erections and nocturnal emissions.
Physical examination revealed a tall, healthy-appearing manwith no acromegaloid features but with obvious genu valgum.His height was 204 cm (80.3 in.) (>95th percentile), weight127 kg (280 lb), heart rate 80 per minute, and blood pressure140/85 mm Hg. The upper segment of his body was 96 cm (37.7in.), and his lower segment was 109 cm (42.9 in.), yieldinga ratio of the upper segment to the lower segment of 0.88 (averagefor men, 0.96). His left middle finger measured 10 cm (3.9 in.)(97th percentile, 9 cm), left hand 23 cm (8.9 in.) (97th percentile,19.5 cm), and foot 33 cm (13 in.) (97th percentile, 29 cm).He had an arm span of 213 cm (83.8 in.). There was bilateralaxillary acanthosis nigricans and a 0.5-cm skin tag in the leftaxilla. The patient had a full beard with early temporal hairloss. There was no thyroid enlargement or gynecomastia. Theresults of cardiovascular, respiratory, and abdominal examinationswere normal. The patient had normal male genitalia with bilateraldescended testes, each with a volume of 20 to 25 ml, and a normal-sizedprostate gland.
Radiography of his left wrist and hand revealed a bone age of15 years9 (Figure 1). Knee films revealed open epiphyses (Figure 1);a review of radiographs from previous orthopedic evaluationsdemonstrated minimal evidence of epiphyseal maturation overa 10-year period and demineralized bones. The density of thelumbar spine, measured by dual-energy x-ray absorptiometry (Hologic,Waltham, Mass.), was 0.745 g per square centimeter (3.1 SD belowthe mean for age-matched normal women and more than 2 SD belowthe mean for 15-year-old boys [the patient's bone age]). Thekaryotype was 46,XY. Semen analysis revealed a sperm densityof 25 million per milliliter (normal, >20 million per milliliter),with a viability of 18 percent (normal, >50 percent). Theresults of initial laboratory tests are shown in Table 1. Theserum testosterone concentration was normal, and estradiol,estrone, follicle-stimulating hormone, and luteinizing hormoneconcentrations were high. A five-hour oral glucose-tolerancetest (75 g) revealed a fasting blood glucose concentration of135 mg per deciliter (7.6 mmol per liter), a peak response of224 mg per deciliter (12.5 mmol per liter) at three hours, anda concentration of 163 mg per deciliter (9.1 mmol per liter)at five hours. The respective serum insulin values were 50 microU per milliliter (300 pmol per liter), 114 micro U per milliliter(684 pmol per liter), and 93 micro U per milliliter (558 pmolper liter).
Table 1. Biochemical Measurements before and after Four and Six Months of Transdermal Ethinyl Estradiol Therapy in a Man with Estrogen Resistance.
On the basis of the hypothesis that primary estrogen resistancemight explain the elevated serum estrogen and abnormal serumgonadotropin concentrations, failure of epiphyseal fusion, andpossibly insulin resistance, the patient was treated with high-dosetransdermal ethinyl estradiol (Estraderm patch system, Ciba,Summit, N.J.) for six months. The starting dose was 2 100-µgpatches per week, with 100-µg increments each week untila maintenance dose of 14 100-µg patches per week was reached.The dose was based on clinical experience with men treated withhigh doses of estrogen for either prostate cancer or transsexualconversion10,11. This protocol was approved by the CincinnatiChildren's Hospital institutional review board, and the patientgave informed consent.
The serum hormone and metabolic measurements before and afterfour and six months of estrogen therapy are shown in Table 1.(All serial tests in Table 1 were performed at the Nichols Institute,San Juan Capistrano, Calif., and for each assay, results wereanalyzed simultaneously for purposes of comparison).
During estrogen therapy, the patient had no nausea, fluid retention,hypertension, unusual headaches, weight gain, gynecomastia,impotence, or mood alterations. In addition, there was no significantincrease in the serum concentration of any estrogen-dependentprotein (sex hormone-binding globulin, thyroxine-binding globulin,cortisol-binding globulin, or prolactin) or change in serumgonadotropin concentrations (Table 1). The results of testsof bone turnover were all consistent with active bone demineralizationand did not decrease. Finally, total bone mineral density andbone age did not change during estrogen administration.
Because of the patient's resistance to estrogen, peripheral-bloodlymphocyte DNA was obtained to study his estrogen-receptor geneby analysis of single-strand-conformation polymorphisms12. Exons1 through 813 were independently amplified by the polymerasechain reaction (PCR) and subjected to single-strand-conformationanalysis with DNA from several normal subjects as a control.All exons were wild type, with the exception of exon 2, whichhad a variant banding pattern suggestive of a homozygous mutation(Figure 2B). Direct sequencing of the exon 2 product revealedthe substitution of thymine for cytosine at codon 157 (Figure 2C),resulting in the replacement of an arginine codon (CGA)with a premature stop codon (TGA). The translated protein wouldtherefore be severely truncated, lacking the DNA-binding andhormone-binding domains (Figure 2A), and expected to be functionallyinert. Because the mutation was homozygous, the patient's parentswere interviewed to obtain a more detailed family history. Thefamily pedigree (Figure 3) demonstrates that his parents weresecond cousins. On the basis of slot blot analyses performedwith wild-type and mutant oligonucleotide probes (Figure 4A)and direct sequence analysis (Figure 4B), each parent, as wellas three of the patient's four sisters, proved to be heterozygousfor the mutation, a finding consistent with autosomal recessiveinheritance.
Panel A shows the location of the codon 157 mutation in the estrogen-receptor protein. The mutation occurs in the A/B domain that is upstream of both the DNA-binding and hormone-binding domains and would be expected to yield a severely truncated protein with no functional activity. Panel B shows the results of single-strand-conformation analysis of exon 2 of the estrogen-receptor gene. A homozygous sequence variant is present in the patient's DNA (lane 10) but not in DNA from nine normal subjects (lanes 1 through 9). In Panel C, sequence analysis of the exon 2 PCR product revealed that the patient had thymine substituted for cytosine at codon 157 (indicated by the asterisk).
Figure 3. Pedigree of a Man with Estrogen Resistance Demonstrating Consanguinity (Double Lines).
Sequence analysis of the estrogen-receptor gene was performed only in the proband, his parents, and his sisters. Squares denote male family members, circles female family members, the solid square the homozygous proband, half-solid symbols family members who were heterozygous for the estrogen-receptor mutation, the cross a stillbirth, and small circles spontaneous abortions.
Figure 4. Parental Origin of the Mutation of the Estrogen-Receptor Gene.
Panel A shows the results of DNA slot blotting after hybridization with radiolabeled oligonucleotide probes specific for the wild-type or mutant sequence of exon 2. The filter contained PCR-amplified exon 2 from DNA of the patient (slot 1), his father (slot 2), his mother (slot 6), and two normal subjects (slots 3 and 5). For slot blot analysis of parental DNA, the exon 2 products obtained by PCR were blotted and hybridized to radiolabeled oglionucleotide probes as described.14 The oglionucleotide sequences were as follows: 5'TTCAGATAATCGACGCCAGGG3' (wild type) and 5'TTCAGATAATTGACGCCAGGG3' (mutant). In Panel B, sequence analysis of the exon 2 PCR product indicated constitutional heterozygosity for the codon 157 mutation in both parents.
Methods
The coding region of the estrogen-receptor gene was amplifiedby PCR. Primer sequences for the eight coding exons of the genewere designed on the basis of information on the exon-intronjunction sequence13. The forward primer sequence for exon 2was 5'CCCAGGCCAAATTCAGATAA3', and the reverse primer sequencewas 5'CGTTTTCAACACACTATTAC3'. PCR was carried out with 35 cyclesconsisting of one minute at 94 °C, one minute at 55 °C,and one minute at 72 °C. The reaction mixtures were heatedat 94 °C for 90 seconds before the first cycle and at 72°C for 7 minutes after the last cycle. After amplification,a 4-microl aliquot of the product was diluted with denaturingbuffer, heated at 95 °C for five minutes, and cooled onice for five minutes; 3 to 4 microl of this solution was usedfor electrophoresis.
The gels used for single-strand-conformation analysis consistedof 0.5X MDE solution (AT Biochem, Malvern, Pa.) and 0.6X TBEbuffer (89 mM Tris, 89 mM borate, and 2 mM EDTA), and they wererun in 0.6X TBE buffer at 8 W for 16 hours at room temperature.For sequence analysis, both strands of the purified exon 2 productsobtained by PCR were subjected to cycle sequencing with a double-strandedDNA Cycle Sequencing System (Life Technologies, Gaithersburg,Md.) as specified by the manufacturer, except that [-33P]ATPwas used for primer labeling. Sequencing reaction samples wererun on a 6 percent polyacrylamide gel containing 8.3 M ureaat 70 W for two to four hours at room temperature and processedfor autoradiography according to standard procedures.
Discussion
The findings in this man with a naturally occurring disruptivemutation of the estrogen-receptor gene demonstrate that mutationsin this gene need not be lethal. The major phenotypic manifestationsof estrogen resistance that he demonstrated were tall staturewith evidence of continued slow linear growth, markedly delayedskeletal maturation, and osteoporosis. These abnormalities providecompelling evidence of the critical part played by estrogenin bone development and mineralization during puberty not onlyin girls but also in boys.
The pubertal growth spurt and epiphyseal maturation are consideredto be induced primarily by the actions of sex steroids, estrogenin the female and androgen in the male. The close associationof sex steroids and advancement of bone age is well demonstratedin precocious puberty, which is characterized by a prematureincrease in sex-steroid secretion, increased height velocity,accelerated epiphyseal maturation, and reduced final adult height15.Despite the normal timing of pubertal onset and normal serumandrogen concentrations, this adult with estrogen resistancehad a bone age of 15 years and a slow continued increase inheight during his third decade. His presentation is similarto that of a genetic female with pseudohermaphroditism causedby an aromatase-gene defect in whom androgen was present inthe absence of circulating estrogen, rather than estrogen resistance8,16.Despite virilization at puberty, the patient's bone age wasdelayed relative to her chronologic age, and she had no growthspurt16. However, unlike the results in this man with estrogeninsensitivity, her treatment with estrogen resulted in growthacceleration, advancement of bone age, and breast development.Finally, our patient's phenotype is consistent with that associatedwith two other conditions, testotoxicosis and androgen insensitivity.In testotoxicosis, in which there is autonomous production ofandrogen from the testes, therapy with an antiandrogen aloneis not sufficient to slow skeletal growth to a prepubertal rate;this is achieved by the addition of an aromatase inhibitor17.Patients with complete androgen insensitivity have a pubertalgrowth spurt that is normal for a genetic female in both magnitudeand timing18. This man's phenotype confirms what these earlierclinical observations suggested -- namely, that estrogen hasa critical role in pubertal growth and epiphyseal maturationin both sexes.
Although the importance of estrogen deficiency in the pathogenesisof osteoporosis in postmenopausal women is well known, manyclinical observations have supported the idea that androgenis important for the maintenance of bone mass in men. Men withhypogonadism have osteoporosis19,20; decreased serum testosteroneconcentrations in elderly men are a risk factor for fractures21;men with a history of constitutional delay of puberty have decreasedbone density as adults22; and androgenic steroids increase bonemass23. This man with estrogen resistance had a severely undermineralizedskeleton with biochemical evidence of increased bone resorption24,25despite normal serum androgen concentrations. These observationsindicate that androgen alone is not sufficient to promote skeletalmaturation and retain bone mass and that estrogen has a pivotalrole in the mineralization of the skeleton in males as wellas females.
The elevated serum estrogen concentrations in this man suggesta compensatory increase in aromatase activity in response toestrogen resistance, and increased aromatase activity couldaccount for the normal concentrations of androgen despite increasedsecretion of luteinizing hormone. In men, multiple tissues areinvolved in the aromatization of androgen to form estrogen,including the testes, liver, skin, and adipose tissue26,27.Testicular estrogen secretion is stimulated by luteinizing hormone,making the testis the most likely source of the elevated serumestrogen concentrations in this man. His elevated gonadotropinsecretion suggests that estrogen plays a part in the regulationof gonadotropin secretion in men.
The relation of insulin resistance, glucose intolerance, andacanthosis nigricans to estrogen resistance in the patient isintriguing. Isolated increases in estrogen improve glucose toleranceby enhancing either target-tissue responsiveness to insulinor insulin secretion28,29,30. Acanthosis nigricans is a cutaneousmarker of insulin resistance, especially when insulin resistanceis associated with relative hyperandrogenism31. In this man,loss of estrogen effect or an altered balance of androgen andestrogen action may well account for diminished insulin sensitivity,glucose intolerance, and acanthosis nigricans. The elevatedserum concentration of sex hormone-binding globulin, an estrogen-dependentprotein, is unexplained.
It is possible that mutations causing milder estrogen resistanceexist, and that compensatory hyperestrogenemia can overcomethe resistance and result in a normal phenotype. The absenceof lethality and the rather striking phenotype in either sexsuggest that previous cases would eventually have been appropriatelydiagnosed. It is possible that heterozygous women may have impairedfertility, thus reducing the incidence of the mutation in thepopulation and decreasing the prevalence of homozygous cases.Notably, the patient's mother had three spontaneous abortions.Regardless, this patient's diagnosis suggests that there arelikely to be other patients with phenotypic presentations ofvariable severity. Estrogen-receptor defects should be includedin the differential diagnosis of such apparently disparate entitiesas tall stature, unfused epiphyses, osteoporosis, abnormal gonadotropinsecretion, and infertility.
Supported in part by the Children's Hospital-University of CincinnatiClinical Research Center (under grant MO1 RR 08084) and by aclinical research grant (to Dr. Cohen) from the American DiabetesAssociation. Dr. Lubahn was a Pew Scholar.
We are indebted to Drs. Judson J. Van Wyk, Frank S. French,Robert M. Blizzard, Hartmut Malluche, Penelope Manasco, andPhilip S. Zeitler for helpful discussions of this case; to Dr.Richard Jolson, the orthopedic surgeon who first recognizedthe abnormal epiphyseal maturation; to Nichols Institute forperforming numerous assays before and during the estrogen therapy;to Dr. Nancy D. Leslie for lymphocyte transformation; to Ms.JoAnn Horn for technical assistance; and to Ms. Vicki Livengoodfor assistance in the preparation of the manuscript.
Source Information
From the Department of Pediatrics, Divisions of Endocrinology (E.P.S., G.R.F.) and Neonatology (B.S.), Children's Hospital Medical Center, University of Cincinnati College of Medicine, Cincinnati; the Department of Internal Medicine, Division of Endocrinology, University of Cincinnati College of Medicine, Cincinnati (R.M.C., T.C.W.); the Departments of Pediatrics and Pathology, University of North Carolina School of Medicine at Chapel Hill, Chapel Hill (D.B.L.); and the Gynecologic Pathobiology Group, Laboratory of Molecular Carcinogenesis (J.B., H.T.), and Receptor Biology Section, Laboratory and Developmental Toxicology (K.S.K.), National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, N.C.
Address reprint requests to Dr. Smith at the Department of Pediatrics, Division of Endocrinology, Children's Hospital Medical Center, 3333 Burnett Ave., Cincinnati, OH 45229.
References
Chrousos GP, Detera-Wadleigh SD, Karl M. Syndromes of glucocorticoid resistance. Ann Intern Med 1993;119:1113-1124. [Free Full Text]
McDermott MT, Ridgway EC. Thyroid hormone resistance syndromes. Am J Med 1993;94:424-432. [CrossRef][Medline]
Brooks MH, Bell NH, Love L, et al. Vitamin-D-dependent rickets type II: resistance of target organs to 1,25-dihydroxyvitamin D. N Engl J Med 1978;298:996-999. [Abstract]
Brown TR, Lubahn DB, Wilson EM, French FS, Migeon CJ, Corden JL. Functional characterization of naturally occurring mutant androgen receptors from subjects with complete androgen insensitivity. Mol Endocrinol 1990;4:1759-1772. [Abstract]
George FW, Wilson JD. Sex determination and differentiation. In: Knobil E, Neill JD, eds. The physiology of reproduction. New York: Raven Press, 1988:3-26.
Lubahn DB, Moyer JS, Golding TS, Couse JF, Korach KS, Smithies O. Alteration of reproductive function but not prenatal sexual development after insertional disruption of the mouse estrogen receptor gene. Proc Natl Acad Sci U S A 1993;90:11162-11166. [Free Full Text]
Shozu M, Akasofu K, Harada T, Kubota Y. A new cause of female pseudohermaphroditism: placental aromatase deficiency. J Clin Endocrinol Metab 1991;72:560-566. [Abstract]
Ito Y, Fisher CR, Conte FA, Grumbach MM, Simpson ER. Molecular basis of aromatase deficiency in an adult female with sexual infantilism and polycystic ovaries. Proc Natl Acad Sci U S A 1993;90:11673-11677. [Free Full Text]
Greulich WW, Pyle SI. Radiographic atlas of skeletal development of the hand and wrist. 2nd ed. Stanford, Calif.: Stanford University Press, 1959.
Carlstrom K, Collste L, Eriksson A, et al. A comparison of androgen status in patients with prostatic cancer treated with oral and/or parenteral estrogens or by orchidectomy. Prostate 1989;14:177-182. [Medline]
Valenta LJ, Elias AN, Domurat ES. Hormone pattern in pharmacologically feminized male transsexuals in the California State prison system. J Natl Med Assoc 1992;84:241-250. [Medline]
Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 1989;5:874-879. [CrossRef][Medline]
Ponglikitmongkol M, Green S, Chambon P. Genomic organization of the human oestrogen receptor gene. EMBO J 1988;7:3385-3388. [Medline]
Boyd J, Risinger JI. Analysis of oncogene alterations in human endometrial carcinoma: prevalence of ras mutations. Mol Carcinog 1991;4:189-195. [Medline]
Kaplan SL, Grumbach MM. Pathophysiology and treatment of sexual precocity. J Clin Endocrinol Metab 1990;71:785-789. [Medline]
Conte FA, Grumbach MM, Ito Y, Fisher CR, Simpson ER. A syndrome of female pseudohermaphrodism, hypergonadotropic hypogonadism, and multicystic ovaries associated with missense mutations in the gene encoding aromatase (P450arom). J Clin Endocrinol Metab 1994;78:1287-1292. [Abstract]
Laue L, Kenigsberg D, Pescovitz OH, et al. Treatment of familial male precocious puberty with spironolactone and testolactone. N Engl J Med 1989;320:496-502. [Abstract]
Zachmann M, Prader A, Sobel EH, et al. Pubertal growth in patients with androgen insensitivity: indirect evidence for the importance of estrogens in pubertal growth of girls. J Pediatr 1986;108:694-697. [CrossRef][Medline]
Finkelstein JS, Klibanski A, Neer RM, Greenspan SL, Rosenthal DI, Crowley WF Jr. Osteoporosis in men with idiopathic hypogonadotropic hypogonadism. Ann Intern Med 1987;106:354-361.
Foresta C, Ruzza G, Mioni R, et al. Osteoporosis and decline of gonadal function in the elderly male. Horm Res 1984;19:18-22. [Medline]
Swartz CM, Young MA. Male hypogonadism and bone fracture. N Engl J Med 1988;318:996-996. [Medline]
Finkelstein JS, Neer RM, Biller BMK, Crawford JD, Klibanski A. Osteopenia in men with a history of delayed puberty. N Engl J Med 1992;326:600-604. [Abstract]
Dequeker J, Geusens P. Anabolic steroids and osteoporosis. Acta Endocrinol Suppl (Copenh) 1985;271:45-52. [Medline]
Siebel MJ, Robins SP, Bilezikian JP. Urinary pyridinium crosslinks of collagen: specific markers of bone resorption in metabolic disease. Trends Endocrinol Metab 1992;3:263-70.
Hanson DA, Weis MA, Bollen AM, Maslan SL, Singer FR, Eyre DR. A specific immunoassay for monitoring human bone resorption: quantitation of type I collagen cross-linked N-telopeptides in urine. J Bone Miner Res 1992;7:1251-1258. [Medline]
Bhatnagar AS, Muller P, Schenkel L, Trunet PF, Beh I, Schieweck K. Inhibition of estrogen biosynthesis and its consequences on gonadotrophin secretion in the male. J Steroid Biochem Mol Biol 1992;41:437-443. [CrossRef][Medline]
MacDonald PC, Madden JD, Brenner PF, Wilson JD, Siiteri PK. Origin of estrogen in normal men and in women with testicular feminization. J Clin Endocrinol Metab 1979;49:905-916. [Abstract]
Sharp SC, Diamond MP. Sex steroids and diabetes. Diabetes Rev 1993;1:318-42.
Leiter EH, Beamer WG, Coleman DL, Longcope C. Androgenic and estrogenic metabolites in serum of mice fed dehydroepiandrosterone: relationship to antihyperglycemic effects. Metabolism 1987;36:863-869. [CrossRef][Medline]
Prochazka M, Premdas FH, Leiter EH, Lipson LG. Estrone treatment dissociates primary versus secondary consequences of "diabetes" (db) gene expression in mice. Diabetes 1986;35:725-728. [Abstract]
Barbieri RL, Ryan KJ. Hyperandrogenism, insulin resistance, and acanthosis nigricans syndrome: a common endocrinopathy with distinct pathophysiologic features. Am J Obstet Gynecol 1993;147:90-101.
Foresta, C., Zuccarello, D., Garolla, A., Ferlin, A.
(2008). Role of Hormones, Genes, and Environment in Human Cryptorchidism. Endocr. Rev.
29: 560-580
[Abstract][Full Text]
Smith, E. P., Specker, B., Bachrach, B. E., Kimbro, K. S., Li, X. J., Young, M. F., Fedarko, N. S., Abuzzahab, M. J., Frank, G. R., Cohen, R. M., Lubahn, D. B., Korach, K. S.
(2008). Impact on Bone of an Estrogen Receptor-{alpha} Gene Loss of Function Mutation. J. Clin. Endocrinol. Metab.
93: 3088-3096
[Abstract][Full Text]
Page, S. T., Amory, J. K., Bremner, W. J.
(2008). Advances in Male Contraception. Endocr. Rev.
29: 465-493
[Abstract][Full Text]
Khosla, S., Amin, S., Orwoll, E.
(2008). Osteoporosis in Men. Endocr. Rev.
29: 441-464
[Abstract][Full Text]
Miller, V. M., Duckles, S. P.
(2008). Vascular Actions of Estrogens: Functional Implications. Pharmacol. Rev.
60: 210-241
[Abstract][Full Text]
Moran, A., Jacobs, D. R. Jr, Steinberger, J., Steffen, L. M., Pankow, J. S., Hong, C.-P., Sinaiko, A. R.
(2008). Changes in Insulin Resistance and Cardiovascular Risk During Adolescence: Establishment of Differential Risk in Males and Females. Circulation
117: 2361-2368
[Abstract][Full Text]
Heino, T. J, Chagin, A. S, Savendahl, L.
(2008). The novel estrogen receptor G-protein-coupled receptor 30 is expressed in human bone. J Endocrinol
197: R1-R6
[Abstract][Full Text]
Ebeling, P. R.
(2008). Osteoporosis in Men. NEJM
358: 1474-1482
[Full Text]
Venken, K., Bouillon, R., Vanderschueren, D.
(2008). Androgens Versus Estrogens: Different Theories About Opposing Actions on Periosteal Bone Expansion. IBMS BoneKEy
5: 130-136
[Abstract][Full Text]
Nissel, R., Lindberg, A., Mehls, O., Haffner, D., on behalf of the Pfizer International Growth Datab,
(2008). Factors Predicting the Near-Final Height in Growth Hormone-Treated Children and Adolescents with Chronic Kidney Disease. J. Clin. Endocrinol. Metab.
93: 1359-1365
[Abstract][Full Text]
Shulman, D. I., Francis, G. L., Palmert, M. R., Eugster, E. A., for the Lawson Wilkins Pediatric Endocrine Society,
(2008). Use of Aromatase Inhibitors in Children and Adolescents With Disorders of Growth and Adolescent Development. Pediatrics
121: e975-e983
[Abstract][Full Text]
Mauras, N., Gonzalez de Pijem, L., Hsiang, H. Y., Desrosiers, P., Rapaport, R., Schwartz, I. D., Klein, K. O., Singh, R. J., Miyamoto, A., Bishop, K.
(2008). Anastrozole Increases Predicted Adult Height of Short Adolescent Males Treated with Growth Hormone: A Randomized, Placebo-Controlled, Multicenter Trial for One to Three Years. J. Clin. Endocrinol. Metab.
93: 823-831
[Abstract][Full Text]
Hackam, D. G., Hackam, A. S.
(2008). Translation of Genetic Discoveries into Clinical Therapies. ANN INTERN MED
148: 246-247
[Full Text]
Chagin, A. S., Savendahl, L.
(2007). GPR30 Estrogen Receptor Expression in the Growth Plate Declines as Puberty Progresses. J. Clin. Endocrinol. Metab.
92: 4873-4877
[Abstract][Full Text]
Windahl, S. H., Lagerquist, M. K., Andersson, N., Jochems, C., Kallkopf, A., Hakansson, C., Inzunza, J., Gustafsson, J.-A., van der Saag, P. T., Carlsten, H., Pettersson, K., Ohlsson, C.
(2007). Identification of Target Cells for the Genomic Effects of Estrogens in Bone. Endocrinology
148: 5688-5695
[Abstract][Full Text]
Yialamas, M. A., Dwyer, A. A., Hanley, E., Lee, H., Pitteloud, N., Hayes, F. J.
(2007). Acute Sex Steroid Withdrawal Reduces Insulin Sensitivity in Healthy Men with Idiopathic Hypogonadotropic Hypogonadism. J. Clin. Endocrinol. Metab.
92: 4254-4259
[Abstract][Full Text]
Khosla, S.
(2007). Estrogen and the Death of Osteoclasts: A Fascinating Story. IBMS BoneKEy
4: 267-272
[Full Text]
Atteritano, M., Marini, H., Minutoli, L., Polito, F., Bitto, A., Altavilla, D., Mazzaferro, S., D'Anna, R., Cannata, M. L., Gaudio, A., Frisina, A., Frisina, N., Corrado, F., Cancellieri, F., Lubrano, C., Bonaiuto, M., Adamo, E. B., Squadrito, F.
(2007). Effects of the Phytoestrogen Genistein on Some Predictors of Cardiovascular Risk in Osteopenic, Postmenopausal Women: A Two-Year Randomized, Double-Blind, Placebo-Controlled Study. J. Clin. Endocrinol. Metab.
92: 3068-3075
[Abstract][Full Text]
Gallagher, C. J., Langefeld, C. D., Gordon, C. J., Campbell, J. K., Mychalecky, J. C., Bryer-Ash, M., Rich, S. S., Bowden, D. W., Sale, M. M.
(2007). Association of the Estrogen Receptor-{alpha} Gene With the Metabolic Syndrome and Its Component Traits in African-American Families: The Insulin Resistance Atherosclerosis Family Study. Diabetes
56: 2135-2141
[Abstract][Full Text]
Boukari, K., Ciampi, M. L., Guiochon-Mantel, A., Young, J., Lombes, M., Meduri, G.
(2007). Human fetal testis: source of estrogen and target of estrogen action. Hum Reprod
22: 1885-1892
[Abstract][Full Text]
Williams, G. R.
(2007). Hypogonadal Bone Loss: Sex Steroids or Gonadotropins?. Endocrinology
148: 2610-2612
[Full Text]
Grundberg, E., Akesson, K., Kindmark, A., Gerdhem, P., Holmberg, A., Mellstrom, D., Ljunggren, O., Orwoll, E., Mallmin, H., Ohlsson, C., Brandstrom, H.
(2007). The Impact of Estradiol on Bone Mineral Density Is Modulated by the Specific Estrogen Receptor-{alpha} Cofactor Retinoblastoma-Interacting Zinc Finger Protein-1 Insertion/Deletion Polymorphism. J. Clin. Endocrinol. Metab.
92: 2300-2306
[Abstract][Full Text]
Syed, F. A., Fraser, D. G., Spelsberg, T. C., Rosen, C. J., Krust, A., Chambon, P., Jameson, J. L., Khosla, S.
(2007). Effects of Loss of Classical Estrogen Response Element Signaling on Bone in Male Mice. Endocrinology
148: 1902-1910
[Abstract][Full Text]
Wierman, M. E.
(2007). Sex steroid effects at target tissues: mechanisms of action. Adv. Physiol. Educ.
31: 26-33
[Abstract][Full Text]
Gallagher, C. J., Keene, K. L., Mychaleckyj, J. C., Langefeld, C. D., Hirschhorn, J. N., Henderson, B. E., Gordon, C. J., Freedman, B. I., Rich, S. S., Bowden, D. W., Sale, M. M.
(2007). Investigation of the Estrogen Receptor-{alpha} Gene With Type 2 Diabetes and/or Nephropathy in African-American and European-American Populations. Diabetes
56: 675-684
[Abstract][Full Text]
Tobias, J. H., Steer, C. D., Vilarino-Guell, C., Brown, M. A.
(2007). Estrogen Receptor {alpha} Regulates Area-Adjusted Bone Mineral Content in Late Pubertal Girls. J. Clin. Endocrinol. Metab.
92: 641-647
[Abstract][Full Text]
Pino, A. M., Rodriguez, J. M., Rios, S., Astudillo, P., Leiva, L., Seitz, G., Fernandez, M., Rodriguez, J P.
(2006). Aromatase activity of human mesenchymal stem cells is stimulated by early differentiation, vitamin D and leptin. J Endocrinol
191: 715-725
[Abstract][Full Text]
Ferrari, S.
(2006). Single Gene Mutations and Variations Affecting Bone Turnover and Strength: a Selective 2006 Update. IBMS BoneKEy
3: 11-29
[Abstract][Full Text]
Dahlman-Wright, K., Cavailles, V., Fuqua, S. A., Jordan, V. C., Katzenellenbogen, J. A., Korach, K. S., Maggi, A., Muramatsu, M., Parker, M. G., Gustafsson, J.-A.
(2006). International Union of Pharmacology. LXIV. Estrogen Receptors. Pharmacol. Rev.
58: 773-781
[Full Text]
Rochira, V., Zirilli, L., Genazzani, A. D, Balestrieri, A., Aranda, C., Fabre, B., Antunez, P., Diazzi, C., Carani, C., Maffei, L.
(2006). Hypothalamic-pituitary-gonadal axis in two men with aromatase deficiency: evidence that circulating estrogens are required at the hypothalamic level for the integrity of gonadotropin negative feedback.. Eur J Endocrinol
155: 513-522
[Abstract][Full Text]
Delbes, G., Levacher, C., Habert, R.
(2006). Estrogen effects on fetal and neonatal testicular development.. Reproduction
132: 527-538
[Abstract][Full Text]
Maghnie, M., Ambrosini, L., Cappa, M., Pozzobon, G., Ghizzoni, L., Ubertini, M. G., di Iorgi, N., Tinelli, C., Pilia, S., Chiumello, G., Lorini, R., Loche, S.
(2006). Adult Height in Patients with Permanent Growth Hormone Deficiency with and without Multiple Pituitary Hormone Deficiencies. J. Clin. Endocrinol. Metab.
91: 2900-2905
[Abstract][Full Text]
Sobel, V., Schwartz, B., Zhu, Y.-S., Cordero, J. J., Imperato-McGinley, J.
(2006). Bone Mineral Density in the Complete Androgen Insensitivity and 5{alpha}-Reductase-2 Deficiency Syndromes. J. Clin. Endocrinol. Metab.
91: 3017-3023
[Abstract][Full Text]
Aksglaede, L., Juul, A., Leffers, H., Skakkebaek, N. E., Andersson, A.-M.
(2006). The sensitivity of the child to sex steroids: possible impact of exogenous estrogens. Hum Reprod Update
12: 341-349
[Abstract][Full Text]
Le May, C., Chu, K., Hu, M., Ortega, C. S., Simpson, E. R., Korach, K. S., Tsai, M.-J., Mauvais-Jarvis, F.
(2006). Estrogens protect pancreatic beta-cells from apoptosis and prevent insulin-deficient diabetes mellitus in mice. Proc. Natl. Acad. Sci. USA
103: 9232-9237
[Abstract][Full Text]
Wright, V. J.
(2006). Osteoporosis in Men. J Am Acad Orthop Surg
14: 347-353
[Abstract][Full Text]
Anway, M. D., Skinner, M. K.
(2006). Epigenetic Transgenerational Actions of Endocrine Disruptors. Endocrinology
147: s43-s49
[Abstract][Full Text]
Pielecka, J., Moenter, S. M.
(2006). Effect of Steroid Milieu on Gonadotropin-Releasing Hormone-1 Neuron Firing Pattern and Luteinizing Hormone Levels in Male Mice. Biol. Reprod.
74: 931-937
[Abstract][Full Text]
Federman, D. D.
(2006). The Biology of Human Sex Differences. NEJM
354: 1507-1514
[Full Text]
Bilezikian, J. P.
(2006). What's Good for the Goose's Skeleton is Good for the Gander's Skeleton.. J. Clin. Endocrinol. Metab.
91: 1223-1225
[Full Text]
Guarducci, E., Nuti, F., Becherini, L., Rotondi, M., Balercia, G., Forti, G., Krausz, C.
(2006). Estrogen receptor {alpha} promoter polymorphism: stronger estrogen action is coupled with lower sperm count. Hum Reprod
21: 994-1001
[Abstract][Full Text]
Sims, N. A., Brennan, K., Spaliviero, J., Handelsman, D. J., Seibel, M. J.
(2006). Perinatal testosterone surge is required for normal adult bone size but not for normal bone remodeling. Am. J. Physiol. Endocrinol. Metab.
290: E456-E462
[Abstract][Full Text]
Rochira, V, Balestrieri, A, Madeo, B, Zirilli, L, Granata, A R M, Carani, C
(2006). Osteoporosis and male age-related hypogonadism: role of sex steroids on bone (patho)physiology. Eur J Endocrinol
154: 175-185
[Abstract][Full Text]
Enjuanes, A., Garcia-Giralt, N., Supervia, A., Nogues, X., Ruiz-Gaspa, S., Bustamante, M., Mellibovsky, L., Grinberg, D., Balcells, S., Diez-Perez, A.
(2005). Functional analysis of the I.3, I.6, pII and I.4 promoters of CYP19 (aromatase) gene in human osteoblasts and their role in vitamin D and dexamethasone stimulation. Eur J Endocrinol
153: 981-988
[Abstract][Full Text]
Hero, M., Norjavaara, E., Dunkel, L.
(2005). Inhibition of Estrogen Biosynthesis with a Potent Aromatase Inhibitor Increases Predicted Adult Height in Boys with Idiopathic Short Stature: A Randomized Controlled Trial. J. Clin. Endocrinol. Metab.
90: 6396-6402
[Abstract][Full Text]
Rosenfield, R. L., Devine, N., Hunold, J. J., Mauras, N., Moshang, T. Jr., Root, A. W.
(2005). Salutary Effects of Combining Early Very Low-Dose Systemic Estradiol with Growth Hormone Therapy in Girls with Turner Syndrome. J. Clin. Endocrinol. Metab.
90: 6424-6430
[Abstract][Full Text]
Kreher, N. C., Eugster, E. A., Shankar, R. R.
(2005). The Use of Tamoxifen to Improve Height Potential in Short Pubertal Boys. Pediatrics
116: 1513-1515
[Abstract][Full Text]
T'Sjoen, G. G., Giagulli, V. A., Delva, H., Crabbe, P., De Bacquer, D., Kaufman, J.-M.
(2005). Comparative Assessment in Young and Elderly Men of the Gonadotropin Response to Aromatase Inhibition. J. Clin. Endocrinol. Metab.
90: 5717-5722
[Abstract][Full Text]
Shearman, A. M., Cooper, J. A., Kotwinski, P. J., Humphries, S. E., Mendelsohn, M. E., Housman, D. E., Miller, G. J.
(2005). Estrogen Receptor {alpha} Gene Variation and the Risk of Stroke. Stroke
36: 2281-2282
[Abstract][Full Text]
Shearman, A. M., Demissie, S., Cupples, L. A., Peter, I., Schmid, C. H., Ordovas, J. M., Mendelsohn, M. E., Housman, D. E.
(2005). Tobacco smoking, estrogen receptor {alpha} gene variation and small low density lipoprotein level. Hum Mol Genet
14: 2405-2413
[Abstract][Full Text]
Yoshida, R., Fukami, M., Sasagawa, I., Hasegawa, T., Kamatani, N., Ogata, T.
(2005). Association of Cryptorchidism with a Specific Haplotype of the Estrogen Receptor {alpha} Gene: Implication for the Susceptibility to Estrogenic Environmental Endocrine Disruptors. J. Clin. Endocrinol. Metab.
90: 4716-4721
[Abstract][Full Text]
Mueller, A., Dittrich, R., Binder, H., Kuehnel, W., Maltaris, T., Hoffmann, I., Beckmann, M. W
(2005). High dose estrogen treatment increases bone mineral density in male-to-female transsexuals receiving gonadotropin-releasing hormone agonist in the absence of testosterone. Eur J Endocrinol
153: 107-113
[Abstract][Full Text]
Abbott, D.H., Barnett, D.K., Bruns, C.M., Dumesic, D.A.
(2005). Androgen excess fetal programming of female reproduction: a developmental aetiology for polycystic ovary syndrome?. Hum Reprod Update
11: 357-374
[Abstract][Full Text]
Eastell, R.
(2005). Role of oestrogen in the regulation of bone turnover at the menarche. J Endocrinol
185: 223-234
[Abstract][Full Text]
Kassi, E, Vlachoyiannopoulos, P G, Kominakis, A, Kiaris, H, Moutsopoulos, H M, Moutsatsou, P
(2005). Estrogen receptor alpha gene polymorphism and systemic lupus erythematosus: a possible risk?. Lupus
14: 391-398
[Abstract]
Simpson, E. R., Misso, M., Hewitt, K. N., Hill, R. A., Boon, W. C., Jones, M. E., Kovacic, A., Zhou, J., Clyne, C. D.
(2005). Estrogen--the Good, the Bad, and the Unexpected. Endocr. Rev.
26: 322-330
[Full Text]
Phillips, G. B.
(2005). Is Atherosclerotic Cardiovascular Disease an Endocrinological Disorder? The Estrogen-Androgen Paradox. J. Clin. Endocrinol. Metab.
90: 2708-2711
[Abstract][Full Text]
Napoli, N., Donepudi, S., Sheikh, S., Rini, G. B., Armamento-Villareal, R.
(2005). Increased 2-Hydroxylation of Estrogen in Women with a Family History of Osteoporosis. J. Clin. Endocrinol. Metab.
90: 2035-2041
[Abstract][Full Text]
Gennari, L., Merlotti, D., De Paola, V., Calabro, A., Becherini, L., Martini, G., Nuti, R.
(2005). Estrogen Receptor Gene Polymorphisms and the Genetics of Osteoporosis: A HuGE Review. Am J Epidemiol
161: 307-320
[Abstract][Full Text]
de Ronde, W., Hofman, A., Pols, H. A P, de Jong, F. H
(2005). A direct approach to the estimation of the origin of oestrogens and androgens in elderly men by comparison with hormone levels in postmenopausal women. Eur J Endocrinol
152: 261-268
[Abstract][Full Text]
Parikka, V., Peng, Z., Hentunen, T., Risteli, J., Elo, T., Vaananen, H K., Harkonen, P.
(2005). Estrogen responsiveness of bone formation in vitro and altered bone phenotype in aged estrogen receptor-{alpha}-deficient male and female mice. Eur J Endocrinol
152: 301-314
[Abstract][Full Text]
Veldhuis, J. D., Roemmich, J. N., Richmond, E. J., Rogol, A. D., Lovejoy, J. C., Sheffield-Moore, M., Mauras, N., Bowers, C. Y.
(2005). Endocrine Control of Body Composition in Infancy, Childhood, and Puberty. Endocr. Rev.
26: 114-146
[Abstract][Full Text]
Zhou, P., Shah, B., Prasad, K., David, R.
(2005). Letrozole Significantly Improves Growth Potential in a Pubertal Boy With Growth Hormone Deficiency. Pediatrics
115: e245-e248
[Abstract][Full Text]
Veldhuis, J. D., Iranmanesh, A.
(2005). Short-Term Aromatase-Enzyme Blockade Unmasks Impaired Feedback Adaptations in Luteinizing Hormone and Testosterone Secretion in Older Men. J. Clin. Endocrinol. Metab.
90: 211-218
[Abstract][Full Text]
Borst, S. E., Lee, J. H., Conover, C. F.
(2005). Inhibition of 5{alpha}-reductase blocks prostate effects of testosterone without blocking anabolic effects. Am. J. Physiol. Endocrinol. Metab.
288: E222-E227
[Abstract][Full Text]
Gennari, L., Nuti, R., Bilezikian, J. P.
(2004). Aromatase Activity and Bone Homeostasis in Men. J. Clin. Endocrinol. Metab.
89: 5898-5907
[Abstract][Full Text]
Bouillon, R., Bex, M., Vanderschueren, D., Boonen, S.
(2004). Estrogens Are Essential for Male Pubertal Periosteal Bone Expansion. J. Clin. Endocrinol. Metab.
89: 6025-6029
[Abstract][Full Text]
Herynk, M. H., Fuqua, S. A. W.
(2004). Estrogen Receptor Mutations in Human Disease. Endocr. Rev.
25: 869-898
[Abstract][Full Text]
Doherty, T. M., Fitzpatrick, L. A., Inoue, D., Qiao, J.-H., Fishbein, M. C., Detrano, R. C., Shah, P. K., Rajavashisth, T. B.
(2004). Molecular, Endocrine, and Genetic Mechanisms of Arterial Calcification. Endocr. Rev.
25: 629-672
[Abstract][Full Text]
Valimaki, V.-V., Alfthan, H., Ivaska, K. K., Loyttyniemi, E., Pettersson, K., Stenman, U.-H., Valimaki, M. J.
(2004). Serum Estradiol, Testosterone, and Sex Hormone-Binding Globulin as Regulators of Peak Bone Mass and Bone Turnover Rate in Young Finnish Men. J. Clin. Endocrinol. Metab.
89: 3785-3789
[Abstract][Full Text]
Oliveira, C. A, Mahecha, G. A B, Carnes, K., Prins, G. S, Saunders, P. T K, Franca, L. R, Hess, R. A
(2004). Differential hormonal regulation of estrogen receptors ER{alpha} and ER{beta} and androgen receptor expression in rat efferent ductules. Reproduction
128: 73-86
[Abstract][Full Text]
Delbes, G., Levacher, C., Pairault, C., Racine, C., Duquenne, C., Krust, A., Habert, R.
(2004). Estrogen Receptor {beta}-Mediated Inhibition of Male Germ Cell Line Development in Mice by Endogenous Estrogens during Perinatal Life. Endocrinology
145: 3395-3403
[Abstract][Full Text]
Vanderschueren, D., Vandenput, L., Boonen, S., Lindberg, M. K., Bouillon, R., Ohlsson, C.
(2004). Androgens and Bone. Endocr. Rev.
25: 389-425
[Abstract][Full Text]
Meier, C., Liu, P. Y., Ly, L. P., de Winter-Modzelewski, J., Jimenez, M., Handelsman, D. J., Seibel, M. J.
(2004). Recombinant Human Chorionic Gonadotropin But Not Dihydrotestosterone Alone Stimulates Osteoblastic Collagen Synthesis in Older Men with Partial Age-Related Androgen Deficiency. J. Clin. Endocrinol. Metab.
89: 3033-3041
[Abstract][Full Text]
Pinzone, J. J., Stevenson, H., Strobl, J. S., Berg, P. E.
(2004). Molecular and Cellular Determinants of Estrogen Receptor {alpha} Expression. Mol. Cell. Biol.
24: 4605-4612
[Full Text]
Villablanca, A., Lubahn, D., Shelby, L., Lloyd, K., Barthold, S.
(2004). Susceptibility to Early Atherosclerosis in Male Mice Is Mediated by Estrogen Receptor {alpha}. Arterioscler. Thromb. Vasc. Bio.
24: 1055-1061
[Abstract][Full Text]
Wang, C., Cunningham, G., Dobs, A., Iranmanesh, A., Matsumoto, A. M., Snyder, P. J., Weber, T., Berman, N., Hull, L., Swerdloff, R. S.
(2004). Long-Term Testosterone Gel (AndroGel) Treatment Maintains Beneficial Effects on Sexual Function and Mood, Lean and Fat Mass, and Bone Mineral Density in Hypogonadal Men. J. Clin. Endocrinol. Metab.
89: 2085-2098
[Abstract][Full Text]
Hegele-Hartung, C., Siebel, P., Peters, O., Kosemund, D., Muller, G., Hillisch, A., Walter, A., Kraetzschmar, J., Fritzemeier, K.-H.
(2004). Impact of isotype-selective estrogen receptor agonists on ovarian function. Proc. Natl. Acad. Sci. USA
101: 5129-5134
[Abstract][Full Text]
Wang, Q., Nicholson, P. H. F., Suuriniemi, M., Lyytikainen, A., Helkala, E., Alen, M., Suominen, H., Cheng, S.
(2004). Relationship of Sex Hormones to Bone Geometric Properties and Mineral Density in Early Pubertal Girls. J. Clin. Endocrinol. Metab.
89: 1698-1703
[Abstract][Full Text]
Khosla, S., Riggs, B. L., Atkinson, E. J., Oberg, A. L., Mavilia, C., Del Monte, F., Melton, L. J. III, Brandi, M. L.
(2004). Relationship of Estrogen Receptor Genotypes to Bone Mineral Density and to Rates of Bone Loss in Men. J. Clin. Endocrinol. Metab.
89: 1808-1816
[Abstract][Full Text]
Gong, G., Kosoko-Lasaki, O., Haynatzki, G. R., Wilson, M. R.
(2004). Genetic dissection of myocilin glaucoma. Hum Mol Genet
13: R91-102
[Abstract][Full Text]
Eriksson, A.-L., Skrtic, S., Niklason, A., Hulten, L. M., Wiklund, O., Hedner, T., Ohlsson, C.
(2004). Association between the low activity genotype of catechol-O-methyltransferase and myocardial infarction in a hypertensive population. Eur Heart J
25: 386-391
[Abstract][Full Text]
Carel, J.-C., Lahlou, N., Roger, M., Chaussain, J. L.
(2004). Precocious puberty and statural growth. Hum Reprod Update
10: 135-147
[Abstract][Full Text]
Amory, J. K., Watts, N. B., Easley, K. A., Sutton, P. R., Anawalt, B. D., Matsumoto, A. M., Bremner, W. J., Tenover, J. L.
(2004). Exogenous Testosterone or Testosterone with Finasteride Increases Bone Mineral Density in Older Men with Low Serum Testosterone. J. Clin. Endocrinol. Metab.
89: 503-510
[Abstract][Full Text]
Maffei, L., Murata, Y., Rochira, V., Tubert, G., Aranda, C., Vazquez, M., Clyne, C. D., Davis, S., Simpson, E. R., Carani, C.
(2004). Dysmetabolic Syndrome in a Man with a Novel Mutation of the Aromatase Gene: Effects of Testosterone, Alendronate, and Estradiol Treatment. J. Clin. Endocrinol. Metab.
89: 61-70
[Abstract][Full Text]
Schuit, S. C. E., van Meurs, J. B. J., Bergink, A. P., van der Klift, M., Fang, Y., Leusink, G., Hofman, A., van Leeuwen, J. P. T. M., Uitterlinden, A. G., Pols, H. A. P.
(2004). Height in Pre- and Postmenopausal Women Is Influenced by Estrogen Receptor {alpha} Gene Polymorphisms. J. Clin. Endocrinol. Metab.
89: 303-309
[Abstract][Full Text]
Mendelsohn, M. E., Rosano, G. M.C.
(2003). Hormonal Regulation of Normal Vascular Tone in Males. Circ. Res.
93: 1142-1145
[Full Text]
Kimura, M., Sudhir, K., Jones, M., Simpson, E., Jefferis, A.-M., Chin-Dusting, J. P.F.
(2003). Impaired Acetylcholine-Induced Release of Nitric Oxide in the Aorta of Male Aromatase-Knockout Mice: Regulation of Nitric Oxide Production by Endogenous Sex Hormones in Males. Circ. Res.
93: 1267-1271
[Abstract][Full Text]
van der Eerden, B. C. J., Karperien, M., Wit, J. M.
(2003). Systemic and Local Regulation of the Growth Plate. Endocr. Rev.
24: 782-801
[Abstract][Full Text]
Drake, W. M., Kendler, D. L., Rosen, C. J., Orwoll, E. S.
(2003). An Investigation of the Predictors of Bone Mineral Density and Response to Therapy with Alendronate in Osteoporotic Men. J. Clin. Endocrinol. Metab.
88: 5759-5765
[Abstract][Full Text]
Mauras, N., Lima, J., Patel, D., Rini, A., di Salle, E., Kwok, A., Lippe, B.
(2003). Pharmacokinetics and Dose Finding of a Potent Aromatase Inhibitor, Aromasin (Exemestane), in Young Males. J. Clin. Endocrinol. Metab.
88: 5951-5956
[Abstract][Full Text]
Lew, R., Komesaroff, P., Williams, M., Dawood, T., Sudhir, K.
(2003). Endogenous Estrogens Influence Endothelial Function in Young Men. Circ. Res.
93: 1127-1133
[Abstract][Full Text]
Seeman, E.
(2003). Invited Review: Pathogenesis of osteoporosis. J. Appl. Physiol.
95: 2142-2151
[Abstract][Full Text]
Muller, M., van der Schouw, Y. T., Thijssen, J. H. H., Grobbee, D. E.
(2003). Endogenous Sex Hormones and Cardiovascular Disease in Men. J. Clin. Endocrinol. Metab.
88: 5076-5086
[Abstract][Full Text]
Gennari, L., Merlotti, D., Martini, G., Gonnelli, S., Franci, B., Campagna, S., Lucani, B., Dal Canto, N., Valenti, R., Gennari, C., Nuti, R.
(2003). Longitudinal Association between Sex Hormone Levels, Bone Loss, and Bone Turnover in Elderly Men. J. Clin. Endocrinol. Metab.
88: 5327-5333
[Abstract][Full Text]
Thompson, C. A., Shanafelt, T. D., Loprinzi, C. L.
(2003). Andropause: Symptom Management for Prostate Cancer Patients Treated With Hormonal Ablation. The Oncologist
8: 474-487
[Abstract][Full Text]
Lance, V. A., Conley, A. J., Mapes, S., Steven, C., Place, A. R.
(2003). Does Alligator Testis Produce Estradiol? A Comparison of Ovarian and Testicular Aromatase. Biol. Reprod.
69: 1201-1207
[Abstract][Full Text]