The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
A correction has been published: N Engl J Med 1995;332(2):131.

Original Article
PreviousPrevious
Volume 331:1056-1061 October 20, 1994 Number 16
NextNext

Estrogen Resistance Caused by a Mutation in the Estrogen-Receptor Gene in a Man
Eric P. Smith, Jeff Boyd, Graeme R. Frank, Hiroyuki Takahashi, Robert M. Cohen, Bonny Specker, Timothy C. Williams, Dennis B. Lubahn, and Kenneth S. Korach

 

This Article
-Abstract

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-Related Article
-PubMed Citation
ABSTRACT

Background and Methods Mutations in the estrogen-receptor gene have been thought to be lethal. A 28-year-old man whose estrogen resistance was caused by a disruptive mutation in the estrogen-receptor gene underwent studies of pituitary-gonadal function and bone density and received transdermal estrogen for six months. Estrogen-receptor DNA, extracted from lymphocytes, was evaluated by analysis of single-strand-conformation polymorphisms and by direct sequencing.

Results The patient was tall (204 cm [80.3 in.]) and had incomplete epiphyseal closure, with a history of continued linear growth into adulthood despite otherwise normal pubertal development. He was normally masculinized and had bilateral axillary acanthosis nigricans. Serum estradiol and estrone concentrations were elevated, and serum testosterone concentrations were normal. Serum follicle-stimulating hormone and luteinizing hormone concentrations were increased. Glucose tolerance was impaired, and hyperinsulinemia was present. The bone mineral density of the lumbar spine was 0.745 g per square centimeter, 3.1 SD below the mean for age-matched normal women; there was biochemical evidence of increased bone turnover.

The patient had no detectable response to estrogen administration, despite a 10-fold increase in the serum free estradiol concentration. Conformation analysis of his estrogen-receptor gene revealed a variant banding pattern in exon 2. Direct sequencing of exon 2 revealed a cytosine-to-thymine transition at codon 157 of both alleles, resulting in a premature stop codon. The patient's parents were heterozygous carriers of this mutation, and pedigree analysis revealed consanguinity.

Conclusions Disruption of the estrogen receptor in humans need not be lethal. Estrogen is important for bone maturation and mineralization in men as well as women.


The actions of adrenal and gonadal steroids, thyroid hormone, and vitamin D are mediated by receptors encoded by a family of related genes. Mutations of glucocorticoid, androgen, thyroid hormone, and vitamin D receptors leading to syndromes of hormone resistance have been reported1,2,3,4. It has been thought that mutation of the estrogen-receptor gene would be lethal, affecting embryo implantation in particular5. Recent insertional disruption of the mouse estrogen-receptor gene6 and two case reports,7,8 however, raise questions about the validity of the lethality hypothesis and reveal intriguing phenotypes. In mice with disrupted estrogen-receptor genes, both sexes are viable. The affected female mice have hypoplastic breasts and uteri, hyperemic cystic ovaries without corpora lutea, infertility, and decreased skeletal mineralization; the male mice have decreased skeletal mineralization and low sperm counts.

The first case report7 involving decreased estrogen synthesis described a female patient with pseudohermaphroditism due to placental aromatase deficiency, suggesting that, at least beginning late in the first trimester, excess androgen with low or absent estrogen in the female fetus is compatible with life. The second case report8 described a karyotypically female patient with pseudohermaphroditism caused by a null mutation in the aromatase cytochrome P-450 gene. At puberty progressive virilization without breast development or growth acceleration was noted. Estrogen treatment resulted in normal breast development, a pubertal growth spurt, and menarche, suggesting that androgen is relatively ineffective in stimulating pubertal growth.

In this report, we describe a man with estrogen resistance who had osteoporosis, unfused epiphyses, and continuing linear growth in adulthood. He also had elevated serum estrogen concentrations, abnormal gonadotropin secretion, and no target-tissue responses to estrogen therapy. Analysis of the estrogen-receptor gene revealed a change in a single base pair in the second exon, generating a premature stop codon. These findings indicate that estrogen-receptor mutations need not be lethal and that estrogen is important in the male, as it is in the female, for normal skeletal growth and development.

Case Report

A 28-year-old white man presented to an orthopedic surgeon with tall stature and a four-to-five-year history of progressive genu valgum. Because radiologic evaluation revealed unfused epiphyses, he was referred for further evaluation. His birth weight and early growth and development were within normal limits, and his stature was in the average range. He first noted pubic and axillary hair at 12 to 13 years of age and started shaving regularly at age 17 to 18 years of age but had no recollection of associated growth acceleration. His height at the age of 16 was approximately 178 cm (70 in.) according to information provided on his driver's license (Figure 1). His legs and feet continued to grow slowly after adolescence.


View larger version (172K):
[in this window]
[in a new window]
 
Figure 1. Growth Chart of a 28-Year-Old Man with Estrogen Resistance and Radiographs of the Left Hand and Wrist and Left Knee.

Anthropometric measurements made at the age of 28 years are also shown.

 
Review of the family history revealed four sisters who were average in stature (160 to 165 cm [63 to 65 in.]). His mother was 162 cm (64 in.) tall, and his father was 180 cm (71 in.). His mother was given a diagnosis of non-insulin-dependent diabetes mellitus at the age of 45 years. A paternal uncle had colon cancer, two maternal cousins had insulin-dependent diabetes mellitus (one of whom was given the diagnosis in infancy), and a niece had XO/XY mixed gonadal dysgenesis.

The patient had a history of Osgood-Schlatter disease, which was diagnosed when he was 20 years of age and was treated with rest. At the age of 24, a meniscal tear in the right knee required arthroscopic surgery and the results of a glucose-tolerance test were reportedly slightly abnormal. There was no history of polyuria, polydipsia, blurred vision, or nocturia. The patient did not recall any change in facial structure, thickening or oiliness of the skin, excessive diaphoresis, skin tags, or changes in his voice. He did remember noticing increased pigment in the skin of each axilla starting at the age of 23. Though unmarried, he reported no history of gender-identity disorder. He indicated strong heterosexual interests and had normal functioning, including morning erections and nocturnal emissions.

Physical examination revealed a tall, healthy-appearing man with no acromegaloid features but with obvious genu valgum. His height was 204 cm (80.3 in.) (>95th percentile), weight 127 kg (280 lb), heart rate 80 per minute, and blood pressure 140/85 mm Hg. The upper segment of his body was 96 cm (37.7 in.), and his lower segment was 109 cm (42.9 in.), yielding a ratio of the upper segment to the lower segment of 0.88 (average for men, 0.96). His left middle finger measured 10 cm (3.9 in.) (97th percentile, 9 cm), left hand 23 cm (8.9 in.) (97th percentile, 19.5 cm), and foot 33 cm (13 in.) (97th percentile, 29 cm). He had an arm span of 213 cm (83.8 in.). There was bilateral axillary acanthosis nigricans and a 0.5-cm skin tag in the left axilla. The patient had a full beard with early temporal hair loss. There was no thyroid enlargement or gynecomastia. The results of cardiovascular, respiratory, and abdominal examinations were normal. The patient had normal male genitalia with bilateral descended testes, each with a volume of 20 to 25 ml, and a normal-sized prostate gland.

Radiography of his left wrist and hand revealed a bone age of 15 years9 (Figure 1). Knee films revealed open epiphyses (Figure 1); a review of radiographs from previous orthopedic evaluations demonstrated minimal evidence of epiphyseal maturation over a 10-year period and demineralized bones. The density of the lumbar spine, measured by dual-energy x-ray absorptiometry (Hologic, Waltham, Mass.), was 0.745 g per square centimeter (3.1 SD below the mean for age-matched normal women and more than 2 SD below the mean for 15-year-old boys [the patient's bone age]). The karyotype was 46,XY. Semen analysis revealed a sperm density of 25 million per milliliter (normal, >20 million per milliliter), with a viability of 18 percent (normal, >50 percent). The results of initial laboratory tests are shown in Table 1. The serum testosterone concentration was normal, and estradiol, estrone, follicle-stimulating hormone, and luteinizing hormone concentrations were high. A five-hour oral glucose-tolerance test (75 g) revealed a fasting blood glucose concentration of 135 mg per deciliter (7.6 mmol per liter), a peak response of 224 mg per deciliter (12.5 mmol per liter) at three hours, and a concentration of 163 mg per deciliter (9.1 mmol per liter) at five hours. The respective serum insulin values were 50 micro U per milliliter (300 pmol per liter), 114 micro U per milliliter (684 pmol per liter), and 93 micro U per milliliter (558 pmol per liter).

View this table:
[in this window]
[in a new window]
 
Table 1. Biochemical Measurements before and after Four and Six Months of Transdermal Ethinyl Estradiol Therapy in a Man with Estrogen Resistance.

 
On the basis of the hypothesis that primary estrogen resistance might explain the elevated serum estrogen and abnormal serum gonadotropin concentrations, failure of epiphyseal fusion, and possibly insulin resistance, the patient was treated with high-dose transdermal ethinyl estradiol (Estraderm patch system, Ciba, Summit, N.J.) for six months. The starting dose was 2 100-µg patches per week, with 100-µg increments each week until a maintenance dose of 14 100-µg patches per week was reached. The dose was based on clinical experience with men treated with high doses of estrogen for either prostate cancer or transsexual conversion10,11. This protocol was approved by the Cincinnati Children's Hospital institutional review board, and the patient gave informed consent.

The serum hormone and metabolic measurements before and after four and six months of estrogen therapy are shown in Table 1. (All serial tests in Table 1 were performed at the Nichols Institute, San Juan Capistrano, Calif., and for each assay, results were analyzed simultaneously for purposes of comparison).

During estrogen therapy, the patient had no nausea, fluid retention, hypertension, unusual headaches, weight gain, gynecomastia, impotence, or mood alterations. In addition, there was no significant increase in the serum concentration of any estrogen-dependent protein (sex hormone-binding globulin, thyroxine-binding globulin, cortisol-binding globulin, or prolactin) or change in serum gonadotropin concentrations (Table 1). The results of tests of bone turnover were all consistent with active bone demineralization and did not decrease. Finally, total bone mineral density and bone age did not change during estrogen administration.

Because of the patient's resistance to estrogen, peripheral-blood lymphocyte DNA was obtained to study his estrogen-receptor gene by analysis of single-strand-conformation polymorphisms12. Exons 1 through 813 were independently amplified by the polymerase chain reaction (PCR) and subjected to single-strand-conformation analysis with DNA from several normal subjects as a control. All exons were wild type, with the exception of exon 2, which had a variant banding pattern suggestive of a homozygous mutation (Figure 2B). Direct sequencing of the exon 2 product revealed the substitution of thymine for cytosine at codon 157 (Figure 2C), resulting in the replacement of an arginine codon (CGA) with a premature stop codon (TGA). The translated protein would therefore be severely truncated, lacking the DNA-binding and hormone-binding domains (Figure 2A), and expected to be functionally inert. Because the mutation was homozygous, the patient's parents were interviewed to obtain a more detailed family history. The family pedigree (Figure 3) demonstrates that his parents were second cousins. On the basis of slot blot analyses performed with wild-type and mutant oligonucleotide probes (Figure 4A) and direct sequence analysis (Figure 4B), each parent, as well as three of the patient's four sisters, proved to be heterozygous for the mutation, a finding consistent with autosomal recessive inheritance.


View larger version (132K):
[in this window]
[in a new window]
 
Figure 2. Mutation of the Estrogen-Receptor Gene.

Panel A shows the location of the codon 157 mutation in the estrogen-receptor protein. The mutation occurs in the A/B domain that is upstream of both the DNA-binding and hormone-binding domains and would be expected to yield a severely truncated protein with no functional activity. Panel B shows the results of single-strand-conformation analysis of exon 2 of the estrogen-receptor gene. A homozygous sequence variant is present in the patient's DNA (lane 10) but not in DNA from nine normal subjects (lanes 1 through 9). In Panel C, sequence analysis of the exon 2 PCR product revealed that the patient had thymine substituted for cytosine at codon 157 (indicated by the asterisk).

 

View larger version (21K):
[in this window]
[in a new window]
 
Figure 3. Pedigree of a Man with Estrogen Resistance Demonstrating Consanguinity (Double Lines).

Sequence analysis of the estrogen-receptor gene was performed only in the proband, his parents, and his sisters. Squares denote male family members, circles female family members, the solid square the homozygous proband, half-solid symbols family members who were heterozygous for the estrogen-receptor mutation, the cross a stillbirth, and small circles spontaneous abortions.

 

View larger version (208K):
[in this window]
[in a new window]
 
Figure 4. Parental Origin of the Mutation of the Estrogen-Receptor Gene.

Panel A shows the results of DNA slot blotting after hybridization with radiolabeled oligonucleotide probes specific for the wild-type or mutant sequence of exon 2. The filter contained PCR-amplified exon 2 from DNA of the patient (slot 1), his father (slot 2), his mother (slot 6), and two normal subjects (slots 3 and 5). For slot blot analysis of parental DNA, the exon 2 products obtained by PCR were blotted and hybridized to radiolabeled oglionucleotide probes as described.14 The oglionucleotide sequences were as follows: 5'TTCAGATAATCGACGCCAGGG3' (wild type) and 5'TTCAGATAATTGACGCCAGGG3' (mutant). In Panel B, sequence analysis of the exon 2 PCR product indicated constitutional heterozygosity for the codon 157 mutation in both parents.

 
Methods

The coding region of the estrogen-receptor gene was amplified by PCR. Primer sequences for the eight coding exons of the gene were designed on the basis of information on the exon-intron junction sequence13. The forward primer sequence for exon 2 was 5'CCCAGGCCAAATTCAGATAA3', and the reverse primer sequence was 5'CGTTTTCAACACACTATTAC3'. PCR was carried out with 35 cycles consisting of one minute at 94 °C, one minute at 55 °C, and one minute at 72 °C. The reaction mixtures were heated at 94 °C for 90 seconds before the first cycle and at 72 °C for 7 minutes after the last cycle. After amplification, a 4-microl aliquot of the product was diluted with denaturing buffer, heated at 95 °C for five minutes, and cooled on ice for five minutes; 3 to 4 microl of this solution was used for electrophoresis.

The gels used for single-strand-conformation analysis consisted of 0.5X MDE solution (AT Biochem, Malvern, Pa.) and 0.6X TBE buffer (89 mM Tris, 89 mM borate, and 2 mM EDTA), and they were run in 0.6X TBE buffer at 8 W for 16 hours at room temperature. For sequence analysis, both strands of the purified exon 2 products obtained by PCR were subjected to cycle sequencing with a double-stranded DNA Cycle Sequencing System (Life Technologies, Gaithersburg, Md.) as specified by the manufacturer, except that [{gamma}-33P]ATP was used for primer labeling. Sequencing reaction samples were run on a 6 percent polyacrylamide gel containing 8.3 M urea at 70 W for two to four hours at room temperature and processed for autoradiography according to standard procedures.

Discussion

The findings in this man with a naturally occurring disruptive mutation of the estrogen-receptor gene demonstrate that mutations in this gene need not be lethal. The major phenotypic manifestations of estrogen resistance that he demonstrated were tall stature with evidence of continued slow linear growth, markedly delayed skeletal maturation, and osteoporosis. These abnormalities provide compelling evidence of the critical part played by estrogen in bone development and mineralization during puberty not only in girls but also in boys.

The pubertal growth spurt and epiphyseal maturation are considered to be induced primarily by the actions of sex steroids, estrogen in the female and androgen in the male. The close association of sex steroids and advancement of bone age is well demonstrated in precocious puberty, which is characterized by a premature increase in sex-steroid secretion, increased height velocity, accelerated epiphyseal maturation, and reduced final adult height15. Despite the normal timing of pubertal onset and normal serum androgen concentrations, this adult with estrogen resistance had a bone age of 15 years and a slow continued increase in height during his third decade. His presentation is similar to that of a genetic female with pseudohermaphroditism caused by an aromatase-gene defect in whom androgen was present in the absence of circulating estrogen, rather than estrogen resistance8,16. Despite virilization at puberty, the patient's bone age was delayed relative to her chronologic age, and she had no growth spurt16. However, unlike the results in this man with estrogen insensitivity, her treatment with estrogen resulted in growth acceleration, advancement of bone age, and breast development. Finally, our patient's phenotype is consistent with that associated with two other conditions, testotoxicosis and androgen insensitivity. In testotoxicosis, in which there is autonomous production of androgen from the testes, therapy with an antiandrogen alone is not sufficient to slow skeletal growth to a prepubertal rate; this is achieved by the addition of an aromatase inhibitor17. Patients with complete androgen insensitivity have a pubertal growth spurt that is normal for a genetic female in both magnitude and timing18. This man's phenotype confirms what these earlier clinical observations suggested -- namely, that estrogen has a critical role in pubertal growth and epiphyseal maturation in both sexes.

Although the importance of estrogen deficiency in the pathogenesis of osteoporosis in postmenopausal women is well known, many clinical observations have supported the idea that androgen is important for the maintenance of bone mass in men. Men with hypogonadism have osteoporosis19,20; decreased serum testosterone concentrations in elderly men are a risk factor for fractures21; men with a history of constitutional delay of puberty have decreased bone density as adults22; and androgenic steroids increase bone mass23. This man with estrogen resistance had a severely undermineralized skeleton with biochemical evidence of increased bone resorption24,25 despite normal serum androgen concentrations. These observations indicate that androgen alone is not sufficient to promote skeletal maturation and retain bone mass and that estrogen has a pivotal role in the mineralization of the skeleton in males as well as females.

The elevated serum estrogen concentrations in this man suggest a compensatory increase in aromatase activity in response to estrogen resistance, and increased aromatase activity could account for the normal concentrations of androgen despite increased secretion of luteinizing hormone. In men, multiple tissues are involved in the aromatization of androgen to form estrogen, including the testes, liver, skin, and adipose tissue26,27. Testicular estrogen secretion is stimulated by luteinizing hormone, making the testis the most likely source of the elevated serum estrogen concentrations in this man. His elevated gonadotropin secretion suggests that estrogen plays a part in the regulation of gonadotropin secretion in men.

The relation of insulin resistance, glucose intolerance, and acanthosis nigricans to estrogen resistance in the patient is intriguing. Isolated increases in estrogen improve glucose tolerance by enhancing either target-tissue responsiveness to insulin or insulin secretion28,29,30. Acanthosis nigricans is a cutaneous marker of insulin resistance, especially when insulin resistance is associated with relative hyperandrogenism31. In this man, loss of estrogen effect or an altered balance of androgen and estrogen action may well account for diminished insulin sensitivity, glucose intolerance, and acanthosis nigricans. The elevated serum concentration of sex hormone-binding globulin, an estrogen-dependent protein, is unexplained.

It is possible that mutations causing milder estrogen resistance exist, and that compensatory hyperestrogenemia can overcome the resistance and result in a normal phenotype. The absence of lethality and the rather striking phenotype in either sex suggest that previous cases would eventually have been appropriately diagnosed. It is possible that heterozygous women may have impaired fertility, thus reducing the incidence of the mutation in the population and decreasing the prevalence of homozygous cases. Notably, the patient's mother had three spontaneous abortions. Regardless, this patient's diagnosis suggests that there are likely to be other patients with phenotypic presentations of variable severity. Estrogen-receptor defects should be included in the differential diagnosis of such apparently disparate entities as tall stature, unfused epiphyses, osteoporosis, abnormal gonadotropin secretion, and infertility.

Supported in part by the Children's Hospital-University of Cincinnati Clinical Research Center (under grant MO1 RR 08084) and by a clinical research grant (to Dr. Cohen) from the American Diabetes Association. Dr. Lubahn was a Pew Scholar.

We are indebted to Drs. Judson J. Van Wyk, Frank S. French, Robert M. Blizzard, Hartmut Malluche, Penelope Manasco, and Philip S. Zeitler for helpful discussions of this case; to Dr. Richard Jolson, the orthopedic surgeon who first recognized the abnormal epiphyseal maturation; to Nichols Institute for performing numerous assays before and during the estrogen therapy; to Dr. Nancy D. Leslie for lymphocyte transformation; to Ms. JoAnn Horn for technical assistance; and to Ms. Vicki Livengood for assistance in the preparation of the manuscript.


Source Information

From the Department of Pediatrics, Divisions of Endocrinology (E.P.S., G.R.F.) and Neonatology (B.S.), Children's Hospital Medical Center, University of Cincinnati College of Medicine, Cincinnati; the Department of Internal Medicine, Division of Endocrinology, University of Cincinnati College of Medicine, Cincinnati (R.M.C., T.C.W.); the Departments of Pediatrics and Pathology, University of North Carolina School of Medicine at Chapel Hill, Chapel Hill (D.B.L.); and the Gynecologic Pathobiology Group, Laboratory of Molecular Carcinogenesis (J.B., H.T.), and Receptor Biology Section, Laboratory and Developmental Toxicology (K.S.K.), National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, N.C.

Address reprint requests to Dr. Smith at the Department of Pediatrics, Division of Endocrinology, Children's Hospital Medical Center, 3333 Burnett Ave., Cincinnati, OH 45229.

References

  1. Chrousos GP, Detera-Wadleigh SD, Karl M. Syndromes of glucocorticoid resistance. Ann Intern Med 1993;119:1113-1124. [Free Full Text]
  2. McDermott MT, Ridgway EC. Thyroid hormone resistance syndromes. Am J Med 1993;94:424-432. [CrossRef][Medline]
  3. Brooks MH, Bell NH, Love L, et al. Vitamin-D-dependent rickets type II: resistance of target organs to 1,25-dihydroxyvitamin D. N Engl J Med 1978;298:996-999. [Abstract]
  4. Brown TR, Lubahn DB, Wilson EM, French FS, Migeon CJ, Corden JL. Functional characterization of naturally occurring mutant androgen receptors from subjects with complete androgen insensitivity. Mol Endocrinol 1990;4:1759-1772. [Free Full Text]
  5. George FW, Wilson JD. Sex determination and differentiation. In: Knobil E, Neill JD, eds. The physiology of reproduction. New York: Raven Press, 1988:3-26.
  6. Lubahn DB, Moyer JS, Golding TS, Couse JF, Korach KS, Smithies O. Alteration of reproductive function but not prenatal sexual development after insertional disruption of the mouse estrogen receptor gene. Proc Natl Acad Sci U S A 1993;90:11162-11166. [Free Full Text]
  7. Shozu M, Akasofu K, Harada T, Kubota Y. A new cause of female pseudohermaphroditism: placental aromatase deficiency. J Clin Endocrinol Metab 1991;72:560-566. [Free Full Text]
  8. Ito Y, Fisher CR, Conte FA, Grumbach MM, Simpson ER. Molecular basis of aromatase deficiency in an adult female with sexual infantilism and polycystic ovaries. Proc Natl Acad Sci U S A 1993;90:11673-11677. [Free Full Text]
  9. Greulich WW, Pyle SI. Radiographic atlas of skeletal development of the hand and wrist. 2nd ed. Stanford, Calif.: Stanford University Press, 1959.
  10. Carlstrom K, Collste L, Eriksson A, et al. A comparison of androgen status in patients with prostatic cancer treated with oral and/or parenteral estrogens or by orchidectomy. Prostate 1989;14:177-182. [CrossRef][Medline]
  11. Valenta LJ, Elias AN, Domurat ES. Hormone pattern in pharmacologically feminized male transsexuals in the California State prison system. J Natl Med Assoc 1992;84:241-250. [Medline]
  12. Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 1989;5:874-879. [CrossRef][Medline]
  13. Ponglikitmongkol M, Green S, Chambon P. Genomic organization of the human oestrogen receptor gene. EMBO J 1988;7:3385-3388. [Medline]
  14. Boyd J, Risinger JI. Analysis of oncogene alterations in human endometrial carcinoma: prevalence of ras mutations. Mol Carcinog 1991;4:189-195. [CrossRef][Medline]
  15. Kaplan SL, Grumbach MM. Pathophysiology and treatment of sexual precocity. J Clin Endocrinol Metab 1990;71:785-789. [Free Full Text]
  16. Conte FA, Grumbach MM, Ito Y, Fisher CR, Simpson ER. A syndrome of female pseudohermaphrodism, hypergonadotropic hypogonadism, and multicystic ovaries associated with missense mutations in the gene encoding aromatase (P450arom). J Clin Endocrinol Metab 1994;78:1287-1292. [Abstract]
  17. Laue L, Kenigsberg D, Pescovitz OH, et al. Treatment of familial male precocious puberty with spironolactone and testolactone. N Engl J Med 1989;320:496-502. [Abstract]
  18. Zachmann M, Prader A, Sobel EH, et al. Pubertal growth in patients with androgen insensitivity: indirect evidence for the importance of estrogens in pubertal growth of girls. J Pediatr 1986;108:694-697. [CrossRef][Medline]
  19. Finkelstein JS, Klibanski A, Neer RM, Greenspan SL, Rosenthal DI, Crowley WF Jr. Osteoporosis in men with idiopathic hypogonadotropic hypogonadism. Ann Intern Med 1987;106:354-361.
  20. Foresta C, Ruzza G, Mioni R, et al. Osteoporosis and decline of gonadal function in the elderly male. Horm Res 1984;19:18-22. [Medline]
  21. Swartz CM, Young MA. Male hypogonadism and bone fracture. N Engl J Med 1988;318:996-996. [Medline]
  22. Finkelstein JS, Neer RM, Biller BMK, Crawford JD, Klibanski A. Osteopenia in men with a history of delayed puberty. N Engl J Med 1992;326:600-604. [Abstract]
  23. Dequeker J, Geusens P. Anabolic steroids and osteoporosis. Acta Endocrinol Suppl (Copenh) 1985;271:45-52. [Medline]
  24. Siebel MJ, Robins SP, Bilezikian JP. Urinary pyridinium crosslinks of collagen: specific markers of bone resorption in metabolic disease. Trends Endocrinol Metab 1992;3:263-70.
  25. Hanson DA, Weis MA, Bollen AM, Maslan SL, Singer FR, Eyre DR. A specific immunoassay for monitoring human bone resorption: quantitation of type I collagen cross-linked N-telopeptides in urine. J Bone Miner Res 1992;7:1251-1258. [Medline]
  26. Bhatnagar AS, Muller P, Schenkel L, Trunet PF, Beh I, Schieweck K. Inhibition of estrogen biosynthesis and its consequences on gonadotrophin secretion in the male. J Steroid Biochem Mol Biol 1992;41:437-443. [CrossRef][Medline]
  27. MacDonald PC, Madden JD, Brenner PF, Wilson JD, Siiteri PK. Origin of estrogen in normal men and in women with testicular feminization. J Clin Endocrinol Metab 1979;49:905-916. [Free Full Text]
  28. Sharp SC, Diamond MP. Sex steroids and diabetes. Diabetes Rev 1993;1:318-42.
  29. Leiter EH, Beamer WG, Coleman DL, Longcope C. Androgenic and estrogenic metabolites in serum of mice fed dehydroepiandrosterone: relationship to antihyperglycemic effects. Metabolism 1987;36:863-869. [CrossRef][Medline]
  30. Prochazka M, Premdas FH, Leiter EH, Lipson LG. Estrone treatment dissociates primary versus secondary consequences of "diabetes" (db) gene expression in mice. Diabetes 1986;35:725-728. [Abstract]
  31. Barbieri RL, Ryan KJ. Hyperandrogenism, insulin resistance, and acanthosis nigricans syndrome: a common endocrinopathy with distinct pathophysiologic features. Am J Obstet Gynecol 1993;147:90-101. 

 

This Article
-Abstract

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-Related Article
-PubMed Citation

This article has been cited by other articles:



HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  TERMS OF USE  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved.