| |||||||||||||||||||||||
Recent studies have shown that the specific identification of bacterial pathogens does not require culture but can be accomplished by molecular analysis of the bacterial 16S ribosomal RNA (rRNA) gene isolated from infected tissue5,6,7,8. This gene includes several highly conserved domains interspersed among species-specific domains. These conserved domains can be used as sites for amplification of the intervening species-specific sequences by the primer-directed polymerase chain reaction (PCR)9,10,11.
Recently, a novel bacterial 16S rRNA gene sequence was identified in bacterial DNA extracted from biopsy specimens from patients in whom Whipple's disease had been diagnosed according to histopathological criteria7,8. This allowed specific identification of Whipple's disease and its proposed causative bacillus, Tropheryma whippelii8.
We describe two patients who presented with chronic illnesses consistent with Whipple's disease. Both patients had non-culturable erythrocyte-associated gram-positive bacilli in smears of peripheral blood. One patient was described by Archer et al. in the Journal 15 years ago as having an infection caused by an unidentified erythrocyte-associated bacterium12. In retrospect, the authors believed, as have others, that this was an unusual form of Whipple's disease1. Isolation of bacterial DNA from the peripheral blood of patients with this disease and sequence analysis of part of the 16S rRNA gene revealed the presence of T. whippelii. This report identifies the Whipple's bacillus as a red-cell-associated organism and demonstrates that Whipple's disease can be diagnosed without tissue biopsy.
Case Reports
Case 1
The case history of the patient in Case 1 was initially reported in the Journal in 197912. In 1972, arthralgias developed in a 45-year-old man from Virginia. He obtained relief with analgesics, but in 1975 he reported worsening arthralgia, malaise, fatigue, anorexia, night sweats with fever, and purpuric lesions on his feet. His symptoms persisted, and generalized lymphadenopathy developed. In 1976, he was hospitalized for investigation. His history included a splenectomy after an accident 19 years earlier.
Physical examination revealed a cachectic man with generalized lymphadenopathy and tender, purpuric lesions on his feet. The hemoglobin level was 11.0 g per deciliter, the platelet count 388,000 per cubic millimeter, and the white-cell count 12,000 per cubic millimeter. Wright's staining of a peripheral-blood film revealed small rod-shaped organisms in association with 60 to 80 percent of his red cells. The organisms stained poorly with Gram's stain, but they appeared to be gram-positive. The organisms could not be cultured and did not cause infection in five species of splenectomized animals. The results of serologic testing were nondiagnostic.
The patient was treated with intravenous vancomycin and cefazolin for 30 days, with an excellent clinical response. He had multiple relapses, but responded to similar courses of cefazolin. The third relapse was treated with 40 days of chloramphenicol, followed by 10 months of cephalexin, after which the patient had a sustained response.
Case 2
In 1971, a 27-year-old man from Ontario (the patient in Case 2) was given a diagnosis of stage IIIB Hodgkin's disease after splenectomy. He was treated with combined chemotherapy and radiotherapy and had a complete remission. In 1976, his disease recurred, and a second complete remission was achieved with salvage chemotherapy.
In 1986, arthritis developed in his hands and feet. In 1991, he had arthralgia, fever with sweats, and progressive weight loss. His symptoms worsened throughout 1992, and repeated in-hospital evaluation failed to reveal a specific cause. By May 1992, he had hepatomegaly and intermittent diarrhea. Liver and colon biopsies were nondiagnostic.
A tentative diagnosis of T-cell lymphoma was made in September 1992, based on the findings of increased large granular lymphocytes in peripheral blood, lymphoid aggregates on bone marrow biopsy, inversion of the blood T4:T8 ratio, and a clonal T-cell-receptor gamma gene rearrangement detected in blood by the PCR. Treatment with interferon alfa (3 million units daily) failed to improve his symptoms.
Finally, in November 1992, at 47 years of age, the patient presented with sepsis. Physical examination revealed jaundice and cachexia. His height was 178 cm, his weight 48 kg, and his body-mass index (the weight in kilograms divided by the square of the height in meters) 15.1. His heart rate was 135 beats per minute, blood pressure 100/60 mm Hg, temperature 40 °C, and respiratory rate 40 per minute. He had hepatomegaly and peripheral edema. Neurologic examination showed disorientation without focal deficits. The hemoglobin level was 11.3 g per deciliter, the platelet count 15,000 per cubic millimeter, and the white-cell count 7600 per cubic millimeter. The prothrombin time, activated partial-thromboplastin time, and fibrinogen level were normal, and the chest film was unremarkable.
As in Case 1, small rod-shaped organisms adherent to erythrocytes were seen on Wright's staining of peripheral blood. The organisms were gram-positive bacilli, but attempts to culture them were unsuccessful. Therapy was initiated with intravenous penicillin G (12 million units daily) and trimethoprim-sulfamethoxazole, with an excellent clinical response. Trimethoprim-sulfamethoxazole therapy was stopped on day 3. Treatment with intravenous penicillin continued for 14 days and was followed by treatment with penicillin V potassium (300 mg four times a day). After three months, therapy was changed to daily trimethoprim-sulfamethoxazole, which was continued for one year. On evaluation at one year, the patient was well and back to his normal weight.
Methods
Microscopical Studies
Peripheral-blood films were stained with Wright's and Gram's stains. Electron microscopy was performed on fixed peripheral blood stained and embedded in Spurr's medium.
Molecular Studies
In Case 1, DNA was extracted from several of the Romanovsky-stained slides of peripheral blood that had been stored at room temperature for 14 years13. In Case 2, total cellular DNA was extracted from whole blood that had been obtained at presentation and after three months of antibiotic therapy and stored at -70 °C14.
Dna (5 µg in Case 1 and 10 ng in Case 2) was mixed with the Whipple's disease-specific primers pW3FE (5'GGAATTCCAGAGATACGCCCCCCGCAA3') and pW2RB (5'ATTCGCTCCACCTTGCGA3')8 and with primers (PCO3 and PCO4) that amplify a 110-base-pair (bp) human
-globin gene sequence15. The primers were synthesized on a 392 DNA/RNA synthesizer (Applied Biosystems, Foster City, Calif.); the Whipple's disease-specific oligomers corresponded to the regions spanning nucleotides 965 through 983 (PW3FE) and 1214 through 1231 (PW2RB) of the 16S rRNA gene of T. whippelii. The final reaction volume was 100 microl, containing 250 µmol of each deoxyribonucleoside triphosphate and 2.5 mM magnesium chloride. Reaction mixtures were transferred to a Thermocycler 480 (Perkin-Elmer, Emeryville, Calif.), and the target domain was amplified by PCR for 30 cycles in standard fashion. Control samples of whole-blood DNA from a normal subject or DNA from organisms phylogenetically related to T. whippelii (i.e., Actinomyces pyogenes, Micrococcus luteus, and Mycobacterium chelonei) were amplified in similar fashion. Also included in these reaction mixtures were the primers for the
-globin gene sequence (normal human control) or a set of primers (p515FPL8 and p11p11) for conserved eubacterial 16S rRNA gene sequences (related organisms). PCR products were detected by electrophoresis on a 2.0 percent agarose gel containing ethidium bromide. The PCR-amplified products were sequenced directly using the dideoxy method with the oligonucleotides used for PCR as primers.
Results
Wright's-stained smears of peripheral blood from both patients revealed short, bluish-purple rods associated with many erythrocytes (Figure 1). These rods were rarely seen lying free and were not seen in association with leukocytes. Gram's staining identified these rods as gram-positive bacilli (not shown). In Case 2, it became difficult to find red-cell-associated organisms by the third day of penicillin treatment, and the organisms could no longer be seen after five days. In both patients, electron-microscopical examination of these rods in longitudinal section revealed a trilamellar outer membrane external to the cell wall, a feature typical of the Whipple's bacillus.
|
-globin primers generated a product in the patient in Case 2 after treatment, as did the primers for eubacterial conserved 16S rRNA sequences in phylogenetically related organisms. The nucleotide sequences of the amplified products from both patients were identical to the domain spanning nucleotides 984 through 1213 of the 16S rRNA gene from T. whippelii (GenBank accession number M87484)8.
|
We report here the cases of two patients who had previously undergone splenectomy and who presented with chronic symptoms consistent with a diagnosis of Whipple's disease. In both, examination of peripheral-blood films revealed erythrocyte-associated gram-positive bacilli. Partial sequencing of the 16S rRNA gene from these organisms demonstrated the presence of T. whippelii, the proposed causative organism of Whipple's disease. This report confirms the fact that a diagnosis of Whipple's disease can be established from peripheral blood by a molecular assay, as proposed by Relman et al.8 Furthermore, our report demonstrates the hematotropic nature of the Whipple's bacillus.
Sequence analysis of the bacterial 16S rRNA gene has proved reliable in defining members of the same genus, even in the case of bacteria that cannot be cultured5,6,7,8,16. The 16S rRNA gene sequence from the Whipple's bacillus was recently determined and found to be unique and virtually identical in all six patients studied7,8. On the basis of these reports, we used established primers specific for Whipple's disease to evaluate infection by T. whippelii. Sequence analysis of PCR products amplified from whole-blood DNA from both patients revealed that the sequence of a normally divergent domain of bacterial 16S rRNA had 100 percent homology with T. whippelii.
In neither case were conventional diagnostic tests -- that is, biopsies of infected organs -- performed. However, we believe that the patients' clinical syndromes, their responses to treatment, and the presence of gram-positive bacilli with the typical electron-microscopical finding of a trilamellar membrane external to the cell wall confirm the diagnosis of Whipple's disease.
Although Relman and coworkers provided strong evidence implicating their proposed organism as a cause of Whipple's disease, a link between T. whippelii gene sequences and the clinical and pathological features of the syndrome had not been unequivocally demonstrated17. Our study provides further evidence in support of this association. We detected erythrocyte-associated bacilli in two patients who had histories compatible with Whipple's disease. The isolation of T. whippelii DNA from blood, a site that remained culture-negative, implicates this organism as the cause of the disease in these patients.
The Whipple's disease-specific primers failed to generate a product with whole-blood DNA obtained from the patient in Case 2 after three months of therapy or with DNA obtained from phylogenetically related organisms. The inability to amplify a product in these control samples indicates that the observed red-cell-associated bacteria were the sole source of template and highlights both the specificity of this method and the effectiveness of the antibiotic treatment.
PCR-based detection of T. whippelii in peripheral-blood mononuclear cells but not in plasma has been reported in one patient in whom Whipple's disease was previously diagnosed by conventional histopathological criteria18. The amplicon (amplified product) was not sequenced, however, and the authors did not describe the patient's peripheral-blood films or the status of the patient's spleen. It is possible that DNA contamination of peripheral-blood mononuclear cells by erythrocytes and their adherent bacteria could have served as the template for amplification.
The diagnosis of Whipple's disease in these two patients establishes that the Whipple's bacillus can now be added to the short list of erythrocyte-associated bacteria. The only other bacterium known to be hematotropic to human erythrocytes is Bartonella bacilliformis,19 although a few reports of other unidentified red-cell-associated bacteria have appeared20,21,22,23.
There are a number of possible reasons why the Whipple's bacillus was evident in peripheral blood in our patients. Both had undergone splenectomy, and the absence of a spleen predisposes patients to more severe disease with other hematotropic organisms such as babesia and plasmodium24. Alternatively, it is possible that our patients' red cells possessed unique epitopes on the cell surface that allowed specific binding of the Whipple's bacillus. However, the finding of red-cell-associated organisms may not be rare in patients with Whipple's disease. A retrospective review of peripheral-blood films from the patient in Case 2 revealed that small numbers of red-cell-adherent organisms were present as early as 12 months before diagnosis. It is possible that bacteremia is present in many patients with this infection and that PCR analysis of peripheral blood may prove useful as a diagnostic assay for Whipple's disease.
We are indebted to Mr. Josello Mandawe in the Department of Hematology, Princess Margaret Hospital, for first recognizing bacteria in the peripheral-blood smear in Case 2.
Source Information
From the Departments of Medicine (R.L., G.F., M.M., J.C., H.M., H.A.) and Laboratory Medicine (B.P.), Princess Margaret Hospital and the University of Toronto, Toronto; the Department of Microbiology, Princess Margaret-Mount Sinai Hospitals and the University of Toronto, Toronto (B.M.W., A.M.); and the Department of Medicine, Division of Infectious Diseases, Medical College of Virginia, Virginia Commonwealth University, Richmond (G.L.A.).
Address reprint requests to Dr. McGeer at Princess Margaret Hospital, 500 Sherbourne St., Toronto, ON M4X 1K9, Canada.
References
| |||||||||||||||||||||||
This article has been cited by other articles:
HOME | SUBSCRIBE | SEARCH | CURRENT ISSUE | PAST ISSUES | COLLECTIONS | PRIVACY | TERMS OF USE | HELP | beta.nejm.org Comments and questions? Please contact us. The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved. |