A correction has been published: N Engl J Med 1995;332(20):1381.
| |||||||||||||||||||||||||||||||||||||
The most common cause of resistance to activated protein C is a mutation in the factor V gene that replaces the arginine in residue 506 with glutamine (an Arg-to-Gln mutation). This change in only a single amino acid causes the mutant factor Va to resist proteolysis by activated protein C. Numerous persons who are heterozygous for this molecular defect have been described,7,8,9,10,11 but few homozygous patients have been identified7. In this report, we describe a remarkable example of familial thrombosis and resistance to activated protein C in a family in which four of five children are homozygous for the Arg-to-Gln mutation in the factor V gene.
Methods
Collection of Blood Samples
Venipuncture was performed atraumatically with 19- or 21-gauge butterfly infusion sets with use of a two-syringe technique. Blood samples were drawn into plastic syringes loaded with the appropriate solutions, as described below. For all functional and immunologic assays of clotting factors, 3.8 percent (wt/vol) sodium citrate was used in a ratio of 0.1:0.9 (vol/vol) anticoagulant to blood. For the assay of the prothrombin fragment F1+2, an anticoagulant containing a thrombin inhibitor, EDTA, and aprotinin was used (Byk-Sangtec, Dietzenbach, Germany).
Plasma was obtained by centrifugation at 4 °C for 15 minutes at 1600 x g and stored at -80 °C before use. In family members with venous thrombosis, samples were obtained at least three months after the most recent thrombotic episode. Blood samples for DNA analysis were collected in an anticoagulant citrate-phosphate-dextrose solution and processed within 24 hours.
Assay for Resistance to Activated Protein C
Resistance to activated protein C was determined with assays of activated partial-thromboplastin time performed in the absence and presence of activated protein C, as described elsewhere2; the results were expressed as the ratio of the two values. Normal values for this ratio were determined by testing 40 healthy men and 40 healthy women 21 to 54 years of age who were not taking any medications. Resistance to activated protein C was diagnosed when the ratio was below 2.2 for men or below 1.9 for women.
Coagulation Measures
Protein C antigen was measured by immunoassay as described elsewhere12. Protein C activity was assayed by activation of protein C with a highly purified extract of venom from the Southern copperhead snake (Agkistrodon contortrix contortrix), followed by an amidolytic assay (Stachrom Protein C, American Bioproducts, Parsippany, N.J.) and a clotting assay (Staclot Protein C, American Bioproducts). Total and free protein S was measured by enzyme-linked immunosorbent assay (Asserachrom Protein S, American Bioproducts). Antithrombin III activity was determined by an assay for heparin-cofactor activity (Coatest, Chromogenix, Franklin, Ohio). Plasminogen activity was determined with a commercial kit (Chromostrate, Organon Teknika, Research Triangle Park, N.C.). A reference pool of normal plasma for these assays was constructed by mixing equal volumes of plasma from more than 30 healthy subjects.
Prothrombin fragment F1+2 was measured by radioimmunoassay13. Normal values for this assay were determined in 26 healthy subjects under 50 years of age and 28 subjects 50 to 69 years of age who were not taking any medications.
Sequencing of Genomic DNA
Genomic DNA was prepared from peripheral-blood leukocytes14. Primers FV7 (5'CATACTACAGTGACGTGGAC3') in exon 10 and FV8A (5'TGCTGTTCGATGTCTGCTGC3') in exon 11, based on the reported factor V messenger RNA (mRNA) sequence,15 were used to amplify a 3.1-kb genomic fragment encompassing intron 10 by the polymerase chain reaction (PCR)16. PCR products were generated in 50-microl reaction mixtures that contained 200 ng of genomic DNA; 100 pmol each of primers FV7 and FV8A; 0.5 units of Taq polymerase (Promega, Madison, Wis.); 200 micro M each of deoxyadenosine triphosphate, deoxycytidine triphosphate, deoxyguanosine triphosphate, and deoxythymidine triphosphate, in 1.5 mM magnesium chloride, 10 mM TRIS-hydrochloric acid (pH 8.3), 50 mM potassium chloride, and 0.01 mg of autoclaved gelatin per milliliter. The reactions were subjected to 30 cycles of one minute at 94 °C, two minutes at 60 °C, and three minutes at 72 °C, followed by 2 cycles of two minutes at 60 °C and three minutes at 72 °C. The amplification primers were removed from the PCR products with Wizard PCR Prep columns (Promega). Sequencing reactions incorporating 35S-labeled deoxyadenosine triphosphate (Amersham, Arlington Heights, Ill.) were performed without further purification of the template with a cycle-sequencing kit (fmol DNA Sequencing System, Promega) and the factor V primer FV23 (5'ATCGCCTCTGGGCTAATAGG3').
Factor V Complementary DNA Sequence
RNA was prepared from buffy coats of whole blood collected in anticoagulant citrate-phosphate-dextrose solution with RNA-Stat 60 (TelTest B, Friendswood, Tex.). The RNA was reverse-transcribed from oligodeoxythymidine with a complementary DNA (cDNA) kit (cDNA Cycle Kit, Invitrogen, San Diego, Calif.). The single-stranded cDNA was used as a template for PCR amplification with factor V-specific primers. The sequence coding the factor V light chain was amplified with primers FV9 (5'TGAGATCATTCCAAAGGAAG3') and FV14 (5'TTGAGGTCTTAAAGAGTCTC3') in the presence of 1.5 mmol of magnesium chloride per liter, with 30 cycles of two minutes at 56 °C, three minutes at 72 °C, and one minute at 94 °C. The amplification of the sequence coding the heavy chain was the same, except that the reaction used FV2 (5'TGCCATTCTCCAGAGCTAGG3') and FV13 (5'CAGGAAAGGAAGCATGTTCC3') in the presence of 1.0 mM magnesium chloride. The amplification primers were removed from the PCR products with Wizard PCR Prep columns to permit the determination of the complete sequence of the RNA coding for factor Va. Sequencing with various internal primers derived from the factor V coding sequence15 was performed as described above.
Results
We investigated a white family with familial thrombosis (Table 1). The oldest son (Subject II-1) was hospitalized at the age of 18 years for treatment of venographically confirmed deep-vein thrombosis of the right leg after an injury to this extremity. Two weeks later, during treatment with warfarin, he was readmitted to the hospital with a deep-vein thrombosis of the left leg. A clip was placed on the inferior vena cava, and the warfarin therapy was continued for two years. Severe bilateral postphlebitic syndrome with chronic leg ulcers subsequently developed.
|
The youngest son (Subject II-5) had a spontaneous pulmonary embolus (confirmed by pulmonary angiography) at the age of 16 years that recurred one year later after the discontinuation of warfarin treatment. At the age of 24, he had a deep-vein thrombosis of the right leg when he was not receiving warfarin; he was treated for six months. Four months after the discontinuation of treatment, he had a recurrent deep-vein thrombosis in the right leg.
Two daughters (Subjects II-2 and II-4) and the father (Subject I-1) have not had venous thrombosis. The mother of these children (Subject I-2) had a deep-vein thrombosis of the left leg (venographically confirmed) during her most recent pregnancy at the age of 37. She received oral anticoagulant therapy for three months and was subsequently free of thrombotic episodes. The parents were not known to be related. No definite history of venous thromboembolic events was obtained from other relatives.
Both parents and four of their children (Subjects II-1, II-2, II-4, and II-5) were tested for resistance to activated protein C; the remaining child (Subject II-3) could not be tested, because he was receiving long-term warfarin therapy. In the four children tested, the prolongation of the activated partial-thromboplastin time after the addition of activated protein C was markedly reduced, and the ratios of resistance to activated protein C were 1.2 or less (Table 1). In the mother and father these ratios were 1.6 and 2.0, respectively -- below the lower limit of the normal range. The levels of protein C antigen and activity in the parents and the four children ranged from 96 percent to 122 percent of the normal range, those of total and free protein S antigen from 90 percent to 136 percent, those of antithrombin III antigen and activity from 105 percent to 124 percent, and those of plasminogen activity from 83 percent to 129 percent. These results, as well as the prothrombin time, activated partial-thromboplastin time, thrombin time, and fibrinogen level, were all within the normal range.
The clinical and laboratory features of this kindred are shown in Table 1. To delineate the factor V genotype responsible for resistance to activated protein C, genomic DNA from each family member was studied. Homozygosity for the Arg-to-Gln mutation at position 506 in factor V was detected in Subjects II-1, II-2 (Figure 1), II-4, and II-5. Family member II-3 was shown to be heterozygous (Figure 1), as were both parents. In Subject II-1, sequencing of cDNA encoding the heavy- and light-chain sequences of factor V showed no other mutations and identified only known factor V polymorphisms8.
|
Discussion
In this kindred the response to activated protein C was markedly abnormal in the family members who were homozygous for the Arg-to-Gln mutation at position 506 in the factor V gene and only moderately abnormal in the heterozygous parents. (One heterozygous son [Subject II-3] was not tested.) Thus, the severity of resistance to activated protein C correlated with the homozygous and heterozygous genotypes, confirming the data of Bertina et al7.
Two homozygous sons with the Arg-to-Gln mutation and one heterozygous son had severe and recurrent thromboembolic episodes that first occurred between the ages of 16 and 23 years. By contrast, two homozygous daughters, now 33 and 28 years old, remain asymptomatic. Neither of these women has been subjected to factors known to trigger venous thrombosis, such as major surgical procedures, the use of oral contraceptives, or pregnancy, but it is likely that they are at high risk for thromboembolic events. The heterozygous mother of these children had a single episode of venous thrombosis during her most recent pregnancy, but the heterozygous father has had no venous thromboembolic events.
The elevated levels of prothrombin fragment F1+2 in members of this family indicate heightened activation of the coagulation system in vivo. Patients with other hereditary defects in the protein C anticoagulant pathway (i.e., deficiency of protein C or protein S) also have increased plasma levels of prothrombin fragment F1+217,18,19. However, we do not know whether elevations of this peptide can be used to identify patients with these genetic disorders who have an increased risk of venous thrombosis.
The homozygous members of the family we studied had a highly variable thrombotic diathesis. The reasons for the variability among homozygous as well as heterozygous patients with the Arg-to-Gln mutation are not known, but additional genetic defects may contribute to the thrombotic manifestations. Koeleman and colleagues recently found that heterozygous carriers of both the Arg-to-Gln mutation and a mutation in the protein C gene were at higher risk of thrombosis than patients with either defect alone20. A similar mechanism may apply to patients who have the Arg-to-Gln mutation in combination with mutations in antithrombin III or protein S. Because it is still not possible to identify the cause of venous thrombosis in approximately half of patients, other genetic risk factors for thrombosis undoubtedly remain to be discovered. Acquired factors that trigger thrombosis, such as pregnancy and surgery, are also likely to influence disease severity in patients with resistance to activated protein C.
Given that heterozygosity for the Arg-to-Gln mutation has a prevalence of 3 to 7 percent in the general population,3,5,6,7 we expect that the homozygous defect occurs with a frequency between 0.09 percent and 0.5 percent. It is apparent, however, that homozygosity for the mutant factor V gene is a considerably more benign thrombotic disorder than homozygous deficiencies of protein C or protein S, which frequently cause neonatal purpura fulminans21,22,23. This difference suggests that the Arg-to-Gln mutation does not render the factor Va molecule absolutely resistant to inactivation by activated protein C, or that perhaps additional mechanisms down-regulate factor Va activity in vivo24. Another consideration is that the mechanism for inactivating factor VIIIa should be intact in patients with the mutation, whereas in patients with deficiencies of protein C or protein S it is dysfunctional.
Supported in part by grants from the National Institutes of Health (HL 21544, HL 33014), the Medical Research Service of the Department of Veterans Affairs, the Stein Endowment Fund, and the Fonds zur Forderung der wissenschaftlichen Forschung (J00872-Med).
Source Information
From the Departments of Molecular and Experimental Medicine and Vascular Biology, the Scripps Research Institute, La Jolla, Calif. (J.S.G., J.H.G.); and the Department of Medicine, Brockton-West Roxbury Veterans Affairs Medical Center, and Beth Israel Hospital, Harvard Medical School, Boston (S.E., K.A.B.).
Address reprint requests to Dr. Bauer at the Veterans Affairs Medical Center, 1400 VFW Pky., West Roxbury, MA 02132.
References
| |||||||||||||||||||||||||||||||||||||
Related Letters:
Factor V Leiden and Thrombophilia
Hopmeier P., Krugluger W., Simioni P., Scudeller A., Girolami A., Kalafatis M., Mann K. G., Belliveau R. R., Bauer K. A., Griffin J. H., Hajjar K. A.
Extract |
Full Text
N Engl J Med 1995;
332:1381-1384, May 18, 1995.
Correspondence
This article has been cited by other articles:
HOME | SUBSCRIBE | SEARCH | CURRENT ISSUE | PAST ISSUES | COLLECTIONS | PRIVACY | TERMS OF USE | HELP | beta.nejm.org Comments and questions? Please contact us. The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved. |
Previous
