The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
Original Article
PreviousPrevious
Volume 331:1607-1611 December 15, 1994 Number 24
NextNext

Hepatitis C Infection in Patients with Primary Hypogammaglobulinemia after Treatment with Contaminated Immune Globulin
Kristian Bjoro, Stig S. Froland, Zhibing Yun, Helvi H. Samdal, and Terese Haaland

 

This Article
-Abstract

Commentary
-Letters

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation
ABSTRACT

Background In Scandinavia many patients with primary hypogammaglobulinemia contracted non-A, non-B hepatitis after intravenous treatment with an immune globulin product that was later found to contain a non-A, non-B hepatitis virus.

Methods We studied the prevalence and clinical course of hepatitis C virus (HCV) infection in a group of 55 Norwegian patients with primary hypogammaglobulinemia and investigated its association with the use of contaminated immune globulin. We used the polymerase chain reaction to detect HCV RNA and performed HCV genotyping. We also analyzed the responses to treatment with interferon.

Results Of 20 patients who received the contaminated immune globulin, 17 were seropositive for HCV RNA. In addition, 1 of 35 patients not exposed to the contaminated immune globulin was HCV RNA-positive. HCV genotype V was found in all 12 patients for whom genotyping was performed, but 8 patients also had genotype II or III, or both. All HCV RNA-positive patients had abnormal results on biochemical liver tests. All liver-biopsy specimens (from 15 patients) were abnormal, with portal inflammation, bile-duct damage, and focal necrosis. In six patients there was cirrhosis. Two patients died of liver failure. In 4 of the 10 patients treated with interferon there were complete, though transient, biochemical responses, but the follow-up biopsy specimens showed evidence of histologic progression. The poorest responses to interferon were among the patients with multiple HCV genotypes. All but one patient remained positive for HCV RNA.

Conclusions In patients with primary hypogammaglobulinemia there was a high rate of HCV infection after treatment with contaminated immune globulin. In these immunocompromised patients HCV infection has a severe and rapidly progressive course, and responses to interferon are poor.


Non-A, non-B hepatitis has been reported after substitution therapy with immune globulin in several patients with primary hypogammaglobulinemia1,2,3,4,5,6. In Scandinavia, one intravenous immune globulin product in particular (Gammonativ, KabiVitrum, Stockholm, Sweden) has been associated with the occurrence of non-A, non-B hepatitis5. The clinical importance of non-A, non-B hepatitis in patients with hypogammaglobulinemia is not well defined, but the impression is that the disease may progress more rapidly than it does in otherwise healthy patients5,7.

Most patients with transfusion-associated non-A, non-B hepatitis are infected with the hepatitis C virus (HCV)8. To establish a diagnosis of HCV infection in patients with primary hypogammaglobulinemia, detection of HCV RNA by the polymerase chain reaction (PCR) is mandatory, because one cannot rely on antibody tests in such patients. We report on the prevalence and clinical course of chronic HCV infection in patients with primary hypogammaglobulinemia, as well as on our experience with interferon as treatment for this infection.

Methods

Fifty-five Norwegian patients with primary hypogammaglobulinemia from whom at least one serum sample was available were included in the study. The diagnosis of primary hypogammaglobulinemia was based on established criteria9,10. The patients' diseases were classified clinically as described elsewhere11: 7 patients had X-linked agammaglobulinemia, 31 patients had common variable immunodeficiency, and 15 patients had congenital hypogammaglobulinemia. Two patients had the hyper-IgM syndrome, with very low levels of IgG and IgA. All 55 patients had severe hypogammaglobulinemia, with IgG levels below 2.0 g per liter before IgG substitution therapy. The median age of the patients was 35 years (range, 17 to 76); there were 34 male patients and 21 female patients.

We took histories of immune globulin substitution, tested for possible liver disease, and obtained the results of relevant radiologic investigations. Liver biochemical tests, including measurements of alanine aminotransferase, alkaline phosphatase, {gamma}-glutamyltransferase, bilirubin, and albumin, were performed regularly. Isoenzymes of alkaline phosphatase were analyzed in selected patients. To be classified as having chronic liver disease, a patient had to have serum alanine aminotransferase levels more than twice the upper reference limit in at least three measurements over a period of more than six months.

History of Immune Globulin Substitution Therapy

The majority of the 55 patients had received standard immune globulin intramuscularly for several years before receiving immune globulin intravenously. During the period from 1982 to 1986, 20 of the patients received the intravenous immune globulin preparation (Gammonativ) that has been shown to have been contaminated with a non-A, non-B hepatitis virus12. This product was an albumin-stabilized preparation of immune globulin derived from both U.S. and European plasma sources5 and prepared as follows: after fractionation in cold ethanol with 25 percent ethyl alcohol, the fraction II paste was dissolved and treated with diethylaminoethyl-Sephadex, stabilized with glycine, albumin, and glucose, and lyophilized. Cold-ethanol fractionation does not remove all HCV RNA from the fraction II used to prepare immune globulin13. Only plasma from patients negative for hepatitis B surface antigen was used.

After the contaminated immune globulin preparation was withdrawn from the market, most of our patients received intravenous treatment with two other immune globulins, neither of which has been associated with non-A, non-B hepatitis. For the past four to five years, most of our patients have been treated with subcutaneous infusions of standard immune globulin.

Virologic Investigation

The most recent serum sample available from each patient was assayed for HCV RNA by PCR. For patients being treated with interferon, the most recent serum sample obtained before interferon therapy was assayed. Serial serum samples were studied in selected patients in order to establish HCV RNA status longitudinally. In the case of patients exposed to the contaminated immune globulin product who were negative for HCV RNA in 1992 and 1993, previous serum samples were also assayed. In addition, all patients were examined for anti-HCV by a second-generation enzyme immunoassay (Abbott Diagnostika, Wiesbaden, Germany). Supplementary testing was performed with an assay (HCV Riba 3.0 SIA, Chiron, Emeryville, Calif.) that detects antibodies against antigens derived from putative nonstructural regions of the virus (recombinant antigens c33-c and NS5 and synthetic peptides c100-p and 5-1-1p) and against synthetic peptide c22-p, corresponding to the putative nucleocapsid viral protein. Serum samples from all patients were also examined for hepatitis B surface antigen (Ausria II-125, Abbott Laboratories Diagnostics Division, North Chicago, Ill.).

HCV RNA Detection and Genotyping

Serum samples were stored at -70 °C. RNA was extracted from 200 microl of serum with a modified acid guanidinium thiocyanate-phenol-chloroform method, as described elsewhere,14,15,16 frozen immediately, and kept at -20 °C until use.

The primers for complementary DNA (cDNA) synthesis and the nested PCR were from the conserved 5' noncoding region of the HCV genome17. The sequences are 5'CGTTAGTATGAGTGTCGTGC3' (PT1, outer sense), 5'CGGTGTACTCACCGGTTCC3' (PT2, outer antisense), 5'AGTGTCGTGCAGCCTCCAGG3' (PT3, inner sense), and 5'CGGTTCCGCAGACCACTATG3' (PT4, inner antisense). RNA was reversibly translated into cDNA at 37 °C for 60 minutes in a 20-microl reaction mixture according to a protocol described elsewhere15. Eighty-eight picomoles of the outer antisense primer was used. After inactivation of the reverse transcriptase (M-Mulv, Pharmacia, Freiburg, Germany) at 95 °C for five minutes, 50 pmol of outer sense primer was added to the cDNA and 1 unit of Amplitaq DNA polymerase (Perkin-Elmer Cetus, Norwalk, Conn.) in a volume of 80 microl containing 50 mmol of potassium chloride, 10 mmol of TRIS-hydrochloric acid (pH 8.3), and 1.5 mmol of magnesium dichloride per liter of solution. The PCR was performed in a TempCycler (Coy, Ann Arbor, Mich.). The first reaction was run with 25 cycles of 1 minute at 95 °C, 1 minute at 45 °C, and 1 minute 40 seconds at 72 °C, with a final elongation step of 5 minutes at 72 °C.

The second PCR was performed in a 100-microl reaction mixture according to the protocol described elsewhere,15 with 2 microl of the first reaction product and 50 pmol each of the inner sense and inner antisense primers. The second reaction was similar to the first, but with annealing at 55 °C instead of 45 °C. The PCR products from the second round were visualized under ultraviolet light after electrophoresis in 2.5 percent agarose gel with 0.5 µg of ethidium bromide per milliliter of solution. The size of the HCV cDNA fragment expected from the second round of PCR was 59 base pairs (bp). Procedures designed to avert contamination18 were applied strictly throughout the study.

Genotyping was performed and interpreted according to the method of Okamoto et al19. In brief, a combined reverse transcription and PCR16 was performed by adding outer antisense primer 186 (5'ATGTACCCATGAGGTCGGC3') and mixed outer sense primers 256 (5'CGCGCGACTAGGAAGACTTC3') and 256V (5'CGCGCGACGCGTAAAACTTC3'). In order to differentiate the various HCV genotypes, a nested PCR was performed with mixed inner sense primers 104 (5'AGGAAGACTTCCGAGCGGTC3') and 104V (5'CGTAAAACTTCTGAACGGTC3'), as well as five antisense type-specific primers -- i.e., 296 (5'GGATAGGCTGACGTCTACCT3'), 133 (5'GAGCCATCCTGCCCACCCCA3'), 134 (5'CCAAGAGGGACGGGAACCTC3'), 135 (5'ACCCTCGTTTCCGTACAGAG3'), and 339 (5'GCTGAGCCCAGGACCGGTCT3') -- for the amplification of HCV genotypes I (49 bp), II (144 bp), III (174 bp), IV (123 bp), and V (88 bp), respectively.

Interferon Treatment

Ten HCV RNA-positive patients with active liver disease as determined by biochemical measurements and liver biopsy were treated with recombinant interferon alfa-2b (Intron A, Schering Plough, Kenilworth, N.J.). They received an initial dose of 3 million units three times weekly for the first month. Three patients received a lower maintenance dose (1 million units three times weekly) after the first month, whereas the other seven were given the same dose (3 million units three times weekly) for the entire treatment period of 12 months. HCV RNA analysis was performed at the start of interferon therapy, after 3, 9, and 12 months of therapy, and 3 and 12 months after therapy had ended. Serum alanine aminotransferase levels were measured monthly throughout treatment and during a three-month follow-up period. Thereafter, blood tests were performed every third month.

Liver Histology

A percutaneous-liver-biopsy specimen was obtained from HCV RNA-positive patients with signs of active liver disease. In patients treated with interferon, a specimen was obtained during the six months before the start of interferon therapy and, when possible, immediately after the cessation of therapy. Serial liver biopsies were performed, and specimens evaluated, in nine patients. A total of 33 specimens of liver tissue were examined. They were interpreted blindly by one pathologist, and the morphologic features were graded semiquantitatively and given scores ranging from 0 to 3 according to the severity of the findings.

Results

HCV RNA and Anti-HCV Status

Of the 55 patients, 18 (33 percent) proved to be HCV RNA-positive by PCR. Serial blood samples obtained from 1987 through 1993 from 6 of the 18 were examined, and all the samples were HCV RNA-positive. One patient (Patient 18 in Table 1) was positive for hepatitis B surface antigen. One patient was positive for anti-HCV antibody in a single serum sample, but negative in three subsequent samples.

View this table:
[in this window]
[in a new window]
 
Table 1. Clinical Findings in 18 HCV RNA-Positive Patients with Primary Hypogammaglobulinemia.

 
HCV Genotyping

The HCV genotypes of 14 patients were studied. The samples from 2 patients could not be typed, but genotype V was detected in the samples from each of the remaining 12 patients. Six of them were infected with two strains, and two with three strains; the other strains detected were genotypes II and III (Table 2).

View this table:
[in this window]
[in a new window]
 
Table 2. HCV Genotypes of 14 Patients and Results of Treatment in Patients Receiving Interferon.

 
Exposure to Contaminated Immune Globulin and HCV RNA Status

As can be seen from Table 3, 20 patients were exposed to the contaminated immune globulin, and 17 of them (85 percent) were positive for HCV RNA. One patient (Patient 18) who was HCV RNA-positive had not been exposed to this preparation of immune globulin but had a history of intravenous drug abuse. Seventeen patients had received the contaminated immune globulin (7.5 to 17.5 g monthly) for more than 1.5 years. The other three patients received only two to five infusions of the product. Three patients exposed to the contaminated immune globulin had also received other blood products through transfusions of blood or plasma; in each case the transfusions occurred more than three years before the exposure to contaminated immune globulin.

View this table:
[in this window]
[in a new window]
 
Table 3. Prevalence of Liver Disease According to Positivity or Negativity for HCV RNA and Exposure to Contaminated Immune Globulin.

 
Three patients were negative for HCV RNA despite having received the contaminated immune globulin. Two had received the preparation regularly for three years, whereas one had received only two infusions.

Liver Disease in HCV RNA-Positive Patients

Except for Patient 2, who had cholangiographic findings compatible with sclerosing cholangitis, and Patient 18, who was coinfected with the hepatitis B and hepatitis D viruses, the HCV RNA-positive patients had normal liver findings before their exposure to the contaminated immune globulin. Liver findings became abnormal in eight patients during the period of exposure, whereas abnormal results occurred in the remaining eight two months to seven years after administration of the contaminated immune globulin had ended (Table 1). Only two patients had signs and symptoms of acute hepatitis, with nausea, asthenia, moderate jaundice, and significantly increased levels of alanine aminotransferase and bilirubin in serum.

Two patients had increased levels of alanine aminotransferase 4.5 and 7 years after the last infusion of contaminated immune globulin. One of these patients was positive for HCV RNA more than three years before biochemical signs of liver disease became apparent. As Table 1 shows, all HCV RNA-positive patients had abnormal results on liver tests, and in most of them alanine aminotransferase levels were persistently more than twice the upper limit of the reference values. Most patients had biochemical signs of cholestatic liver disease (increased serum levels of alkaline phosphatase and {gamma}-glutamyltransferase), but only 1 had cholangiographic findings indicative of bile-duct involvement (endoscopic retrograde cholangiography was performed in 7 of the 18 patients). Four patients died during the observation period, two of liver failure (Table 1).

Clinical Course of HCV Infection in Hypogammaglobulinemia Subgroups

Of five patients with common variable immunodeficiency, four had cirrhosis and severe liver disease, and the fifth died of chronic active hepatitis (Table 1). Both patients who died of end-stage liver disease had common variable immunodeficiency. Among six patients with X-linked hypogammaglobulinemia, cirrhosis and end-stage liver disease were seen only in the patient coinfected with the hepatitis B and hepatitis D viruses.

Liver-Biopsy Findings

Liver biopsies were performed in 15 of the 18 HCV RNA-positive patients. All specimens revealed pathologic features (Table 4). Portal inflammation, bile-duct damage with partial bile-duct loss, parenchymal activity with inflammation, and focal liver necrosis were frequently seen. Cirrhosis or probable cirrhosis was demonstrated in six patients (Table 1). In four patients not treated with interferon, serial liver-biopsy specimens revealed substantial progression in three patients and stable disease in one.

View this table:
[in this window]
[in a new window]
 
Table 4. Liver-Biopsy Findings in 15 Patients Positive for HCV RNA Who Had Hypogammaglobulinemia.

 
Interferon Treatment

In 1 of the 10 patients, interferon was discontinued after two months because of increasing signs and symptoms of decompensated liver cirrhosis. In two patients treatment was discontinued after three and six months because of complications probably not associated with the use of interferon. One patient who had a history of psychiatric illness committed suicide during interferon therapy.

Four patients had complete biochemical responses, with their alanine aminotransferase levels becoming normal after four to six weeks of interferon therapy. However, only one patient with a complete response had a sustained biochemical response (i.e., persistently normal alanine aminotransferase values 12 and 24 months after the cessation of treatment). In four patients alanine aminotransferase levels were reduced by more than half during the treatment period (a partial response), and in all four these levels subsequently increased, indicating that the effect of interferon was only temporary. Two patients, one of whom did not undergo genotyping, did not have a response.

Of five patients treated with interferon for whom serial biopsy specimens were available, two had histologic improvement after the treatment. Biopsy specimens obtained one to two years later have, however, demonstrated further progression in these two patients. In the other three patients histologic findings showed progression of disease during interferon therapy despite complete biochemical responses in two of them.

One patient seroconverted from positive to negative for HCV RNA after six months of interferon treatment. However, only one negative sample was obtained before the patient committed suicide. All the other patients treated with interferon remained HCV RNA-positive throughout treatment and the 12-month follow-up period.

The relation between the response to interferon therapy and the configuration of HCV genotypes is shown in Table 2. The presence of more than one strain of HCV may indicate a poor response to interferon treatment.

Discussion

We report a high prevalence of HCV infection in patients with primary hypogammaglobulinemia who received intravenous treatment with an immune globulin product that was later found to be contaminated with non-A, non-B hepatitis virus5,12. The fact that only 1 of the 35 patients not exposed to the contaminated immune globulin was positive for HCV RNA is in accordance with the low prevalence of HCV infection in Norway20.

Intravenous therapy with this HCV-contaminated immune globulin product apparently carried a very high risk of infection. The observed rate of infectivity was much higher than that reported by Bjorkander et al., who found that hepatitis developed in 16 of 77 patients after treatment with the same contaminated immune globulin5. This discrepancy may reflect the much longer observation period in our study and more precise virologic diagnosis due to the availability of HCV RNA analysis by PCR.

A striking finding was the presence of more than one genotype in the majority of the patients. Multiple exposures to different batches of immune globulin, each prepared from blood from a large number of donors, may explain this. The immunodeficiency of the patients may also have allowed infection with more than one genotype. The frequent finding of genotype V (corresponding to genotype 3 in Simmonds's classification21), which is not very common in Europe,22 may have occurred because a large plasma pool used for the production of immune globulin was infected with this particular genotype. This genotype may be more prevalent in other parts of the world that supplied plasma for the production of the contaminated immune globulin. The absence of HCV antibodies in serum samples from our HCV-infected patients is as would be expected because of their hypogammaglobulinemia. The reason why three patients exposed to the contaminated immune globulin remained negative for HCV RNA may be that they were not treated with infected batches or that they were less susceptible to HCV infection.

The long-term effect of transfusion-associated non-A, non-B hepatitis on morbidity and mortality is not fully known. In one study overall mortality was no higher in the group with transfusion-associated non-A, non-B hepatitis than in a control group23. Our study clearly indicates that HCV is a potent etiologic agent of liver disease that is often severe in patients with primary hypogammaglobulinemia. The more aggressive clinical course in patients with hypogammaglobulinemia may be related to several factors, including a reduced capacity for clearing or neutralizing virus, impaired T-cell and monocyte function,24 and the presence of multiple genotypes and coexistent liver disease25. Sclerosing cholangitis may occur in immunodeficient patients,26 but cholangiographic findings compatible with sclerosing cholangitis were seen in only one of our HCV RNA-positive patients. Liver-biopsy specimens showed cholestasis in only a few patients, even though most patients had markedly elevated levels of alkaline phosphatase and {gamma}-glutamyltransferase. Our data suggest that the clinical course of disease may be most aggressive in patients with common variable hypogammaglobulinemia, but the numbers are too small to permit statistical analysis.

There is a brief report of treatment with lymphoblastoid interferon in three cases of non-A, non-B hepatitis in patients with hypogammaglobulinemia,27 but we know of no study of interferon treatment for well-defined HCV infection in such patients. Our patients had a relatively high rate of biochemical response, as compared with otherwise healthy patients28. However, both liver-biopsy findings and HCV RNA data indicate poorer responses,29,30 which probably reflect, at least in part, the immunodeficiency in these patients. Recent reports describe differences in the response to interferon according to HCV genotype,31,32 and the presence of more than one genotype was associated with poorer responses in our study.

Immune globulins that are currently available for intravenous use are considered to have a high degree of safety with respect to HCV contamination. Most manufacturers use only anti-HCV-negative plasma donors, and virus-inactivating procedures are increasingly included in the manufacturing process.

We are indebted to Bjorg-Guri Gutigard and Bodil Lunden for their excellent technical assistance.


Source Information

From the Section of Clinical Immunology and Infectious Diseases (K.B., S.S.F.) and the Section of Hepatology and Gastroenterology (K.B.), Medical Department A, and the Department of Pathology (T.H.), National Hospital, Oslo, Norway; the Department of Virology, National Institute of Public Health, Oslo (H.H.S.); and the Institute for Clinical Virology, Karolinska Institute, Huddinge Hospital, Stockholm, Sweden (Z.Y.).

Address reprint requests to Dr. Bjoro at Medical Department A, National Hospital, 0027 Oslo, Norway.

References

  1. Lane RS. Non-A, non-B hepatitis from intravenous immunoglobulin. Lancet 1983;2:974-975. 
  2. Lever AML, Brown D, Webster ADB, Thomas HC. Non-A, non-B hepatitis occurring in agammaglobulinaemic patients after intravenous immunoglobulin. Lancet 1984;2:1062-1064. [Medline]
  3. Webster ADB, Lever AML. Non-A, non-B hepatitis after intravenous gammaglobulin. Lancet 1986;1:322-322. [CrossRef][Medline]
  4. Weiland O, Mattsson L, Glaumann H. Non-A, non-B hepatitis after intravenous gammaglobulin. Lancet 1986;1:976-977. [CrossRef]
  5. Bjorkander J, Cunningham-Rundles C, Lundin P, Olsson R, Soderstrom R, Hanson LA. Intravenous immunoglobulin prophylaxis causing liver damage in 16 of 77 patients with hypogammaglobulinemia or IgG subclass deficiency. Am J Med 1988;84:107-111. [CrossRef][Medline]
  6. Williams PE, Yap PL, Gillon J, Crawford RJ, Urbaniak SJ, Galea G. Transmission of non-A, non-B hepatitis by pH4-treated intravenous immunoglobulin. Vox Sang 1989;57:15-18. [Medline]
  7. Webster ADB, Spickett GP, Thomson BJ, Farrant J. Viruses and antibody deficiency syndromes. Immunol Invest 1988;17:93-105. [Medline]
  8. Alter HJ, Jett BW, Polito AJ. Analysis of the role of hepatitis C virus in transfusion-associated hepatitis. In: Hollinger FB, Lemon SM, Margolis HS, eds. Viral hepatitis and liver disease. Baltimore: Williams & Wilkins, 1992:396-402.
  9. Spickett GP, Misbah SA, Chapel HM. Primary antibody deficiency in adults. Lancet 1991;337:281-284. [CrossRef][Medline]
  10. Primary immunodeficiency disease: WHO scientific group report. Immunodefic Rev 1989;1:173-205. [Medline]
  11. Aukrust P, Froland SS, Muller F. Raised serum neopterin levels in patients with primary hypogammaglobulinaemia: correlation to other immunological parameters and to clinical and histological features. Clin Exp Immunol 1992;89:211-216. [Medline]
  12. Iwarson S, Wejstal R, Ruttimann E. Non-A, non-B hepatitis associated with the administration of intravenous immunoglobulin -- transmission studies in chimpanzees. Serodiagn Immunother 1987;1:261-6.
  13. Yei S, Yu MW, Tankersley DL. Partitioning of hepatitis C virus during Cohn-Oncley fractionation of plasma. Transfusion 1992;32:824-828. [Medline]
  14. Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156-159. [Medline]
  15. Garson JA, Ring CJA, Tuke PW. Improvement of HCV genome detection with "short" PCR products. Lancet 1991;338:1466-1467. [Medline]
  16. Yun ZB, Lindh G, Weiland O, Johansson B, Sonnerborg A. Detection of hepatitis C virus (HCV) RNA by PCR related to HCV antibodies in serum and liver histology in Swedish blood donors. J Med Virol 1993;39:57-61. [Medline]
  17. Skaug K, Li H, Jonassen TO, Larsen J, Figenschau KJ. Hepatitis C virus (HCV) RNA among anti-HCV-positive blood donors and their recipients. Vox Sang 1993;64:215-219. [Medline]
  18. Kwok S, Higuchi R. Avoiding false positives with PCR. Nature 1989;339:237-238. [Erratum, Nature 1989;339:490.] [CrossRef][Medline]
  19. Okamoto H, Tokita H, Sakamoto M, et al. Characterization of the genomic sequence of type V (or 3a) hepatitis C virus isolates and PCR primers for specific detection. J Gen Virol 1993;74:2385-2390. [Free Full Text]
  20. Nordoy I, Schrumpf E, Elgjo K, et al. Liver disease in anti-hepatitis C virus-positive Norwegian blood donors. Scand J Gastroenterol 1994;29:77-81. [Medline]
  21. Simmonds P, Holmes EC, Cha T-A, et al. Classification of hepatitis C virus into six major genotypes and a series of subtypes by phylogenetic analysis of the NS-5 region. J Gen Virol 1993;74:2391-2399. [Free Full Text]
  22. Dusheiko G, Schmilovitz-Weiss H, Brown D, et al. Hepatitis C virus genotypes: an investigation of type-specific differences in geographic origin and disease. Hepatology 1994;19:13-18. [CrossRef][Medline]
  23. Seeff LB, Buskell-Bales Z, Wright EC, et al. Long-term mortality after transfusion-associated non-A, non-B hepatitis. N Engl J Med 1992;327:1906-1911. [Abstract]
  24. Reinherz EL, Rubinstein A, Geha RS, Strelkauskas AJ, Rosen FS, Schlossman SF. Abnormalities of immunoregulatory T cells in disorders of immune function. N Engl J Med 1979;301:1018-1022. [Abstract]
  25. Cunningham-Rundles C. Clinical and immunologic analyses of 103 patients with common variable immunodeficiency. J Clin Immunol 1989;9:22-33. [CrossRef][Medline]
  26. Forbes A, Blanshard C, Gazzard B. Natural history of AIDS related sclerosing cholangitis: a study of 20 cases. Gut 1993;34:116-121. [Free Full Text]
  27. Thomson BJ, Doran M, Lever AML, Webster ADB. Alpha-interferon therapy for non-A, non-B hepatitis transmitted by gammaglobulin replacement therapy. Lancet 1987;1:539-541. [Medline]
  28. Tine F, Magrin S, Craxi A, Pagliaro L. Interferon for non-A, non-B chronic hepatitis: a meta-analysis of randomised clinical trials. J Hepatol 1991;13:192-199. [CrossRef][Medline]
  29. Hagiwara H, Hayashi N, Mita E, et al. Detection of hepatitis C virus RNA in serum of patients with chronic hepatitis C treated with interferon-{alpha}. Hepatology 1992;15:37-41. [Medline]
  30. Shindo M, Di Bisceglie AM, Cheung L, et al. Decrease in serum hepatitis C viral RNA during alpha-interferon therapy for chronic hepatitis C. Ann Intern Med 1991;115:700-704.
  31. Chemello L, Alberti A, Rose K, Simmonds P. Hepatitis C serotype and response to interferon therapy. N Engl J Med 1994;330:143-143. [Free Full Text]
  32. Gerolami V, Halfon P, Bourliere M, et al. Hepatitis C virus genotypes in chronic hepatitis and response to interferon-{alpha} therapy. J Infect Dis 1993;168:1328-1329. [Medline]

 

This Article
-Abstract

Commentary
-Letters

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation

Related Letters:

Hepatitis C and Immune Globulin
Douglas S. D., Slade H. B., López-Jiménez J., Odriozola J., Pérez-Oteyza J., García-Laraña J., Prince A. M., Horowitz B., Bjøro K., Frøland S. S., Schiff R. I.
Extract | Full Text  
N Engl J Med 1995; 332:1235-1237, May 4, 1995. Correspondence

This article has been cited by other articles:



HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2008 Massachusetts Medical Society. All rights reserved.