Background The lesions of Langerhans'-cell histiocytosis (histiocytosisX), a proliferative histiocytic disorder of unknown cause, containhistiocytes similar in phenotype to dendritic Langerhans' cells.The disease ranges in severity from a fatal leukemia-like disorderto an isolated lytic lesion of bone. Intermediate forms of thedisease are usually characterized by multiorgan involvement,diabetes insipidus, and a chronic course.
Methods To determine whether Langerhans' histiocytosis is apolyclonal reactive disease or a clonal disorder, we used X-linkedpolymorphic DNA probes (HUMARA, PGK, M27[DXS255], and HPRT)to assess clonality in lesional tissues and control leukocytesfrom 10 female patients with various forms of the disease. Lymphoidclonality was also assessed by analysis of rearrangements atimmunoglobulin and T-cell-receptor gene loci.
Results The HUMARA assay detected clonal cells in the lesionsof 9 of the 10 patients: 3 patients had acute disseminated disease,3 had unifocal disease, and 3 had intermediate forms. The percentageof clonal cells closely approximated the percentage of CD1a-positivehistiocytes in each lesion. Clonality was also confirmed intwo of nine cases with the PGK or M27 probe. Extreme constitutionallyonization precluded assessment of clonality in the 10th case.Lymphoid clonality was ruled out in all cases.
Conclusions The detection of clonal histiocytes in all formsof Langerhans'-cell histiocytosis indicates that this diseaseis probably a clonal neoplastic disorder with highly variablebiologic behavior. Thus, genetic mutations that promote clonalexpansion of Langerhans' cells or their precursors may now beidentified.
Langerhans'-cell histiocytosis (LCH) encompasses several disorderspreviously known as histiocytosis X, Letterer-Siwe disease,Hand-Schuller-Christian syndrome, eosinophilic granuloma ofbone, and self-healing reticulohistiocytosis1,2. The clinicalvarieties of LCH range from a lethal leukemia-like disorderthat primarily affects infants to a curable solitary lytic lesionof bone. Intermediate forms characterized by lesions of bone,skin, and mucous membranes, various degrees of organ dysfunction,and diabetes insipidus have an indolent course. In contrastto the clinical heterogeneity of LCH, the pathologic featuresof all forms of the disease are more uniform. The lesions consistof histiocytes that resemble in morphology and phenotype thedendritic antigen-presenting Langerhans' cells of the skin andother organs1,3,4,5,6. Like their normal counterparts, pathologicLangerhans' cells are positive for HLA-DR, CD1a, S100, and theFc receptor; some contain Langerhans' cell (Birbeck) granules1.Although LCH was described a century ago,7 its cause and pathogenesisare still unknown. The prevailing opinion is that LCH is a reactivedisorder rather than a neoplastic process8. However, this assumptionhas never been definitively tested.
An important distinguishing feature of a neoplasm is its originfrom a single clone of cells9. A reactive process, by contrast,is polyclonal. Clonality can be assessed in any cell lineagein the majority of female subjects by molecular analysis ofpatterns of X-chromosome inactivation (reviewed by Vogelsteinet al.10,11 and Busque and Gilliland12). In female subjects,each somatic cell randomly inactivates one X chromosome earlyin embryogenesis and transmits its pattern of inactivation (lyonization)to all progeny cells. Methods of assessing the clonality ofcells from a female subject follow the principle of lyonization.DNA probes that can detect polymorphisms at a particular X-linkedlocus allow a distinction to be made between the maternal Xchromosome and the paternal X chromosome. The active X chromosomemay be distinguished from the inactive X chromosome by its stateof methylation or by gene expression. Ideally, half the cellsin a polyclonal tissue will have inactivated the paternallyderived X chromosome, and half the maternally derived X chromosome.A monoclonal, or "clonal," population of cells, by contrast,exclusively inactivates one X chromosome.
Three X-linked polymorphic loci have been used to analyze clonality:the loci for phosphoglycerate kinase (PGK)10,11 and hypoxanthinephosphoribosyltransferase (HPRT)10,11 and the hypervariablelocus DXS255 (M27)13,14,15,16,17. However, a low frequency ofpolymorphisms limits the usefulness of HPRT and PGK becauseof the low incidence of polymorphisms at these loci in the twoX chromosomes,11,12 whereas variable methylation may restrictthe utility of M2715,16. These shortcomings have been overcomewith the X-linked human androgen-receptor (HUMARA) gene; analysisof clonality at this locus produces superior results becauseof its high rate of heterozygosity (informativeness) (>90percent) and consistent patterns of methylation12,18,19. Anaspect of lyonization that complicates the analysis is thatnonrandom patterns of X-chromosome inactivation may occur inup to 25 percent of female subjects (skewed lyonization). Thus,their normal tissues may mimic the molecular pattern of a clonalpopulation of cells12,20. It is therefore essential to comparepatterns of X-chromosome inactivation in pathologic tissueswith the patterns in normal cells derived from a similar embryologiclineage in each subject.
To determine whether LCH is a clonal or a polyclonal disorder,we used HUMARA, HPRT, PGK, and M27 probes to evaluate clonalityin lesional cells and peripheral leukocytes from 10 female patientswith various forms of LCH.
Methods
Case Histories
Female patients with LCH were chosen for our study on the basisof the availability of appropriate fresh or frozen lesionaltissues obtained for diagnosis and control samples of peripheralblood. Informed consent was obtained in all cases. The presenceof CD1a-positive histiocytes and Langerhans'-cell granules confirmedthe diagnosis of LCH in each case21. When frozen tissues wereavailable (for all 10 patients except Patients 4 and 5), thepercentage of CD1a-positive cells relative to the total numberof nucleated cells in the lesion was determined by counting500 cells in each of two fields in an immunoperoxidase-stainedfrozen section taken from the same tissue used for molecularanalysis4,5. The lesions studied had been obtained before treatmentin all patients except one (Patient 6), from whom tissue wasobtained after radiation to a site remote from the sample.
Three patients presented with "acute disseminated LCH"22 involvingthe skin, liver, spleen, and lymph nodes (Patients 1, 2, and3). Lymph-node biopsies provided diagnostic material and tissuefor molecular studies. All three patients received intensivemultiagent chemotherapy; Patient 1 died 10 months after diagnosis,and Patients 2 and 3 have survived 9 and 40 months after diagnosis,respectively.
Four patients presented with the intermediate form of LCH, withmultiple bone lesions and various degrees of organ dysfunction(Patients 4, 5, 6, and 7). Diagnostic biopsies of osseous lesionsprovided tissue for molecular studies. A lymph-node biopsy wasperformed in Patient 7 during the course of disease after cranialirradiation and multiagent chemotherapy, and this specimen wasalso analyzed for clonality. Patient 4 died two years afterdiagnosis despite multiagent chemotherapy and local irradiationof affected mastoid processes. Patient 5 has remained free ofany evidence of disease after therapy with vinblastine and prednisone.Patients 6 and 7 have active disease; Patient 7 has diabetesinsipidus associated with a progressive hypothalamic tumor.
Three patients presented with LCH confined to a single bonylesion (Patients 8, 9, and 10). Specimens obtained during diagnosticbiopsy of this tissue were used for clonality studies. Thesethree patients were treated with curettage and are disease-free16, 13, and 12 months after diagnosis, respectively.
Assessment of Lymphoid Clonality
To detect clonal lymphoid cells, rearrangements of genes encodingthe variable region of immunoglobulin heavy chain and the beta,gamma, and delta chains of the T-cell-antigen receptor wereidentified in DNA from the patients' lesions according to establishedmethods with a sensitivity of 2 percent23.
Molecular Assessment of Clonality with HPRT, PGK, and M27 Probes
Lesional DNA was analyzed for clonality at the HPRT,10,11 PGK,10,11and DXS255(M27)13,14,17 loci with established Southern blottingtechniques (reviewed by Busque and Gilliland12). Alleles werequantitated by laser densitometric scanning of autoradiographs;allelic ratios for M27 and PGK were calculated as previouslydescribed17,20. Clonality at the PGK locus was also assessedwith a polymerase-chain-reaction (PCR) assay24.
Molecular Assessment of Clonality at the HUMARA Locus
Clonality at the HUMARA locus was assessed by PCR amplificationaccording to a modification of the technique of Allen et al.18(Figure 1). A total of 10 ng to 1 µg of DNA was digestedovernight at 37 °C in a 20-microl reaction mixture containingRsaI (20 units) or RsaI with 40 units of HpaII. The restrictionenzymes were then inactivated by heating at 95 °C for 10minutes. For the PCR, 2 microl of the digested DNA was combinedwith 23 microl of PCR reaction mixture, for a final concentrationof 50 mmol of potassium chloride per liter, 10 mmol of TRIS(pH 8.3) per liter, 1.5 mmol of magnesium chloride per liter,0.01 percent gelatin, 200 µmol of each deoxynucleotidetriphosphate per liter, 5 pmol of each primer, 0.5 pmol of primer1 labeled with [P32]-ATP kinase, 0.05 unit of Taq polymerase,and 5 percent dimethylsulfoxide. The sequences of the primersused for amplification in the HUMARA assay were 5'GCTGTGAAGGTTGCTGTTCCTCAT3'(primer 1) and 5'TCCAGAATCTGTTCCAGAGCGTGC3' (primer 2). Initialdenaturation was performed for 3 minutes at 94 °C, followedby 28 cycles of 45 seconds at 94 °C, 30 seconds at 60 °C,and 30 seconds at 72 °C. After amplification, 12.5 microlof sequencing-denaturing loading buffer was added to each tube;the samples were heated at 94 °C for five minutes and thenquenched with ice. The samples were loaded on denaturing-sequencinggels composed of 4 percent 19:1 acrylamide:bisacrylamide in30 percent formamide, 4 M urea, and TRIS borate EDTA buffer.The gels were run at 80 W for 4 hours, dried, and left on PhosphorImagerscreens (Molecular Dynamics) for 24 hours. Allele intensitywas quantitated with ImageQuant 3.15 software.
The top portion of the figure shows the HUMARA (human androgen-receptor gene) locus (purple). The methylation-sensitive restriction-enzyme sites (HpaII and HhaI) are located 100 base pairs 5' of the polymorphic CAG repeat [(CAG)n] in the first exon of the HUMARA gene18. Oligonucleotide primers (primers 1 and 2) flanking the methylation sites and this repeat amplify the polymorphic CAG repeat expansion in exon 1 of the HUMARA locus in the PCR. Variations in the length of the CAG repeat on the paternal and the maternal X chromosomes will yield HUMARA alleles of different lengths, thereby allowing the two X chromosomes to be distinguished. Methylation of the HpaII and HhaI sites further distinguishes the active (nonmethylated) from the inactive (methylated) X chromosome. Shown below the locus are the expected results of the HUMARA assay in the case of a polyclonal population of cells with a random pattern of X-chromosome inactivation (left) or a monoclonal population of cells with a nonrandom pattern of X-chromosome inactivation (right).
In this example, the maternal X chromosome (red) has a longer CAG repeat and will yield a longer HUMARA allele than will the paternal X chromosome (blue); methylated (inactive) chromosomes are shown as solid rectangles. Digestion with the methylation-sensitive enzyme HpaII or HhaI cleaves the restriction sites on the active (nonmethylated) chromosomes. The PCR does not then amplify these active alleles, because Taq DNA polymerase cannot extend beyond the cleaved DNA strand, thereby disrupting PCR amplification. In a polyclonal population (left), random X-chromosome inactivation results in methylation of both the maternal and paternal X chromosomes in different cells. Therefore, the PCR will amplify only the methylated (inactive) paternal and maternal X chromosomes in this polyclonal population. These alleles may then be resolved with gel electrophoresis since they are of different lengths. In contrast, in a monoclonal population with nonrandom X-chromosome inactivation (right), only one HUMARA allele is methylated in the clonal cells (in this example, the longer, maternal allele), and thus the PCR amplifies only one HUMARA allele. In the gel electrophoresis (bottom) shown here, the HUMARA alleles are represented as single bands, for simplicity; amplification of each allele actually yields a major band and a minor shadow band (see the Methods section and Figure 2). In the analysis of a mixed population of polyclonal and clonal cells, the relative intensity of each allele will be proportional to the percentage of clonal cells present in the polyclonal population. (Adapted from Allen et al.18 with the permission of the publisher.).
For each sample, a corrected ratio was calculated by dividingthe ratio of the predigested sample (allele 1/allele 2) obtainedafter digesting DNA with RsaI and HpaII, by the ratio of thenon-predigested sample (allele 1/allele 2) obtained after digestingDNA with RsaI alone. The use of this ratio corrected for thepreferential amplification of one allele that might occur ifthe alleles differed markedly in the length of their repeats,or if the allele on the active X chromosome was more readilyamplified. A final clonality ratio for each patient was determinedby dividing the corrected ratio of the lesional DNA by thatof the control DNA, thereby normalizing values for unequal lyonization.The percentage of clonal cells was estimated by comparing thefinal ratio with a standard curve of allelic ratios plottedagainst percentages of clonal cells. Experiments mixing polyclonaland clonal cells have demonstrated that the percentage of clonalcells can be estimated with an error of ±10 percent,and that a clonal population of cells can be detected if theyconstitute more than 10 to 15 percent of cells in a polyclonalbackground (unpublished data). All assays were performed intriplicate, with the assayer blinded to the percentage of lesionalhistiocytes.
Results
Patterns of X-chromosome inactivation in lesional tissue werecompared with those in control leukocytes in peripheral bloodfrom the 10 female patients with LCH. The HUMARA locus was informativein all 10 patients (Table 1). By contrast, the HPRT locus wasuninformative in all patients tested (Patients 1 through 8;data not shown), and the PGK locus was informative in only one(Patient 8). Similarly, clonality could be reliably assessedwith M27 in only one patient (Patient 1); variable methylation,inability to resolve overlapping alleles, or inadequacy of theamounts of DNA for Southern blotting led to uninterpretableresults in the other patients. Lesional DNA from all patientslacked clonal rearrangements of the immunoglobulin heavy chainor T-cell-receptor beta-, gamma-, and delta-chain genes, precludingthe presence of a lymphoid clone in each patient (data not shown).
Table 1. Molecular Analysis of Clonality in Patients with LCH.
Acute Disseminated LCH
Clonal cells were detected in affected lymph nodes with theHUMARA assay (Figure 1) in all three patients with the acutedisseminated form of LCH. In Patient 1, the ratio of the twoHUMARA alleles (one from the maternal and one from the paternalX chromosome) in the control DNA was 1.09, a value close tothe ideal ratio of 1.0 for a completely random pattern of X-chromosomeinactivation (Table 1 and Figure 2A). In contrast, when theHUMARA locus in DNA from this patient's lymph node was amplifiedby PCR, there was preferential amplification of the larger HUMARAallele, which contains a longer triplet-repeat expansion (Figure 2B).The HUMARA-allele ratio in the lymph node, which was effacedby histiocytes, was 5.12, a value reflecting nonrandom X-chromosomeinactivation and consistent with a predominantly clonal population.The final corrected clonality ratio, 4.7, was converted to apercentage of clonal cells, 65 percent (error, ±10 percent)(Table 1; see the Methods section). This value was similar tothe percentage of CD1a-positive histiocytes in the lesion (70percent) (Table 1). The close agreement between the molecularand histochemical results, along with the absence of a clonallymphoid population, is strong evidence that the clonal cellsin this lesion were the CD1a-positive histiocytes.
Figure 2. Assessment of Clonality in Patient 1 by the HUMARA PCR Assay.
Panel A shows the results of amplification of DNA from normal (control) lymphocytes. HUMARA alleles were amplified by PCR in the absence of HpaII (lanes 1 and 2) or in its presence (lanes 3 and 4). The detection of two alleles (lanes 1 and 2) indicates that this patient's DNA is informative at the HUMARA locus (shadow bands, which result from slippage of DNA polymerase during PCR amplification, are also evident). Alleles amplified in the absence or presence of HpaII were quantitated with PhosphorImager analysis (scans at right; the left-hand peak in each scan represents the amount of radioactivity in the upper HUMARA allele, and the right-hand peak represents the radioactivity in the lower allele). Both HUMARA alleles were amplified to an essentially equal degree in the control DNA, a result consistent with random X-chromosome inactivation.
Panel B shows the results of amplification of lesional DNA in the absence of HpaII (lane 1) or in its presence (lanes 2 and 3). The scan revealed a striking predominance of the upper HUMARA allele, a finding consistent with nonrandom X-inactivation and the presence of a predominant population of clonal cells.
Clonality was also confirmed with the M27 probe in Patient 1(Table 1 and Figure 3). Although both M27 alleles in the controlDNA were digested with methylation-sensitive restriction enzymes,indicating random X-chromosome inactivation (Figure 3A, lane3), the two alleles were not digested equally, as in previousstudies15,16. However, comparison of the digestion patternsin control DNA with those in lesional DNA did reveal very differentpatterns of X-chromosome inactivation. In lesional DNA, theupper M27 allele was substantially digested, whereas the lowerallele was undigested (Figure 3B, lane 3). This pattern is consistentwith preferential inactivation (methylation) of the lower alleleand the presence of a clonal population of cells. The M27-alleleratio was 1.9:1 in control DNA and greater than 10:1 in lesionalDNA (Table 1).
Figure 3. Analysis of Clonality at the M27 Locus in Patient 1.
Polymorphisms at the X-linked M27 locus arise because of variation in the length of a tandem repeat13; PstI restriction-enzyme sites flank this repeat and a nearby methylation-sensitive HpaII site. To assess heterozygosity, DNA is first digested with PstI or with MspI (a methylation-insensitive enzyme that has the same restriction-enzyme recognition sequence as HpaII), followed by Southern blot hybridization with the M27 probe; patterns of X-chromosome inactivation are then assessed by digestion with PstI and HpaII, followed by Southern blot hybridization (see the Methods section). In a monoclonal or clonal cell population, only one of the M27 alleles is methylated at this site, and hence only one of the alleles will be digested with HpaII. In a polyclonal population, both M27 alleles exist in inactive and active states because of nonrandom X-chromosome inactivation, and hence both bands will be partially digested.
Panel A shows the results of Southern blotting with control DNA. DNA was digested with PstI and MspI (lane 1), PstI alone (lane 2), and PstI and HpaII (lane 3), followed by Southern blotting analysis. As shown in lane 3, the M27 alleles were easily resolved, and both were digested (although unequally) with HpaII. The result of densitometric quantitation of the alleles in lane 3 is shown at right (reading the scan from right to left [arrow] corresponds to reading lane 3 of the autoradiograph from top to bottom). These data are consistent with random X-chromosome inactivation.
Panel B shows the results of Southern blotting with lesional DNA. DNA was digested and M27 alleles quantitated as in Panel A. In the corresponding scan, the upper M27 allele was almost completely digested, but the lower allele was virtually undigested -- a result consistent with the presence of a clonal population of cells.
Clonality was also demonstrated in Patients 2 and 3, with theHUMARA assay (Table 1 and Figure 4). Although control DNA fromPatient 2 had a nonrandom pattern of X-chromosome inactivation(corrected ratio for HUMARA alleles, 1.57), DNA from this patient'slymph node showed a markedly skewed pattern (corrected ratio,4.9), indicating that a clonal population constituted 50 ±10percent of the lymph-node cells. These data were consistentwith the virtual effacement of this patient's lymph node byCD1a-positive histiocytes (Figure 5A). In contrast to the specimensfrom Patients 1 and 2, the lymph node from Patient 3 showedonly focal sinusoidal involvement by CD1apositive histiocytes(Figure 5B). Nonetheless, a clonal population of cells constituting25 ±10 percent of total cells could be detected withthe HUMARA assay.
Figure 4. Assessment of Clonality in Patient 2 by the HUMARA PCR Assay.
Panel A shows the results of amplification of control DNA. HUMARA alleles were amplified by PCR in the absence of HpaII (lanes 1 and 2) and in its presence (lanes 3 and 4). Although it is not visible in the autoradiograph, some skewing of the HUMARA alleles in the normal tissue of this patient (corrected ratio, 1.57) (Table 1) was evident on PhosphorImager quantitation of the two alleles (shown to the right of the autoradiograph) amplified in the absence or presence of HpaII.
In Panel B, PCR amplification of lesional DNA and PhosphorImager quantitation of the two HUMARA alleles in the absence (lanes 1 and 2) or presence (lanes 3 and 4) of HpaII revealed a striking predominance of the upper allele -- a result consistent with a clonal population of cells.
Figure 5. Immunoperoxidase Staining of CD1a-Positive Langerhans' Histiocytes in Lymph Nodes from Patient 2 (Panel A, x200) and Patient 3 (Panel B, x200).
A lymph-node-biopsy specimen from Patient 2 stained with a CD1a antibody showed an immunoperoxidase reaction as described2,3. The node was effaced by CD1a-positive histiocytes. The node from Patient 3 contained only a focal sinusoidal infiltrate of CD1a-positive cells. In contrast to these lymph nodes affected by LCH, normal lymph nodes contain only rare, scattered CD1a-positive cells in the paracortex4,5.
Intermediate Forms of LCH
Specimens from Patients 4, 5, 6, and 7 were cytologically heterogeneousand contained relatively small numbers of CD1a-positive histiocytesadmixed with eosinophils and other cells. However, in threeof these four patients clonal cells could be detected in lesionaltissues with the HUMARA assay (Table 1). With frozen tissues,the percentage of clonal cells determined with the HUMARA assaywas close to the percentage of CD1a-positive histiocytes (Table 1).Control samples from Patients 4 and 5 had nonrandom patternsof X-chromosome inactivation, but the lesional tissues clearlycontained clonal cell populations. In Patient 7, clonal cellswere detected in a bone-biopsy specimen obtained before treatmentand in an affected lymph node obtained three years after thebiopsy. Both clonal populations had inactivated the same X chromosome,implying that the same clone persisted during the course ofthis patient's illness.
Clonality could not be determined definitively in Patient 6,a known carrier of X-linked spinobulbar muscular atrophy, becauseof extreme constitutional lyonization. This disease resultsfrom expansion of the polymorphic cysteine-alanine-glycine (CAG)repeat in the first exon of the HUMARA locus itself25. However,although control DNA displayed marked skewing (corrected ratio,3.23), lesional DNA was skewed in the opposite direction (correctedratio, 2.7), suggesting the presence of a clonal cell population.
Unifocal LCH
The HUMARA assay also detected clonal cells in bone-biopsy specimensfrom the three patients with solitary bone lesions (Table 1,Patients 8, 9, and 10). Despite skewed lyonization in normalDNA from Patient 8, the HUMARA assay revealed skewing in favorof the opposite HUMARA allele in lesional DNA (as in Patient6). Clonality was also found in this patient with the PGK assay(Table 1). In each of the three patients, there was a closeagreement between the percentage of clonal cells determinedwith the HUMARA assay and the percentage of CD1a-positive histiocytesin the lesion.
Discussion
Langerhans'-cell histiocytosis, an enigmatic disorder, has beenvariously classified as a neoplastic process, a reactive disorder,or an aberrant immune response1. A wide spectrum of diseaseand variable clinical behavior are characteristic. Althoughhistopathological examination cannot predict clinical outcome,recent studies have shown that Langerhans' cells within thelesions of LCH are intrinsically proliferative26. In our studyof 10 female patients with various forms of LCH whose ages rangedfrom 3 months to 25 years, molecular analysis revealed evidenceof clonal cells in all 9 patients in whom results could be interpretedwith confidence. The HUMARA PCR-based assay proved to be a powerfulmethod of assessing clonality. In contrast to other X-linkedpolymorphic loci, the HUMARA locus had a high rate of informativeness,which allowed clonality to be determined in all patients. Quantitationof HUMARA alleles with PhosphorImager analysis gave the assayremarkable sensitivity, an essential feature in studies of cytologicallyheterogeneous lesions, such as those in LCH. The excellent agreementbetween the percentage of clonal cells detected with the HUMARAassay and the percentage of CD1a-positive histiocytes in eachlesion, together with the absence of clonal lymphoid cells,strongly supports the conclusion that the clonal cells in LCHare the CD1a-positive Langerhans' cells. Our results thus showthat LCH is a clonal histiocytic disease rather than a reactivepolyclonal disorder.
It is notable that all three forms of LCH had a clonal pattern.The detection of clonal histiocytes in children with the acutedisseminated form of disease was not unforeseen; this "leukemia-like"form of LCH behaves like a neoplastic process, with mortalityrates approaching 60 to 65 percent among infants8,22,27,28.However, the presence of clonal histiocytes in intermediateforms of LCH was surprising. In this type of LCH the survivalrate is 60 to 70 percent among children two years old or youngerand 80 percent among children more than two years old8,27,28;spontaneous regression has rarely been reported8,29. The findingof clonal histiocytes in unifocal LCH was also unexpected, sincethis form of disease is the most clinically benign.
Although the possibility that LCH has a viral pathogenesis isof considerable interest, McClain et al.,30 using molecularmethods to detect the genomes of Epstein-Barr virus, human herpesvirustype 6, and seven other viruses, found no trace of viral DNAin 50 cases of LCH. Leahy et al.31 have implicated human herpesvirustype 6, but their study requires confirmation. Recent ultrastructuralstudies also found no evidence of virus32. However, the remotepossibility remains that LCH could result from a virally inducedclonal proliferation of dendritic Langerhans' cells.
More compelling is the possibility that LCH is a clonal neoplasticdisorder that arises from somatic mutations that cause the clonalexpansion of Langerhans' cells or their precursors in bone marrowand organs. The extreme rarity of familial cases makes it unlikelythat a predisposing mutation could be inherited in LCH as inother childhood neoplasms. Since our studies revealed that clonalhistiocytes occur in all forms of LCH, clonality alone willnot suffice to predict biologic behavior and clinical course.Indeed, clonal cells have been detected in several disordersthat may not be overtly "malignant."33,34,35,36 However, ifeach form of LCH were to have distinct mutations, then molecularassessment at the time of diagnosis might allow one to predictthe clinical course and to direct appropriate therapy.
Supported by the Histiocytosis Association of America, the DedicatedHealth Research Fund of the State of New Mexico, the All Children'sHospital Foundation Histiocytosis Research Fund, and the NationalCancer Institute of Canada.
We are indebted to the Toughill and Kontoyannis families, theHistiocytosis Association of America, and the Nikolas Symposiafor the creation of research forums and funding for the histiocytoses;to our collaborators for submitting case materials and clinicalhistories -- Vickey Gresik, M.D. (Department of Pathology, TexasChildren's Hospital, Baylor School of Medicine, Houston), PeterIsaacson, M.D. (Department of Histopathology, University College,London Medical School, London), Ron Jaffe, M.D. (Departmentof Pathology, Children's Hospital of Pittsburgh, Pittsburgh),James Navin, M.D. (Department of Laboratories, Kapiolani MedicalCenter for Women and Children, Honolulu), and Charles Palmer,M.D. (Presbyterian Hospital, Albuquerque, N.M.); and to LorettaKanapilly-Chavez and Brian Schnell, M.D., for technical assistance.
Source Information
From the Departments of Pathology and Pediatrics, the Center for Molecular and Cellular Diagnostics, and the Cancer Center, University of New Mexico School of Medicine, Albuquerque (C.L.W., B.B.G., M.H.D.); the Division of Hematology-Oncology, Brigham and Women's Hospital, Harvard Medical School, Boston (L.B., D.G.G.); the Department of Pathology and Laboratory Medicine, All Children's Hospital, St. Petersburg, Fla. (B.E.F.); and the Department of Pediatrics, Texas Children's Hospital, Baylor College of Medicine, Houston (K.L.M.)
Address reprint requests to Dr. Willman at the University of New Mexico Cancer Center, 900 Camino de Salud, N.E., Albuquerque, NM 87131.
References
Favara BE. Langerhans' cell histiocytosis: pathobiology and pathogenesis. Semin Oncol 1991;18:3-7.
Favara BE. Histiocytosis syndromes: classification, diagnostic features and current concepts. Leuk Lymphoma 1990;2:141-150.
Nezelof C, Basset F, Rousseau MF. Histiocytosis X: histogenetic arguments for a Langerhans cell origin. Biomedicine 1973;18:365-371. [Medline]
van der Valk P, van der Loo EM, Jansen J, Daha MR, Meijer CJLM. Analysis of lymphoid and dendritic cells in human lymph node, tonsil and spleen: a study using monoclonal and heterologous antibodies. Virchows Arch [B] Cell Pathol 1984;45:169-85.
Weiss LM, Beckstead JH, Warnke RA, Wood GS. Leu-6-expressing cells in lymph nodes: dendritic cells phenotypically similar to interdigitating cells. Hum Pathol 1986;17:179-184. [Medline]
Caux C, Dezutter-Dambuyant C, Schmitt D, Banchereau J. GM-CSF and TNF- cooperate in the generation of dendritic Langerhans cells. Nature 1992;360:258-261. [CrossRef][Medline]
Hand A Jr. Polyuria and tuberculosis. Arch Pediatr 1893;10:673-675.
Komp DM. Langerhans cell histiocytosis. N Engl J Med 1987;316:747-748. [Medline]
Knudson AG Jr. Hereditary cancer, oncogenes, and antioncogenes. Cancer Res 1985;45:1437-1443. [Free Full Text]
Vogelstein B, Fearon ER, Hamilton SR, Feinberg AP. Use of restriction fragment length polymorphisms to determine the clonal origin of human tumors. Science 1985;227:642-645. [Free Full Text]
Vogelstein B, Fearon ER, Hamilton SR, et al. Clonal analysis using recombinant DNA probes from the X-chromosome. Cancer Res 1987;47:4806-4813. [Free Full Text]
Busque L, Gilliland DG. Clonal evolution in acute myeloid leukemia. Blood 1993;82:337-342. [Free Full Text]
Abrahamson G, Fraser NJ, Boyd Y, Craig I, Wainscoat JS. A highly informative X-chromosome probe, M27, can be used for the determination of tumour clonality. Br J Haematol 1990;74:371-372. [Medline]
Boyd Y, Fraser NJ. Methylation patterns at the hypervariable X-chromosome locus DXS255 (M27): correlation with X-inactivation status. Genomics 1990;7:182-187. [CrossRef][Medline]
Hodges E, Howell WM, Boyd Y, Smith JL. Variable X-chromosome DNA methylation patterns detected with probe M27 in a series of lymphoid and myeloid malignancies. Br J Haematol 1991;77:315-322. [Medline]
Cachia PG, Culligan DJ, Thomas ED, Whittaker J, Jacobs A, Padua RA. Methylation of the DXS255 hypervariable locus 5' CCGG site may be affected by factors other than X-chromosome activation status. Genomics 1992;14:70-74. [CrossRef][Medline]
Fey MF, Peter H-J, Hinds HL, et al. Clonal analysis of human tumors with M27, a highly informative polymorphic X chromosomal probe. J Clin Invest 1992;89:1438-1444.
Allen RC, Zoghbi HY, Moseley AB, Rosenblatt HM, Belmont JW. Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-receptor gene correlates with X chromosome inactivation. Am J Hum Genet 1992;51:1229-1239. [Medline]
Busque L, Zhu J, DeHart D, et al. An expression based clonality assay at the human androgen receptor locus (HUMARA) on chromosome X. Nucleic Acids Res 1994;22:697-698. [Free Full Text]
Gale RE, Wheadon H, Linch DC. X-chromosome inactivation patterns using HPRT and PGK polymorphisms in haematologically normal and post-chemotherapy females. Br J Haematol 1991;79:193-197. [Medline]
Writing Group of the Histiocyte Society. Histiocytosis syndromes in children. Lancet 1987;1:208-209. [CrossRef][Medline]
Nezelof C, Frileux-Herbet F, Cronier-Sachot J. Disseminated histiocytosis X: analysis of prognostic factors based on a retrospective study of 50 cases. Cancer 1979;44:1824-1838. [CrossRef][Medline]
Willman CL, Griffith BB, Whittaker M. Molecular genetic approaches for the diagnosis of clonality in lymphoid neoplasms. Clin Lab Med 1990;10:119-149. [Medline]
Gilliland DG, Blanchard KL, Levy J, Perrin S, Bunn HF. Clonality in myeloproliferative disorders: analysis by means of the polymerase chain reaction. Proc Natl Acad Sci U S A 1991;88:6848-6852. [Free Full Text]
La Spada AR, Wilson EM, Lubahn DB, Harding AE, Fischbeck KH. Androgen receptor gene mutations in X-linked spinal and bulbar muscular atrophy. Nature 1991;352:77-79. [CrossRef][Medline]
Lahey ME. Prognosis in reticuloendotheliosis in children. J Pediatr 1962;60:664-671.
Greenberger JS, Crocker AC, Vawter G, Jaffe N, Cassady JR. Results of treatment of 127 patients with systemic histiocytosis (Letterer-Siwe syndrome, Schuller-Christian syndrome and multifocal eosinophilic granuloma). Medicine 1981;60:311-38.
Broadbent V, Pritchard J, Davies EG, et al. Spontaneous remission of multi-system histiocytosis X. Lancet 1984;1:253-254. [Medline]
McClain K, Jin H, Gresik V, Favara B. Langerhans cell histiocytosis -- lack of viral etiology. Am J Hematol (in press).
Leahy MA, Krejci SM, Friednash M, et al. Human herpesvirus 6 is present in lesions of Langerhans cell histiocytosis. J Invest Dermatol 1993;101:642-645. [CrossRef][Medline]
Mierau GW, Wills EJ, Steele PO. Ultrastructural studies in Langerhans cell histiocytosis: a search for evidence of viral etiology. Pediatr Pathol (in press).
Weiss LM, Hu E, Wood GS, et al. Clonal rearrangements of T-cell receptor genes in mycosis fungoides and dermatopathic lymphadenopathy. N Engl J Med 1985;313:539-544. [Abstract]
Weiss LM, Wood GS, Trela M, Warnke RA, Sklar J. Clonal T-cell populations in lymphomatoid papulosis: evidence of a lymphoproliferative origin for a clinically benign disease. N Engl J Med 1986;315:475-479. [Abstract]
Kurahashi H, Hara J, Yumura-Yagi K, et al. Monoclonal nature of transient abnormal myelopoiesis in Down's syndrome. Blood 1991;77:1161-1163. [Free Full Text]
Starzl TE, Nalesnik MA, Porter KA, et al. Reversibility of lymphomas and lymphoproliferative lesions developing under cyclosporin-steroid therapy. Lancet 1984;1:583-587. [Medline]
Steiner, Q.-G., Otten, L. A., Hicks, M. J., Kaya, G., Grosjean, F., Saeuberli, E., Lavanchy, C., Beermann, F., McClain, K. L., Acha-Orbea, H.
(2008). In vivo transformation of mouse conventional CD8{alpha}+ dendritic cells leads to progressive multisystem histiocytosis. Blood
111: 2073-2082
[Abstract][Full Text]
(2008). Radiology Quiz Case 1: Diagnosis. Arch Otolaryngol Head Neck Surg
134: 212-212
[Full Text]
Dewan, M., Al-Ghamdi, A. A., Zahrani, M. B.
(2008). Lessons to be learned Langerhans' cell histiocytosis. The Journal of the Royal Society for the Promotion of Health
128: 41-46
[Abstract]
Alexandraki, K.I., Makras, P., Protogerou, A.D., Dimitriou, K., Stathopoulou, A., Papadogias, D.S., Voidonikola, P., Piaditis, G., Pittas, A., Papamichael, C.M., Grossman, A.B., Kaltsas, G.
(2008). Cardiovascular risk factors in adult patients with multisystem Langerhans-cell histiocytosis: evidence of glucose metabolism abnormalities. QJM
101: 31-40
[Abstract][Full Text]
Link, D. C., Wun, T.
(2007). Myeloid disorders. ASH-SAP
2007: 143-171
[Full Text]
Leatherwood, D. L., Heitkamp, D. E., Emerson, R. E.
(2007). Best Cases from the AFIP: Pulmonary Langerhans Cell Histiocytosis. RadioGraphics
27: 265-268
[Full Text]
Levine, R. L., Belisle, C., Wadleigh, M., Zahrieh, D., Lee, S., Chagnon, P., Gilliland, D. G., Busque, L.
(2006). X-inactivation-based clonality analysis and quantitative JAK2V617F assessment reveal a strong association between clonality and JAK2V617F in PV but not ET/MMM, and identifies a subset of JAK2V617F-negative ET and MMM patients with clonal hematopoiesis. Blood
107: 4139-4141
[Abstract][Full Text]
Rolland, A., Guyon, L., Gill, M., Cai, Y.-H., Banchereau, J., McClain, K., Palucka, A. K.
(2005). Increased Blood Myeloid Dendritic Cells and Dendritic Cell-Poietins in Langerhans Cell Histiocytosis. J. Immunol.
174: 3067-3071
[Abstract][Full Text]
Anlauf, M., Schafer, M. K.-H., Depboylu, C., Hartschuh, W., Eiden, L. E., Kloppel, G., Weihe, E.
(2004). The Vesicular Monoamine Transporter 2 (VMAT2) Is Expressed by Normal and Tumor Cutaneous Mast Cells and Langerhans Cells of the Skin but Is Absent from Langerhans Cell Histiocytosis. J. Histochem. Cytochem.
52: 779-788
[Abstract][Full Text]
Escardo-Paton, J A, Neal, J, Lane, C M
(2004). Late recurrence of Langerhans cell histiocytosis in the orbit. Br. J. Ophthalmol.
88: 838-839
[Full Text]
Abbott, G. F., Rosado-de-Christenson, M. L., Franks, T. J., Frazier, A. A., Galvin, J. R.
(2004). From the Archives of the AFIP: Pulmonary Langerhans Cell Histiocytosis. RadioGraphics
24: 821-841
[Abstract][Full Text]
Loh, S.-Y., Tan, K.-B., Wong, Y.-S., Lee, Y.-S.
(2004). Rosai-Dorfman Disease of the Triquetrum Without Lymphadenopathy. A Case Report. JBJS
86: 595-598
[Full Text]
McClain, K. L., Natkunam, Y., Swerdlow, S. H.
(2004). Atypical Cellular Disorders. ASH Education Book
2004: 283-296
[Abstract][Full Text]
Jovanovic, L., Delahunt, B., McIver, B., Eberhardt, N. L., Grebe, S. K. G.
(2003). Thyroid Gland Clonality Revisited: The Embryonal Patch Size of the Normal Human Thyroid Gland Is Very Large, Suggesting X-Chromosome Inactivation Tumor Clonality Studies of Thyroid Tumors Have to Be Interpreted with Caution. J. Clin. Endocrinol. Metab.
88: 3284-3291
[Abstract][Full Text]
Annels, N. E., da Costa, C. E.T., Prins, F. A., Willemze, A., Hogendoorn, P. C.W., Egeler, R. M.
(2003). Aberrant Chemokine Receptor Expression and Chemokine Production by Langerhans Cells Underlies the Pathogenesis of Langerhans Cell Histiocytosis. J. Exp. Med.
197: 1385-1390
[Abstract][Full Text]
Sundar, K. M., Gosselin, M. V., Chung, H. L., Cahill, B. C.
(2003). Pulmonary Langerhans Cell Histiocytosis: Emerging Concepts in Pathobiology, Radiology, and Clinical Evolution of Disease. Chest
123: 1673-1683
[Abstract][Full Text]
Usmani, G. N., Westra, S. J., Younes, S.
(2003). Case 13-2003 - A 14-Month-Old Boy with Hepatomegaly, Perianal Lesions, and a Bony Lump on the Forehead. NEJM
348: 1692-1701
[Full Text]
Petersen, O. W., Nielsen, H. L., Gudjonsson, T., Villadsen, R., Rank, F., Niebuhr, E., Bissell, M. J., Ronnov-Jessen, L.
(2003). Epithelial to Mesenchymal Transition in Human Breast Cancer Can Provide a Nonmalignant Stroma. Am. J. Pathol.
162: 391-402
[Abstract][Full Text]
Scott, R. M., Hedley-Whyte, E. T.
(2002). Case 35-2002 - A Nine-Year-Old Girl with Cold Intolerance, Visual-Field Defects, and a Suprasellar Tumor. NEJM
347: 1604-1611
[Full Text]
van Dijk, J. P., Heuver, L. H., van der Reijden, B. A., Raymakers, R. A., de Witte, T., Jansen, J. H.
(2002). A Novel, Essential Control for Clonality Analysis with Human Androgen Receptor Gene Polymerase Chain Reaction. Am. J. Pathol.
161: 807-812
[Abstract][Full Text]
Darvishian, F., Hirawat, S., Teichberg, S., Wolk, D., Allen, S. L., Hajdu, S. I.
(2002). Langerhans' Cell Histiocytosis in the Parotid Gland. Annals of Clinical & Laboratory Science
32: 201-206
[Abstract][Full Text]
Arceci, R. J., Longley, B. J., Emanuel, P. D.
(2002). Atypical Cellular Disorders. ASH Education Book
2002: 297-314
[Abstract][Full Text]
Nezelof, C., Bassett, F.
(2001). From Histiocytosis X to Langerhans Cell Histiocytosis: A Personal Account. INT J SURG PATHOL
9: 137-146
Geissmann, F., Lepelletier, Y., Fraitag, S., Valladeau, J., Bodemer, C., Debre, M., Leborgne, M., Saeland, S., Brousse, N.
(2001). Differentiation of Langerhans cells in Langerhans cell histiocytosis. Blood
97: 1241-1248
[Abstract][Full Text]
Siegal, G., Luntz, M., Duchmann, H., Fradis, M., Attias, D., Fridman, Z., Misselevitch, I.
(2001). Quiz Case 1. Arch Otolaryngol Head Neck Surg
127: 78-80
[Full Text]
Vassallo, R., Ryu, J. H., Colby, T. V., Hartman, T., Limper, A. H.
(2000). Pulmonary Langerhans'-Cell Histiocytosis. NEJM
342: 1969-1978
[Full Text]
Kaltsas, G. A., Powles, T. B., Evanson, J., Plowman, P. N., Drinkwater, J. E., Jenkins, P. J., Monson, J. P., Besser, G. M., Grossman, A. B.
(2000). Hypothalamo-Pituitary Abnormalities in Adult Patients with Langerhans Cell Histiocytosis: Clinical, Endocrinological, and Radiological Features and Response to Treatment. J. Clin. Endocrinol. Metab.
85: 1370-1376
[Abstract][Full Text]
Egeler, R. M., Favara, B. E., van Meurs, M., Laman, J. D., Claassen, E.
(1999). Differential In Situ Cytokine Profiles of Langerhans-Like Cells and T Cells in Langerhans Cell Histiocytosis: Abundant Expression of Cytokines Relevant to Disease and Treatment. Blood
94: 4195-4201
[Abstract][Full Text]
Tazi, A., Moreau, J., Bergeron, A., Dominique, S., Hance, A. J., Soler, P.
(1999). Evidence That Langerhans Cells in Adult Pulmonary Langerhans Cell Histiocytosis Are Mature Dendritic Cells: Importance of the Cytokine Microenvironment. J. Immunol.
163: 3511-3515
[Abstract][Full Text]
Schaller, J. G., Niles, J. L., Lerner, L. H.
(1999). Case 20-1999- A 16-Year-Old Girl with Fever, Rash, and Severe Ocular Disease. NEJM
341: 110-116
[Full Text]
Saven, A., Burian, C.
(1999). Cladribine Activity in Adult Langerhans-Cell Histiocytosis. Blood
93: 4125-4130
[Abstract][Full Text]
Ristevski, S., Purcell, D. F. J., Marshall, J., Campagna, D., Nouri, S., Fenton, S. P., McPhee, D. A., Kannourakis, G.
(1999). Novel Endogenous Type D Retroviral Particles Expressed at High Levels in a SCID Mouse Thymic Lymphoma. J. Virol.
73: 4662-4669
[Abstract][Full Text]
TUDER, R. M., RADISAVLJEVIC, Z., SHROYER, K. R., POLAK, J. M., VOELKEL, N. F.
(1998). Monoclonal Endothelial Cells in Appetite Suppressant-associated Pulmonary Hypertension. Am. J. Respir. Crit. Care Med.
158: 1999-2001
[Abstract][Full Text]
Bauer, P. W., MacDonald, C. B., Domanowski, G. F., Fuleihan, N. S.
(1998). Pathologic Quiz Case 2. Arch Otolaryngol Head Neck Surg
124: 1395-1395
[Full Text]
Mach-Pascual, S., Legare, R. D., Lu, D., Kroon, M., Neuberg, D., Tantravahi, R., Stone, R. M., Freedman, A. S., Nadler, L. M., Gribben, J. G., Gilliland, D. G.
(1998). Predictive Value of Clonality Assays in Patients With Non-Hodgkin's Lymphoma Undergoing Autologous Bone Marrow Transplant: A Single Institution Study. Blood
91: 4496-4503
[Abstract][Full Text]
Howell, S J, Wilton, P, Shalet, S M
(1998). Growth hormone replacement in patients with Langerhan's cell histiocytosis. Arch. Dis. Child.
78: 469-473
[Abstract][Full Text]
YASKO, A. W., FANNING, C. V., AYALA, A. G., CARRASCO, C. H., MURRAY, J. A.
(1998). Percutaneous Techniques for the Diagnosis and Treatment of Localized Langerhans-Cell Histiocytosis (Eosinophilic Granuloma of Bone). JBJS
80: 219-28
[Abstract][Full Text]
Jennings, C. D., Foon, K. A.
(1997). Recent Advances in Flow Cytometry: Application to the Diagnosis of Hematologic Malignancy. Blood
90: 2863-2892
[Full Text]
Gill, P., Tsai, Y., Rao, A. P., Jones, P., Diaz-Cano, S. J., Wolfe, H. J., Rabkin, C. S., Janz, S., Zhuang, Z.
(1997). Clonality in Kaposi's Sarcoma. NEJM
337: 570-572
[Full Text]
Rabkin, C. S., Janz, S., Lash, A., Coleman, A. E., Musaba, E., Liotta, L., Biggar, R. J., Zhuang, Z.
(1997). Monoclonal Origin of Multicentric Kaposi's Sarcoma Lesions. NEJM
336: 988-993
[Abstract][Full Text]
Lerner, L. H., Bailey, E. M.
(1996). Case 18-1996- A newborn boy with multiple hemorrhagic vesicles, lymphadenopathy, and respiratory distress. NEJM
334: 1591-1597
[Full Text]
Egeler, R M.
(1995). Clonality in Langerhans' cell histiocytosis. BMJ
310: 804a-805
[Full Text]
Cotter, F. E, Pritchard, J.
(1995). Clonality in Langerhans' cell histiocytosis. BMJ
310: 74-75
[Full Text]
(1994). Langerhans'-Cell Histiocytosis is a Clonal Proliferation. Journal Watch Dermatology
1994: 5-5
[Full Text]
Sutherland, G. R., Richards, R. I.
(1994). DNA Repeats -- A Treasury of Human Variation. NEJM
331: 191-193
[Full Text]
[DXS255], and HPRT) to assess clonality in lesional tissues and control leukocytes from 10 female patients with various forms of the disease. Lymphoid clonality was also assessed by analysis of rearrangements at immunoglobulin and T-cell-receptor gene loci. 
[P32]-ATP kinase, 0.05 unit of Taq polymerase, and 5 percent dimethylsulfoxide. The sequences of the primers used for amplification in the HUMARA assay were 5'GCTGTGAAGGTTGCTGTTCCTCAT3' (primer 1) and 5'TCCAGAATCTGTTCCAGAGCGTGC3' (primer 2). Initial denaturation was performed for 3 minutes at 94 °C, followed by 28 cycles of 45 seconds at 94 °C, 30 seconds at 60 °C, and 30 seconds at 72 °C. After amplification, 12.5 microl of sequencing-denaturing loading buffer was added to each tube; the samples were heated at 94 °C for five minutes and then quenched with ice. The samples were loaded on denaturing-sequencing gels composed of 4 percent 19:1 acrylamide:bisacrylamide in 30 percent formamide, 4 M urea, and TRIS borate EDTA buffer. The gels were run at 80 W for 4 hours, dried, and left on PhosphorImager screens (Molecular Dynamics) for 24 hours. Allele intensity was quantitated with ImageQuant 3.15 software. 
cooperate in the generation of dendritic Langerhans cells. Nature 1992;360:258-261. [CrossRef][Medline]
Previous
