The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
Original Article
PreviousPrevious
Volume 331:154-160 July 21, 1994 Number 3
NextNext

Langerhans'-Cell Histiocytosis (Histiocytosis X) -- A Clonal Proliferative Disease
Cheryl L. Willman, Lambert Busque, Barbara B. Griffith, Blaise E. Favara, Kenneth L. McClain, Marilyn H. Duncan, and D. Gary Gilliland

 

This Article
-Abstract

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation
ABSTRACT

Background The lesions of Langerhans'-cell histiocytosis (histiocytosis X), a proliferative histiocytic disorder of unknown cause, contain histiocytes similar in phenotype to dendritic Langerhans' cells. The disease ranges in severity from a fatal leukemia-like disorder to an isolated lytic lesion of bone. Intermediate forms of the disease are usually characterized by multiorgan involvement, diabetes insipidus, and a chronic course.

Methods To determine whether Langerhans' histiocytosis is a polyclonal reactive disease or a clonal disorder, we used X-linked polymorphic DNA probes (HUMARA, PGK, M27{beta}[DXS255], and HPRT) to assess clonality in lesional tissues and control leukocytes from 10 female patients with various forms of the disease. Lymphoid clonality was also assessed by analysis of rearrangements at immunoglobulin and T-cell-receptor gene loci.

Results The HUMARA assay detected clonal cells in the lesions of 9 of the 10 patients: 3 patients had acute disseminated disease, 3 had unifocal disease, and 3 had intermediate forms. The percentage of clonal cells closely approximated the percentage of CD1a-positive histiocytes in each lesion. Clonality was also confirmed in two of nine cases with the PGK or M27{beta} probe. Extreme constitutional lyonization precluded assessment of clonality in the 10th case. Lymphoid clonality was ruled out in all cases.

Conclusions The detection of clonal histiocytes in all forms of Langerhans'-cell histiocytosis indicates that this disease is probably a clonal neoplastic disorder with highly variable biologic behavior. Thus, genetic mutations that promote clonal expansion of Langerhans' cells or their precursors may now be identified.


Langerhans'-cell histiocytosis (LCH) encompasses several disorders previously known as histiocytosis X, Letterer-Siwe disease, Hand-Schuller-Christian syndrome, eosinophilic granuloma of bone, and self-healing reticulohistiocytosis1,2. The clinical varieties of LCH range from a lethal leukemia-like disorder that primarily affects infants to a curable solitary lytic lesion of bone. Intermediate forms characterized by lesions of bone, skin, and mucous membranes, various degrees of organ dysfunction, and diabetes insipidus have an indolent course. In contrast to the clinical heterogeneity of LCH, the pathologic features of all forms of the disease are more uniform. The lesions consist of histiocytes that resemble in morphology and phenotype the dendritic antigen-presenting Langerhans' cells of the skin and other organs1,3,4,5,6. Like their normal counterparts, pathologic Langerhans' cells are positive for HLA-DR, CD1a, S100, and the Fc receptor; some contain Langerhans' cell (Birbeck) granules1. Although LCH was described a century ago,7 its cause and pathogenesis are still unknown. The prevailing opinion is that LCH is a reactive disorder rather than a neoplastic process8. However, this assumption has never been definitively tested.

An important distinguishing feature of a neoplasm is its origin from a single clone of cells9. A reactive process, by contrast, is polyclonal. Clonality can be assessed in any cell lineage in the majority of female subjects by molecular analysis of patterns of X-chromosome inactivation (reviewed by Vogelstein et al.10,11 and Busque and Gilliland12). In female subjects, each somatic cell randomly inactivates one X chromosome early in embryogenesis and transmits its pattern of inactivation (lyonization) to all progeny cells. Methods of assessing the clonality of cells from a female subject follow the principle of lyonization. DNA probes that can detect polymorphisms at a particular X-linked locus allow a distinction to be made between the maternal X chromosome and the paternal X chromosome. The active X chromosome may be distinguished from the inactive X chromosome by its state of methylation or by gene expression. Ideally, half the cells in a polyclonal tissue will have inactivated the paternally derived X chromosome, and half the maternally derived X chromosome. A monoclonal, or "clonal," population of cells, by contrast, exclusively inactivates one X chromosome.

Three X-linked polymorphic loci have been used to analyze clonality: the loci for phosphoglycerate kinase (PGK)10,11 and hypoxanthine phosphoribosyltransferase (HPRT)10,11 and the hypervariable locus DXS255 (M27{beta})13,14,15,16,17. However, a low frequency of polymorphisms limits the usefulness of HPRT and PGK because of the low incidence of polymorphisms at these loci in the two X chromosomes,11,12 whereas variable methylation may restrict the utility of M27{beta}15,16. These shortcomings have been overcome with the X-linked human androgen-receptor (HUMARA) gene; analysis of clonality at this locus produces superior results because of its high rate of heterozygosity (informativeness) (>90 percent) and consistent patterns of methylation12,18,19. An aspect of lyonization that complicates the analysis is that nonrandom patterns of X-chromosome inactivation may occur in up to 25 percent of female subjects (skewed lyonization). Thus, their normal tissues may mimic the molecular pattern of a clonal population of cells12,20. It is therefore essential to compare patterns of X-chromosome inactivation in pathologic tissues with the patterns in normal cells derived from a similar embryologic lineage in each subject.

To determine whether LCH is a clonal or a polyclonal disorder, we used HUMARA, HPRT, PGK, and M27{beta} probes to evaluate clonality in lesional cells and peripheral leukocytes from 10 female patients with various forms of LCH.

Methods

Case Histories

Female patients with LCH were chosen for our study on the basis of the availability of appropriate fresh or frozen lesional tissues obtained for diagnosis and control samples of peripheral blood. Informed consent was obtained in all cases. The presence of CD1a-positive histiocytes and Langerhans'-cell granules confirmed the diagnosis of LCH in each case21. When frozen tissues were available (for all 10 patients except Patients 4 and 5), the percentage of CD1a-positive cells relative to the total number of nucleated cells in the lesion was determined by counting 500 cells in each of two fields in an immunoperoxidase-stained frozen section taken from the same tissue used for molecular analysis4,5. The lesions studied had been obtained before treatment in all patients except one (Patient 6), from whom tissue was obtained after radiation to a site remote from the sample.

Three patients presented with "acute disseminated LCH"22 involving the skin, liver, spleen, and lymph nodes (Patients 1, 2, and 3). Lymph-node biopsies provided diagnostic material and tissue for molecular studies. All three patients received intensive multiagent chemotherapy; Patient 1 died 10 months after diagnosis, and Patients 2 and 3 have survived 9 and 40 months after diagnosis, respectively.

Four patients presented with the intermediate form of LCH, with multiple bone lesions and various degrees of organ dysfunction (Patients 4, 5, 6, and 7). Diagnostic biopsies of osseous lesions provided tissue for molecular studies. A lymph-node biopsy was performed in Patient 7 during the course of disease after cranial irradiation and multiagent chemotherapy, and this specimen was also analyzed for clonality. Patient 4 died two years after diagnosis despite multiagent chemotherapy and local irradiation of affected mastoid processes. Patient 5 has remained free of any evidence of disease after therapy with vinblastine and prednisone. Patients 6 and 7 have active disease; Patient 7 has diabetes insipidus associated with a progressive hypothalamic tumor.

Three patients presented with LCH confined to a single bony lesion (Patients 8, 9, and 10). Specimens obtained during diagnostic biopsy of this tissue were used for clonality studies. These three patients were treated with curettage and are disease-free 16, 13, and 12 months after diagnosis, respectively.

Assessment of Lymphoid Clonality

To detect clonal lymphoid cells, rearrangements of genes encoding the variable region of immunoglobulin heavy chain and the beta, gamma, and delta chains of the T-cell-antigen receptor were identified in DNA from the patients' lesions according to established methods with a sensitivity of 2 percent23.

Molecular Assessment of Clonality with HPRT, PGK, and M27{beta} Probes

Lesional DNA was analyzed for clonality at the HPRT,10,11 PGK,10,11 and DXS255(M27{beta})13,14,17 loci with established Southern blotting techniques (reviewed by Busque and Gilliland12). Alleles were quantitated by laser densitometric scanning of autoradiographs; allelic ratios for M27{beta} and PGK were calculated as previously described17,20. Clonality at the PGK locus was also assessed with a polymerase-chain-reaction (PCR) assay24.

Molecular Assessment of Clonality at the HUMARA Locus

Clonality at the HUMARA locus was assessed by PCR amplification according to a modification of the technique of Allen et al.18 (Figure 1). A total of 10 ng to 1 µg of DNA was digested overnight at 37 °C in a 20-microl reaction mixture containing RsaI (20 units) or RsaI with 40 units of HpaII. The restriction enzymes were then inactivated by heating at 95 °C for 10 minutes. For the PCR, 2 microl of the digested DNA was combined with 23 microl of PCR reaction mixture, for a final concentration of 50 mmol of potassium chloride per liter, 10 mmol of TRIS (pH 8.3) per liter, 1.5 mmol of magnesium chloride per liter, 0.01 percent gelatin, 200 µmol of each deoxynucleotide triphosphate per liter, 5 pmol of each primer, 0.5 pmol of primer 1 labeled with {gamma}[P32]-ATP kinase, 0.05 unit of Taq polymerase, and 5 percent dimethylsulfoxide. The sequences of the primers used for amplification in the HUMARA assay were 5'GCTGTGAAGGTTGCTGTTCCTCAT3' (primer 1) and 5'TCCAGAATCTGTTCCAGAGCGTGC3' (primer 2). Initial denaturation was performed for 3 minutes at 94 °C, followed by 28 cycles of 45 seconds at 94 °C, 30 seconds at 60 °C, and 30 seconds at 72 °C. After amplification, 12.5 microl of sequencing-denaturing loading buffer was added to each tube; the samples were heated at 94 °C for five minutes and then quenched with ice. The samples were loaded on denaturing-sequencing gels composed of 4 percent 19:1 acrylamide:bisacrylamide in 30 percent formamide, 4 M urea, and TRIS borate EDTA buffer. The gels were run at 80 W for 4 hours, dried, and left on PhosphorImager screens (Molecular Dynamics) for 24 hours. Allele intensity was quantitated with ImageQuant 3.15 software.


View larger version (130K):
[in this window]
[in a new window]
 
Figure 1. The HUMARA Clonality Assay.

The top portion of the figure shows the HUMARA (human androgen-receptor gene) locus (purple). The methylation-sensitive restriction-enzyme sites (HpaII and HhaI) are located 100 base pairs 5' of the polymorphic CAG repeat [(CAG)n] in the first exon of the HUMARA gene18. Oligonucleotide primers (primers 1 and 2) flanking the methylation sites and this repeat amplify the polymorphic CAG repeat expansion in exon 1 of the HUMARA locus in the PCR. Variations in the length of the CAG repeat on the paternal and the maternal X chromosomes will yield HUMARA alleles of different lengths, thereby allowing the two X chromosomes to be distinguished. Methylation of the HpaII and HhaI sites further distinguishes the active (nonmethylated) from the inactive (methylated) X chromosome. Shown below the locus are the expected results of the HUMARA assay in the case of a polyclonal population of cells with a random pattern of X-chromosome inactivation (left) or a monoclonal population of cells with a nonrandom pattern of X-chromosome inactivation (right).

In this example, the maternal X chromosome (red) has a longer CAG repeat and will yield a longer HUMARA allele than will the paternal X chromosome (blue); methylated (inactive) chromosomes are shown as solid rectangles. Digestion with the methylation-sensitive enzyme HpaII or HhaI cleaves the restriction sites on the active (nonmethylated) chromosomes. The PCR does not then amplify these active alleles, because Taq DNA polymerase cannot extend beyond the cleaved DNA strand, thereby disrupting PCR amplification. In a polyclonal population (left), random X-chromosome inactivation results in methylation of both the maternal and paternal X chromosomes in different cells. Therefore, the PCR will amplify only the methylated (inactive) paternal and maternal X chromosomes in this polyclonal population. These alleles may then be resolved with gel electrophoresis since they are of different lengths. In contrast, in a monoclonal population with nonrandom X-chromosome inactivation (right), only one HUMARA allele is methylated in the clonal cells (in this example, the longer, maternal allele), and thus the PCR amplifies only one HUMARA allele. In the gel electrophoresis (bottom) shown here, the HUMARA alleles are represented as single bands, for simplicity; amplification of each allele actually yields a major band and a minor shadow band (see the Methods section and Figure 2). In the analysis of a mixed population of polyclonal and clonal cells, the relative intensity of each allele will be proportional to the percentage of clonal cells present in the polyclonal population. (Adapted from Allen et al.18 with the permission of the publisher.).

 
For each sample, a corrected ratio was calculated by dividing the ratio of the predigested sample (allele 1/allele 2) obtained after digesting DNA with RsaI and HpaII, by the ratio of the non-predigested sample (allele 1/allele 2) obtained after digesting DNA with RsaI alone. The use of this ratio corrected for the preferential amplification of one allele that might occur if the alleles differed markedly in the length of their repeats, or if the allele on the active X chromosome was more readily amplified. A final clonality ratio for each patient was determined by dividing the corrected ratio of the lesional DNA by that of the control DNA, thereby normalizing values for unequal lyonization. The percentage of clonal cells was estimated by comparing the final ratio with a standard curve of allelic ratios plotted against percentages of clonal cells. Experiments mixing polyclonal and clonal cells have demonstrated that the percentage of clonal cells can be estimated with an error of ±10 percent, and that a clonal population of cells can be detected if they constitute more than 10 to 15 percent of cells in a polyclonal background (unpublished data). All assays were performed in triplicate, with the assayer blinded to the percentage of lesional histiocytes.

Results

Patterns of X-chromosome inactivation in lesional tissue were compared with those in control leukocytes in peripheral blood from the 10 female patients with LCH. The HUMARA locus was informative in all 10 patients (Table 1). By contrast, the HPRT locus was uninformative in all patients tested (Patients 1 through 8; data not shown), and the PGK locus was informative in only one (Patient 8). Similarly, clonality could be reliably assessed with M27{beta} in only one patient (Patient 1); variable methylation, inability to resolve overlapping alleles, or inadequacy of the amounts of DNA for Southern blotting led to uninterpretable results in the other patients. Lesional DNA from all patients lacked clonal rearrangements of the immunoglobulin heavy chain or T-cell-receptor beta-, gamma-, and delta-chain genes, precluding the presence of a lymphoid clone in each patient (data not shown).

View this table:
[in this window]
[in a new window]
 
Table 1. Molecular Analysis of Clonality in Patients with LCH.

 
Acute Disseminated LCH

Clonal cells were detected in affected lymph nodes with the HUMARA assay (Figure 1) in all three patients with the acute disseminated form of LCH. In Patient 1, the ratio of the two HUMARA alleles (one from the maternal and one from the paternal X chromosome) in the control DNA was 1.09, a value close to the ideal ratio of 1.0 for a completely random pattern of X-chromosome inactivation (Table 1 and Figure 2A). In contrast, when the HUMARA locus in DNA from this patient's lymph node was amplified by PCR, there was preferential amplification of the larger HUMARA allele, which contains a longer triplet-repeat expansion (Figure 2B). The HUMARA-allele ratio in the lymph node, which was effaced by histiocytes, was 5.12, a value reflecting nonrandom X-chromosome inactivation and consistent with a predominantly clonal population. The final corrected clonality ratio, 4.7, was converted to a percentage of clonal cells, 65 percent (error, ±10 percent) (Table 1; see the Methods section). This value was similar to the percentage of CD1a-positive histiocytes in the lesion (70 percent) (Table 1). The close agreement between the molecular and histochemical results, along with the absence of a clonal lymphoid population, is strong evidence that the clonal cells in this lesion were the CD1a-positive histiocytes.


View larger version (20K):
[in this window]
[in a new window]
 
Figure 2. Assessment of Clonality in Patient 1 by the HUMARA PCR Assay.

Panel A shows the results of amplification of DNA from normal (control) lymphocytes. HUMARA alleles were amplified by PCR in the absence of HpaII (lanes 1 and 2) or in its presence (lanes 3 and 4). The detection of two alleles (lanes 1 and 2) indicates that this patient's DNA is informative at the HUMARA locus (shadow bands, which result from slippage of DNA polymerase during PCR amplification, are also evident). Alleles amplified in the absence or presence of HpaII were quantitated with PhosphorImager analysis (scans at right; the left-hand peak in each scan represents the amount of radioactivity in the upper HUMARA allele, and the right-hand peak represents the radioactivity in the lower allele). Both HUMARA alleles were amplified to an essentially equal degree in the control DNA, a result consistent with random X-chromosome inactivation.

Panel B shows the results of amplification of lesional DNA in the absence of HpaII (lane 1) or in its presence (lanes 2 and 3). The scan revealed a striking predominance of the upper HUMARA allele, a finding consistent with nonrandom X-inactivation and the presence of a predominant population of clonal cells.

 
Clonality was also confirmed with the M27{beta} probe in Patient 1 (Table 1 and Figure 3). Although both M27{beta} alleles in the control DNA were digested with methylation-sensitive restriction enzymes, indicating random X-chromosome inactivation (Figure 3A, lane 3), the two alleles were not digested equally, as in previous studies15,16. However, comparison of the digestion patterns in control DNA with those in lesional DNA did reveal very different patterns of X-chromosome inactivation. In lesional DNA, the upper M27{beta} allele was substantially digested, whereas the lower allele was undigested (Figure 3B, lane 3). This pattern is consistent with preferential inactivation (methylation) of the lower allele and the presence of a clonal population of cells. The M27{beta}-allele ratio was 1.9:1 in control DNA and greater than 10:1 in lesional DNA (Table 1).


View larger version (20K):
[in this window]
[in a new window]
 
Figure 3. Analysis of Clonality at the M27{beta} Locus in Patient 1.

Polymorphisms at the X-linked M27{beta} locus arise because of variation in the length of a tandem repeat13; PstI restriction-enzyme sites flank this repeat and a nearby methylation-sensitive HpaII site. To assess heterozygosity, DNA is first digested with PstI or with MspI (a methylation-insensitive enzyme that has the same restriction-enzyme recognition sequence as HpaII), followed by Southern blot hybridization with the M27{beta} probe; patterns of X-chromosome inactivation are then assessed by digestion with PstI and HpaII, followed by Southern blot hybridization (see the Methods section). In a monoclonal or clonal cell population, only one of the M27{beta} alleles is methylated at this site, and hence only one of the alleles will be digested with HpaII. In a polyclonal population, both M27{beta} alleles exist in inactive and active states because of nonrandom X-chromosome inactivation, and hence both bands will be partially digested.

Panel A shows the results of Southern blotting with control DNA. DNA was digested with PstI and MspI (lane 1), PstI alone (lane 2), and PstI and HpaII (lane 3), followed by Southern blotting analysis. As shown in lane 3, the M27{beta} alleles were easily resolved, and both were digested (although unequally) with HpaII. The result of densitometric quantitation of the alleles in lane 3 is shown at right (reading the scan from right to left [arrow] corresponds to reading lane 3 of the autoradiograph from top to bottom). These data are consistent with random X-chromosome inactivation.

Panel B shows the results of Southern blotting with lesional DNA. DNA was digested and M27{beta} alleles quantitated as in Panel A. In the corresponding scan, the upper M27{beta} allele was almost completely digested, but the lower allele was virtually undigested -- a result consistent with the presence of a clonal population of cells.

 
Clonality was also demonstrated in Patients 2 and 3, with the HUMARA assay (Table 1 and Figure 4). Although control DNA from Patient 2 had a nonrandom pattern of X-chromosome inactivation (corrected ratio for HUMARA alleles, 1.57), DNA from this patient's lymph node showed a markedly skewed pattern (corrected ratio, 4.9), indicating that a clonal population constituted 50 ±10 percent of the lymph-node cells. These data were consistent with the virtual effacement of this patient's lymph node by CD1a-positive histiocytes (Figure 5A). In contrast to the specimens from Patients 1 and 2, the lymph node from Patient 3 showed only focal sinusoidal involvement by CD1apositive histiocytes (Figure 5B). Nonetheless, a clonal population of cells constituting 25 ±10 percent of total cells could be detected with the HUMARA assay.


View larger version (24K):
[in this window]
[in a new window]
 
Figure 4. Assessment of Clonality in Patient 2 by the HUMARA PCR Assay.

Panel A shows the results of amplification of control DNA. HUMARA alleles were amplified by PCR in the absence of HpaII (lanes 1 and 2) and in its presence (lanes 3 and 4). Although it is not visible in the autoradiograph, some skewing of the HUMARA alleles in the normal tissue of this patient (corrected ratio, 1.57) (Table 1) was evident on PhosphorImager quantitation of the two alleles (shown to the right of the autoradiograph) amplified in the absence or presence of HpaII.

In Panel B, PCR amplification of lesional DNA and PhosphorImager quantitation of the two HUMARA alleles in the absence (lanes 1 and 2) or presence (lanes 3 and 4) of HpaII revealed a striking predominance of the upper allele -- a result consistent with a clonal population of cells.

 

View larger version (153K):
[in this window]
[in a new window]
 
Figure 5. Immunoperoxidase Staining of CD1a-Positive Langerhans' Histiocytes in Lymph Nodes from Patient 2 (Panel A, x200) and Patient 3 (Panel B, x200).

A lymph-node-biopsy specimen from Patient 2 stained with a CD1a antibody showed an immunoperoxidase reaction as described2,3. The node was effaced by CD1a-positive histiocytes. The node from Patient 3 contained only a focal sinusoidal infiltrate of CD1a-positive cells. In contrast to these lymph nodes affected by LCH, normal lymph nodes contain only rare, scattered CD1a-positive cells in the paracortex4,5.

 
Intermediate Forms of LCH

Specimens from Patients 4, 5, 6, and 7 were cytologically heterogeneous and contained relatively small numbers of CD1a-positive histiocytes admixed with eosinophils and other cells. However, in three of these four patients clonal cells could be detected in lesional tissues with the HUMARA assay (Table 1). With frozen tissues, the percentage of clonal cells determined with the HUMARA assay was close to the percentage of CD1a-positive histiocytes (Table 1). Control samples from Patients 4 and 5 had nonrandom patterns of X-chromosome inactivation, but the lesional tissues clearly contained clonal cell populations. In Patient 7, clonal cells were detected in a bone-biopsy specimen obtained before treatment and in an affected lymph node obtained three years after the biopsy. Both clonal populations had inactivated the same X chromosome, implying that the same clone persisted during the course of this patient's illness.

Clonality could not be determined definitively in Patient 6, a known carrier of X-linked spinobulbar muscular atrophy, because of extreme constitutional lyonization. This disease results from expansion of the polymorphic cysteine-alanine-glycine (CAG) repeat in the first exon of the HUMARA locus itself25. However, although control DNA displayed marked skewing (corrected ratio, 3.23), lesional DNA was skewed in the opposite direction (corrected ratio, 2.7), suggesting the presence of a clonal cell population.

Unifocal LCH

The HUMARA assay also detected clonal cells in bone-biopsy specimens from the three patients with solitary bone lesions (Table 1, Patients 8, 9, and 10). Despite skewed lyonization in normal DNA from Patient 8, the HUMARA assay revealed skewing in favor of the opposite HUMARA allele in lesional DNA (as in Patient 6). Clonality was also found in this patient with the PGK assay (Table 1). In each of the three patients, there was a close agreement between the percentage of clonal cells determined with the HUMARA assay and the percentage of CD1a-positive histiocytes in the lesion.

Discussion

Langerhans'-cell histiocytosis, an enigmatic disorder, has been variously classified as a neoplastic process, a reactive disorder, or an aberrant immune response1. A wide spectrum of disease and variable clinical behavior are characteristic. Although histopathological examination cannot predict clinical outcome, recent studies have shown that Langerhans' cells within the lesions of LCH are intrinsically proliferative26. In our study of 10 female patients with various forms of LCH whose ages ranged from 3 months to 25 years, molecular analysis revealed evidence of clonal cells in all 9 patients in whom results could be interpreted with confidence. The HUMARA PCR-based assay proved to be a powerful method of assessing clonality. In contrast to other X-linked polymorphic loci, the HUMARA locus had a high rate of informativeness, which allowed clonality to be determined in all patients. Quantitation of HUMARA alleles with PhosphorImager analysis gave the assay remarkable sensitivity, an essential feature in studies of cytologically heterogeneous lesions, such as those in LCH. The excellent agreement between the percentage of clonal cells detected with the HUMARA assay and the percentage of CD1a-positive histiocytes in each lesion, together with the absence of clonal lymphoid cells, strongly supports the conclusion that the clonal cells in LCH are the CD1a-positive Langerhans' cells. Our results thus show that LCH is a clonal histiocytic disease rather than a reactive polyclonal disorder.

It is notable that all three forms of LCH had a clonal pattern. The detection of clonal histiocytes in children with the acute disseminated form of disease was not unforeseen; this "leukemia-like" form of LCH behaves like a neoplastic process, with mortality rates approaching 60 to 65 percent among infants8,22,27,28. However, the presence of clonal histiocytes in intermediate forms of LCH was surprising. In this type of LCH the survival rate is 60 to 70 percent among children two years old or younger and 80 percent among children more than two years old8,27,28; spontaneous regression has rarely been reported8,29. The finding of clonal histiocytes in unifocal LCH was also unexpected, since this form of disease is the most clinically benign.

Although the possibility that LCH has a viral pathogenesis is of considerable interest, McClain et al.,30 using molecular methods to detect the genomes of Epstein-Barr virus, human herpesvirus type 6, and seven other viruses, found no trace of viral DNA in 50 cases of LCH. Leahy et al.31 have implicated human herpesvirus type 6, but their study requires confirmation. Recent ultrastructural studies also found no evidence of virus32. However, the remote possibility remains that LCH could result from a virally induced clonal proliferation of dendritic Langerhans' cells.

More compelling is the possibility that LCH is a clonal neoplastic disorder that arises from somatic mutations that cause the clonal expansion of Langerhans' cells or their precursors in bone marrow and organs. The extreme rarity of familial cases makes it unlikely that a predisposing mutation could be inherited in LCH as in other childhood neoplasms. Since our studies revealed that clonal histiocytes occur in all forms of LCH, clonality alone will not suffice to predict biologic behavior and clinical course. Indeed, clonal cells have been detected in several disorders that may not be overtly "malignant."33,34,35,36 However, if each form of LCH were to have distinct mutations, then molecular assessment at the time of diagnosis might allow one to predict the clinical course and to direct appropriate therapy.

Supported by the Histiocytosis Association of America, the Dedicated Health Research Fund of the State of New Mexico, the All Children's Hospital Foundation Histiocytosis Research Fund, and the National Cancer Institute of Canada.

We are indebted to the Toughill and Kontoyannis families, the Histiocytosis Association of America, and the Nikolas Symposia for the creation of research forums and funding for the histiocytoses; to our collaborators for submitting case materials and clinical histories -- Vickey Gresik, M.D. (Department of Pathology, Texas Children's Hospital, Baylor School of Medicine, Houston), Peter Isaacson, M.D. (Department of Histopathology, University College, London Medical School, London), Ron Jaffe, M.D. (Department of Pathology, Children's Hospital of Pittsburgh, Pittsburgh), James Navin, M.D. (Department of Laboratories, Kapiolani Medical Center for Women and Children, Honolulu), and Charles Palmer, M.D. (Presbyterian Hospital, Albuquerque, N.M.); and to Loretta Kanapilly-Chavez and Brian Schnell, M.D., for technical assistance.


Source Information

From the Departments of Pathology and Pediatrics, the Center for Molecular and Cellular Diagnostics, and the Cancer Center, University of New Mexico School of Medicine, Albuquerque (C.L.W., B.B.G., M.H.D.); the Division of Hematology-Oncology, Brigham and Women's Hospital, Harvard Medical School, Boston (L.B., D.G.G.); the Department of Pathology and Laboratory Medicine, All Children's Hospital, St. Petersburg, Fla. (B.E.F.); and the Department of Pediatrics, Texas Children's Hospital, Baylor College of Medicine, Houston (K.L.M.)

Address reprint requests to Dr. Willman at the University of New Mexico Cancer Center, 900 Camino de Salud, N.E., Albuquerque, NM 87131.

References

  1. Favara BE. Langerhans' cell histiocytosis: pathobiology and pathogenesis. Semin Oncol 1991;18:3-7. 
  2. Favara BE. Histiocytosis syndromes: classification, diagnostic features and current concepts. Leuk Lymphoma 1990;2:141-150.
  3. Nezelof C, Basset F, Rousseau MF. Histiocytosis X: histogenetic arguments for a Langerhans cell origin. Biomedicine 1973;18:365-371. [Medline]
  4. van der Valk P, van der Loo EM, Jansen J, Daha MR, Meijer CJLM. Analysis of lymphoid and dendritic cells in human lymph node, tonsil and spleen: a study using monoclonal and heterologous antibodies. Virchows Arch [B] Cell Pathol 1984;45:169-85.
  5. Weiss LM, Beckstead JH, Warnke RA, Wood GS. Leu-6-expressing cells in lymph nodes: dendritic cells phenotypically similar to interdigitating cells. Hum Pathol 1986;17:179-184. [Medline]
  6. Caux C, Dezutter-Dambuyant C, Schmitt D, Banchereau J. GM-CSF and TNF-{alpha} cooperate in the generation of dendritic Langerhans cells. Nature 1992;360:258-261. [CrossRef][Medline]
  7. Hand A Jr. Polyuria and tuberculosis. Arch Pediatr 1893;10:673-675. 
  8. Komp DM. Langerhans cell histiocytosis. N Engl J Med 1987;316:747-748. [Medline]
  9. Knudson AG Jr. Hereditary cancer, oncogenes, and antioncogenes. Cancer Res 1985;45:1437-1443. [Free Full Text]
  10. Vogelstein B, Fearon ER, Hamilton SR, Feinberg AP. Use of restriction fragment length polymorphisms to determine the clonal origin of human tumors. Science 1985;227:642-645. [Free Full Text]
  11. Vogelstein B, Fearon ER, Hamilton SR, et al. Clonal analysis using recombinant DNA probes from the X-chromosome. Cancer Res 1987;47:4806-4813. [Free Full Text]
  12. Busque L, Gilliland DG. Clonal evolution in acute myeloid leukemia. Blood 1993;82:337-342. [Free Full Text]
  13. Abrahamson G, Fraser NJ, Boyd Y, Craig I, Wainscoat JS. A highly informative X-chromosome probe, M27{beta}, can be used for the determination of tumour clonality. Br J Haematol 1990;74:371-372. [Medline]
  14. Boyd Y, Fraser NJ. Methylation patterns at the hypervariable X-chromosome locus DXS255 (M27{beta}): correlation with X-inactivation status. Genomics 1990;7:182-187. [CrossRef][Medline]
  15. Hodges E, Howell WM, Boyd Y, Smith JL. Variable X-chromosome DNA methylation patterns detected with probe M27{beta} in a series of lymphoid and myeloid malignancies. Br J Haematol 1991;77:315-322. [Medline]
  16. Cachia PG, Culligan DJ, Thomas ED, Whittaker J, Jacobs A, Padua RA. Methylation of the DXS255 hypervariable locus 5' CCGG site may be affected by factors other than X-chromosome activation status. Genomics 1992;14:70-74. [CrossRef][Medline]
  17. Fey MF, Peter H-J, Hinds HL, et al. Clonal analysis of human tumors with M27{beta}, a highly informative polymorphic X chromosomal probe. J Clin Invest 1992;89:1438-1444.
  18. Allen RC, Zoghbi HY, Moseley AB, Rosenblatt HM, Belmont JW. Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-receptor gene correlates with X chromosome inactivation. Am J Hum Genet 1992;51:1229-1239. [Medline]
  19. Busque L, Zhu J, DeHart D, et al. An expression based clonality assay at the human androgen receptor locus (HUMARA) on chromosome X. Nucleic Acids Res 1994;22:697-698. [Free Full Text]
  20. Gale RE, Wheadon H, Linch DC. X-chromosome inactivation patterns using HPRT and PGK polymorphisms in haematologically normal and post-chemotherapy females. Br J Haematol 1991;79:193-197. [Medline]
  21. Writing Group of the Histiocyte Society. Histiocytosis syndromes in children. Lancet 1987;1:208-209. [CrossRef][Medline]
  22. Nezelof C, Frileux-Herbet F, Cronier-Sachot J. Disseminated histiocytosis X: analysis of prognostic factors based on a retrospective study of 50 cases. Cancer 1979;44:1824-1838. [CrossRef][Medline]
  23. Willman CL, Griffith BB, Whittaker M. Molecular genetic approaches for the diagnosis of clonality in lymphoid neoplasms. Clin Lab Med 1990;10:119-149. [Medline]
  24. Gilliland DG, Blanchard KL, Levy J, Perrin S, Bunn HF. Clonality in myeloproliferative disorders: analysis by means of the polymerase chain reaction. Proc Natl Acad Sci U S A 1991;88:6848-6852. [Free Full Text]
  25. La Spada AR, Wilson EM, Lubahn DB, Harding AE, Fischbeck KH. Androgen receptor gene mutations in X-linked spinal and bulbar muscular atrophy. Nature 1991;352:77-79. [CrossRef][Medline]
  26. Hage C, Willman CL, Favara BE, Isaacson PG. Langerhans' cell histiocytosis (histiocytosis X): immunophenotype and growth fraction. Hum Pathol 1993;24:840-845. [CrossRef][Medline]
  27. Lahey ME. Prognosis in reticuloendotheliosis in children. J Pediatr 1962;60:664-671. 
  28. Greenberger JS, Crocker AC, Vawter G, Jaffe N, Cassady JR. Results of treatment of 127 patients with systemic histiocytosis (Letterer-Siwe syndrome, Schuller-Christian syndrome and multifocal eosinophilic granuloma). Medicine 1981;60:311-38.
  29. Broadbent V, Pritchard J, Davies EG, et al. Spontaneous remission of multi-system histiocytosis X. Lancet 1984;1:253-254. [Medline]
  30. McClain K, Jin H, Gresik V, Favara B. Langerhans cell histiocytosis -- lack of viral etiology. Am J Hematol (in press).
  31. Leahy MA, Krejci SM, Friednash M, et al. Human herpesvirus 6 is present in lesions of Langerhans cell histiocytosis. J Invest Dermatol 1993;101:642-645. [CrossRef][Medline]
  32. Mierau GW, Wills EJ, Steele PO. Ultrastructural studies in Langerhans cell histiocytosis: a search for evidence of viral etiology. Pediatr Pathol (in press).
  33. Weiss LM, Hu E, Wood GS, et al. Clonal rearrangements of T-cell receptor genes in mycosis fungoides and dermatopathic lymphadenopathy. N Engl J Med 1985;313:539-544. [Abstract]
  34. Weiss LM, Wood GS, Trela M, Warnke RA, Sklar J. Clonal T-cell populations in lymphomatoid papulosis: evidence of a lymphoproliferative origin for a clinically benign disease. N Engl J Med 1986;315:475-479. [Abstract]
  35. Kurahashi H, Hara J, Yumura-Yagi K, et al. Monoclonal nature of transient abnormal myelopoiesis in Down's syndrome. Blood 1991;77:1161-1163. [Free Full Text]
  36. Starzl TE, Nalesnik MA, Porter KA, et al. Reversibility of lymphomas and lymphoproliferative lesions developing under cyclosporin-steroid therapy. Lancet 1984;1:583-587. [Medline]

 

This Article
-Abstract

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation

This article has been cited by other articles:



HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2008 Massachusetts Medical Society. All rights reserved.