FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Volume 331:213-221 July 28, 1994 Number 4 Next

Abstract Letters Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

ABSTRACT

Background Colorectal cancer occurs in approximately 150,000 people each year in the United States. Prognostic assessment influences the treatment of patients with colorectal cancer, including decisions about adjuvant therapy. We evaluated chromosome 18q allelic loss, a genetic event associated with tumor progression, as a prognostic marker for this disease.

Methods We developed procedures to examine the status of chromosome 18q with microsatellite markers and DNA from formalin-fixed, paraffin-embedded tumors. Allelic loss of chromosome 18q was assessed in 145 consecutively resected stage II or III colorectal carcinomas.

Results Among patients with stage II disease, the five-year survival rate was 93 percent in those whose tumor had no evidence of allelic loss of chromosome 18q and 54 percent in those with allelic loss; among patients with stage III disease, survival was 52 and 38 percent, respectively. The overall estimated hazard ratio for death in patients whose tumor had chromosome 18q allelic loss was 2.83 (P = 0.008) according to univariate analysis. Furthermore, chromosome 18q allelic loss remained a strong predictive factor (hazard ratio for death, 2.46; 95 percent confidence interval, 1.06 to 5.71; P = 0.036) after adjustment for all other evaluated factors, including tumor differentiation, vein invasion, and TNM stage.

Conclusions The status of chromosome 18q has strong prognostic value in patients with stage II colorectal cancer. The prognosis in patients with stage II cancer and chromosome 18q allelic loss is similar to that in patients with stage III cancer, who are thought to benefit from adjuvant therapy. In contrast, patients with stage II disease who do not have chromosome 18q allelic loss in their tumor have a survival rate similar to that of patients with stage I disease and may not require additional therapy.

Colorectal cancers result from the accumulation of several distinct genetic alterations involving the K-ras oncogene on chromosome 12 and tumor-suppressor genes on chromosomes 5, 17, and 18^10,11,12. The short arm of chromosome 17 (17p) and the long arm of chromosome 18 (18q) are frequently lost in colorectal tumors. This observation led to the discovery that inactivation of the p53 and DCC genes (located on chromosomes 17p and 18q, respectively) probably contributes to the neoplastic transformation of colorectal epithelial cells^13,14. Although studies of the biochemical mechanisms underlying the development of colorectal cancer are just beginning, the genes involved in this process have the potential to serve as markers in diagnosis and prognosis.

We have previously shown that distant metastasis of colorectal cancer is associated with deletions of chromosomes 17p and 18q and more generally with chromosomal losses throughout the genome^15,16. Other studies have also indicated that loss of chromosome 17p or chromosome 18q has prognostic value^17,18. However, several problems have prevented the application of these findings in a routine clinical setting. The analyses have required fresh-frozen tissues, relatively large quantities of DNA, and special procedures to isolate cancer cells from stromal and inflammatory cells within the tumor mass. In addition, Southern blot analysis depends on the heterozygosity of restriction-fragment-length polymorphisms (RFLPs), which are often absent in the chromosomal region of interest.

To develop a practical molecular genetic test for assessing the prognosis of patients with colorectal cancer, we used formalin-fixed paraffin-embedded sections as a source of DNA and highly polymorphic microsatellite markers to determine the status of chromosome 18q. Microsatellite markers are short-tandem-repeat DNA sequences located throughout the genome¹⁹. They are readily assayed by polymerase-chain-reaction (PCR) amplification of small amounts of DNA and gel electrophoresis^20,21,22. The two allelic forms of the microsatellites in normal cells, one inherited from each parent, migrate on gel electrophoresis as two bands of nearly equal intensity but different sizes. Chromosomal losses in tumor tissues cause a loss of one of the two PCR products or a change in their relative intensities (Figure 1). We used this technique to determine whether chromosome 18q loss is a prognostic marker in colorectal cancer.

View larger version (140K): [in this window] [in a new window]   Figure 1. Strategy for Determining the Allelic Status of the Long Arm of Chromosome 18. Neoplastic tissue and non-neoplastic control tissue were separated by microdissection of routine histopathological sections from resection specimens. Total genomic DNA was isolated from each tissue sample. The polymerase chain reaction (PCR) was used to amplify polymorphic microsatellite markers capable of distinguishing between the maternal and paternal copies of chromosome 18. Allelic loss (alleles are designated as A and B on chromosome 18) was observed as absence or a relative reduction of the PCR product corresponding to the lost chromosomal arm. (On the slide label, JHH stands for Johns Hopkins Hospital.).

 
Methods

Patients

One hundred forty-five samples of stage II or III sporadic colorectal carcinoma were obtained for evaluation of the loss of chromosome 18q. They were obtained consecutively from curative surgical resections of primary colorectal tumor performed at the Johns Hopkins Hospital between July 1986 and December 1990. This period was studied because postoperative adjuvant chemotherapy was not administered routinely to patients at this institution until 1991. The tumor stage was based on pathological and clinical evaluation, which included preoperative radiography, computed tomography, and abdominal exploration at laparotomy.

Patients were excluded from the analysis if they had evidence of hereditary non-polyposis colorectal cancer syndrome according to the criteria of the International Collaborative Group,²³ had had malignant tumor outside the colon within the previous five years, had synchronous adenocarcinoma of the large bowel, had carcinoma associated with idiopathic inflammatory bowel disease, or had received preoperative radiation or chemotherapy. Follow-up was carried out through the Johns Hopkins Tumor Registry and was based on chart reviews and yearly contacts with the physician or patient. Follow-up findings were confirmed in all patients as of September 1993. The clinical and pathological characteristics of the tumors were determined by a gastrointestinal pathologist without knowledge of the status of chromosome 18q, according to conventional criteria²⁴.

Tissue and DNA Preparation

In the pilot study for development of the method, DNA was prepared from microdissected cryostat sections of frozen tumor tissues as previously described¹⁰. For the prospective study, DNA was purified with modified methods for assessing allelic loss with PCR^25,26. Tissue sections 6 microm thick were obtained from surgical specimens that had been fixed in formalin and embedded in paraffin for routine histopathological examination. The slides were stained with hematoxylin and eosin, dehydrated in graded ethanol, and then dried without a cover glass. Regions containing at least 70 percent neoplastic cells were inked with a black marker (Sharpie, Sanford Corp., Bellwood, Ill.) under a dissection microscope. The black marking ink increased the density of the tissue and kept it at the bottom of the tube after centrifugation. Tissues from 2 to 10 slides, each containing a blackened region of tumor 0.2 to 1 cm² in area, were scraped off with a razor blade and transferred to a 1.5-ml Microfuge tube. Non-neoplastic tissue from the same slide was then marked and placed in another Microfuge tube. The collected tissue samples were deparaffinized in 400 microl of xylene for 15 minutes and pelleted by centrifugation at 10,000 x g for 2 minutes. After the xylene was removed by pipette, the tissues were heated at 58 °C for 15 minutes to remove the remaining xylene and incubated overnight at 58 °C in a buffer containing 0.5 M TRIS (pH 8.9), 20 mM EDTA, 10 mM sodium chloride, 0.5 mg of proteinase K per milliliter, and 1 percent sodium dodecyl sulfate. The samples were boiled in a water bath for 10 minutes at 100 °C, cooled to room temperature, and then extracted twice with an equal volume of phenol and chloroform, as previously described²⁷. DNA was precipitated with ethanol and dissolved in 30 microl of buffer containing 3 mM TRIS (pH 7.5) and 0.3 mM EDTA.

Microsatellite Markers and PCR Amplification

Oligonucleotide primers for microsatellite markers from the long arm of chromosome 18 were designed on the basis of published sequences²⁸. The following dinucleotide-repeat markers and primers were used in the prospective study: D18S55, 5'GGGAAGTCAAATGCAAAATC3' and 5'AGCTTCTGAGTAATCTTATGCTGTG3'; S18S58, 5'GCTCCCGGCTGGTTTT3' and 5'GCAGGAAATCGCAGGAACTT3'; D18S61, 5'ATTTCTAAGAGGACTCCCAAACT3' and 5'ATATTTTGAAACTCAGGAGCAT3'; D18S64, 5'AACTAGAGACAGGCAGAA3' and 5'ATCAGGAAATCGGCACTG3'; and D18S69, 5'CTCTTTCTCTGACTCTGACC3' and 5'GACTTTCTAAGTTCTTGCCAG3'. The sequences of other primers used in the pilot study are available from us on request. It was important to use primers that produced a PCR product less than 180 base pairs in size, because longer fragments did not amplify consistently with DNA purified from paraffin-embedded sections. PCR-based dinucleotide-repeat assays were carried out in 96-well plates for 30 cycles; each cycle was carried out at 95 °C for 30 seconds, 50 °C for 1 minute, and 70 °C for 1 minute, with primers end-labeled with ³²P-labeled ATP to a specific activity of more than 10⁸ cpm per µg of DNA and under the PCR conditions previously described²⁹. Two volumes of stop buffer (95 percent formamide, 20 micro M sodium hydroxide, and 0.05 percent bromophenol blue and xylene cyanate) were added at the end of the amplification, and the samples were loaded onto 7 percent polyacrylamide gels containing 32 percent formamide and 5.6 M urea³⁰. The relative positions of the DCC gene and other chromosome 18 markers were determined by typing CEPH (Centre d'Etude du Polymorphisme Humain) reference families 1331, 1332, 1347, 1362, and 1416 for DCC³¹ and using the Clinik program of the Linkage program package³² to compute the best placement of the gene on a fixed map.

In the pilot study, the status of chromosome 17p was analyzed in the same way as that of chromosome 18q, with the microsatellite markers D17S804, D17S786, and D17S796²⁸ and a marker in the p53 gene³³.

Determination of Chromosome 18q Status

We defined chromosome 18q loss as the complete or partial loss of the long arm of chromosome 18. Loss of a chromosome 18q allele in a tumor was considered to be present when the PCR assay of adjacent non-neoplastic tissue showed heterozygosity of the microsatellite markers on the long arm of chromosome 18, and the relative intensity of the two alleles in the tumor DNA differed from the relative intensity in the non-neoplastic tissue DNA by a factor of at least 1.5³⁴. When the loss of the allele was not obvious on visual inspection, the intensities of the bands were quantitated with a PhosphorImager (Molecular Dynamics, Sunnyvale, Calif.). Some tumors (6 of 43 in the pilot study and 18 of 137 in the prospective study) yielded PCR products of abnormal sizes with two or more microsatellite markers. These tumors were considered to be in the previously described replication error (RER) subclass^35,36,37,38. It is difficult to ascertain allelic loss of chromosome 18q with microsatellite markers in RER-positive tumors because of the instability of the repeats. However, such tumors infrequently lose any chromosomes, including chromosome 18q³⁷. In the pilot study reported here, Southern blot analysis showed that none of the RER-positive tumors had lost chromosome 18q³⁹. Therefore, tumors of the RER type were included among the tumors with no loss of chromosome 18q in the survival and other statistical analyses.

In the prospective study, two dinucleotide-repeat markers from chromosome 18q (D18S61 and D18S58) were sufficient to determine the status of the chromosome in 110 of the 135 paraffin-embedded tumor specimens (81 percent). Additional markers (D18S69, D18S64, and D18S55) were required only when no heterozygosity in either D18S61 or D18S58 was present in the non-neoplastic tissue, or when atypical bands indicating a potential RER phenotype were observed in either marker.

Statistical Analysis

The primary statistical outcome in this study was overall survival measured from the date of surgery. Event-time distributions were estimated with the product-limit method⁴⁰. Differences between prognostic factors were tested for statistical significance with the log-rank statistic⁴¹. More generally, we estimated the hazard (risk) ratio per unit of change in each level of a potential prognostic factor relative to a specific base-line level. For example, the risk of death among patients with chromosome 18q loss was compared with the risk among patients with no loss, for all follow-up time and all patients. For prognostic factors that were continuous variables (e.g., tumor size), the risk ratio was expressed per unit of change (e.g., per centimeter of increase in size). Hazard ratios and associated 95 percent confidence intervals were estimated with the proportional-hazards model⁴². All reported P values are two-sided.

The simultaneous effects of more than one prognostic factor were estimated by multiple regression in the proportional-hazards model⁴². In this analysis, all factors that were potentially prognostic when considered alone (i.e., the P value was less than 0.15) were entered into a multiple regression model from which hazard ratios and significance levels were estimated. A factor that was not statistically significant or that had an estimated hazard ratio near 1.0 was removed from the model. Hazard ratios and significance levels were then estimated again to derive a more parsimonious model. This step-down procedure was continued until all remaining factors were significant. In some cases, we retained factors that were not significant solely to illustrate their lack of effect in the presence of other factors. In addition, the effects of prognostic factors were controlled by stratified proportional-hazards regression (e.g., rectal vs. colonic tumors) to avoid the assumption of proportional hazards.

Results

Microsatellite Markers for Chromosome 18q Allelic Loss

To establish the reliability of dinucleotide-repeat ((CA)_n) markers for determining chromosomal loss, we tested 43 pairs of tumor and non-neoplastic DNA samples from fresh-frozen tissues in a pilot study. The chromosomal status of 36 of these tumors had been analyzed in detail by hybridizing Southern blots with DNA probes capable of detecting RFLPs of chromosome 18q³⁹. Ten dinucleotide-repeat markers spanning the entire length of chromosome 18q were used to assess the loss of genetic material in this chromosomal region of the tumors. The results obtained with the dinucleotide-repeat assays corresponded perfectly to the available data on RFLPs. Twenty-seven tumors in which Southern blot analysis showed total or partial loss of chromosome 18q had similar losses according to the (CA)_n-repeat assay, and nine tumors that showed no loss of RFLP markers on Southern blot analyses also retained all informative (CA)_n markers. The status of chromosome 18q in the remaining seven tumors (16 percent) was determined with use of (CA)_n markers (four of the tumors had loss of chromosome 18q, and three had no loss), but no comparison with Southern blot data was possible because of the lack of informative RFLP markers in these tumors.

We then examined the association between the region of chromosome 18q that was lost and the presence of metastasis in the 43 patients, all of whom had been followed at least five years (Figure 2). Metastases were found in 19 of the 25 patients whose tumors had lost all the markers studied and all 5 patients with loss of the six most distal markers but not markers more proximal. In contrast, the 1 patient whose tumor had lost only the most distal marker (D18S70) and 11 of 12 patients whose tumor had not lost any marker were free of metastasis. Thus, the dinucleotide markers D18S69, D18S64, D18S55, D18S61, and D18S58 (Figure 2) were most closely associated with the presence of metastatic disease. The markers were found to be highly polymorphic and produced robust signals in the PCR-based dinucleotide-repeat assay.

View larger version (24K): [in this window] [in a new window]   Figure 2. Chromosome 18q Markers and Their Association with Metastasis in the Pilot Study. Chromosome 18q markers are listed from centromere (top) to telomere (bottom). The estimates of genetic distances between each marker and the one directly above it are shown in centiMorgans (cM) and are based on recombination frequencies averaged for sex. The odds in favor of the listed order of markers relative to each other, against pairwise inversion (i.e., reversed order of the pair of markers), were greater than 1 million to 1 in every case. The extent of chromosomal loss in the tumors is indicated by the shaded area. The presence of metastases in patients was determined as previously described15,16. In 25 patients there was loss of all studied markers, and in 5 patients there was loss of the six most distal markers; in 1 patient the tumor had lost only the most distal marker. The DCC gene lies between markers D18S65 and D18S69.

 
In this pilot study we also assessed the loss of chromosome 17p with four microsatellite markers. There was a strong concordance between chromosome 17p and chromosome 18q allelic losses (35 of 43 tumors), as in our previous study,^15,16 but chromosome 18q allelic loss was more closely associated with metastasis in patients whose tumor had either chromosome 17p or chromosome 18q allelic loss. All three patients whose tumor had chromosome 18q allelic loss but not chromosome 17p allelic loss had metastatic disease, whereas only one of five patients with chromosome 17p allelic loss but not chromosome 18q allelic loss had metastases. Therefore, the chromosome 18q markers were chosen for the subsequent prospective study. Figure 2 shows the relative chromosomal position and genetic distance of these 10 dinucleotide-repeat markers.

Using five chromosome 18q markers, we tested the applicability of the dinucleotide-repeat assay to DNA from formalin-fixed paraffin-embedded tumor specimens in the pilot study (Figure 3). The results of the assays with 17 paraffin-embedded tumor sections coincided precisely with the results obtained with DNA from cryostat sections of the same frozen tumors (data not shown).

View larger version (62K): [in this window] [in a new window]   Figure 3. Chromosome 18q Allelic Loss in DNA from Formalin-Fixed Paraffin-Embedded Tumor Sections. Dinucleotide-repeat assays were carried out on DNA obtained from tumor and non-neoplastic tissues of the same histopathological section. Allelic loss of chromosome 18q was observed when one of the two alleles present in the non-neoplastic tissue (N lanes) was absent or reduced in intensity in the tumor (T lanes). The chromosome 18q markers shown are D18S58 (upper panels) and D18S61 (lower panels). The tumors in panels 2, 3, 5, 6, 8, and 9 showed chromosome 18q loss (arrowheads), whereas those in panels 1, 4, 7, and 10 did not show loss.

 
Clinical Characteristics Associated with Chromosome 18q Allelic Loss

We used this dinucleotide-repeat assay to evaluate consecutively resected tumors from a cohort of 145 patients. We were able to determine the status of chromosome 18q in 135 of the 145 tumor specimens (93 percent); 6 specimens were not analyzed because of insufficient amounts of tumor or non-neoplastic tissue, and 4 specimens could not be analyzed because of failed PCR amplifications. Table 1 lists relevant clinical characteristics of all 145 patients and the 135 patients whose tumors were analyzed for chromosome 18q allelic loss. Of the 135 tumors we studied, 90 (67 percent) had either complete or partial loss of chromosome 18q (examples are shown in Figure 3). Fewer patients with stage II disease had chromosome 18q allelic loss in their tumor than the patients with stage III disease (P = 0.007). More than two thirds of the tumors with chromosome 18q allelic loss were in the patient's left colon (i.e., distal to the splenic flexure), whereas two thirds of the tumors without chromosome 18q allelic loss were on the right (P<0.001). The frequency of 18q allelic loss among patients with colon cancers was not significantly different from the frequency among those with rectal cancers (P = 0.12). Patients receiving adjuvant therapy were more common in the group with chromosome 18q allelic loss (P = 0.026) because adjuvant therapy was given more frequently for stage III cancer than for stage II cancer (28 of 76 patients and 6 of 69 patients, respectively). At the close of this study, 83 percent of the patients without chromosome 18q allelic loss and 58 percent of the patients with chromosome 18q allelic loss were still alive at the time of the last follow-up evaluation (P = 0.005). The mean follow-up time was 33 months in the patients with chromosome 18q allelic loss and 38 months in those without such loss.

View this table: [in this window] [in a new window]   Table 1. Clinical Characteristics of All Patients with Colorectal Cancer and Patients Whose Tumors Were Evaluated for Chromosome 18q Status.

 
Status of Chromosome 18q and Survival

Clinical stage was a significant prognostic factor for survival (Figure 4A). In this cohort of patients the overall five-year survival rate was 74 percent in those with stage II disease and 42 percent in those with stage III disease. However, when the status of chromosome 18q was considered, the five-year survival rate was 93 percent in patients with stage II disease whose tumor had no chromosome 18q allelic loss and 54 percent in patients in the same stage whose tumor had chromosome 18q allelic loss (Figure 4B). The survival rate in the latter group of patients did not differ significantly from the survival rate among patients with stage III tumors. The survival rate among patients with stage III colorectal cancer was independent of their status for chromosome 18q. Similar results were obtained when disease-free survival was the end point and when colonic and rectal tumors were analyzed independently. Adjuvant therapy had no significant effect on the outcome in this study (Table 2).

View larger version (14K): [in this window] [in a new window]   Figure 4. Overall Survival of Patients with Colorectal Cancer, According to TNM Stage Alone (Panel A) and Both TNM Stage and Chromosome 18q Allelic Loss (Panel B). The survival rate of patients with stage II disease was significantly better than that of patients with stage III disease (P = 0.006). However, when the patients were subclassified according to their status for chromosome 18q, the survival rate of patients with stage II disease whose tumor had chromosome 18q allelic loss was similar to that of patients with stage III disease, whereas patients with stage II disease whose tumor retained both alleles of chromosome 18q had a significantly better outcome (see Table 3).

 

View this table: [in this window] [in a new window]   Table 2. Estimated Hazard Ratios for Selected Individual Prognostic Factors in All 145 Patients Studied.

 
Chromosome 18q Allelic Loss and Other Prognostic Factors

Besides chromosome 18q allelic loss, other factors were associated with a higher or lower risk of death when these factors were considered individually. Chromosome 18q allelic loss, advanced tumor stage, extramural vein invasion, perineural invasion, and poor tumor differentiation were all associated with a significantly poorer prognosis, whereas white race and female sex were associated with a better prognosis (Table 2). However, as is frequently the case in such analyses, there were correlations among the various prognostic factors we analyzed. As examples, patients in an advanced stage of disease had a higher frequency of poorly differentiated tumors, and poorly differentiated tumors were more likely to involve veins and nerves. In such situations, individual factors are only partially independent with respect to their ability to predict survival.

To study the independent effects of the prognostic factors in the presence of correlations, we used a multiple regression proportional-hazards model. Table 3 shows three representations of multiple regression models. The first model illustrates the fit of a roughly optimal set of prognostic factors in the cohort of patients -- that is, the addition of any other recorded variable did not yield prognostic information independent of the information produced by the factors listed. It is noteworthy that in patients whose tumor had chromosome 18q allelic loss, the risk of death was more than doubled, even after adjustment for vein involvement, grade of tumor differentiation, and race (Table 3, model 1). When the TNM stage was added to this set of predictors, this factor seemed to be redundant (i.e., it did not provide additional prognostic information) in the group studied, which consisted of patients with stage II and stage III disease only (Table 3, model 2). The factors that were redundant with TNM stage were not easily identifiable, but when vein invasion was removed from the regression model, the estimated hazard ratio for TNM stage increased (Table 3, model 3); retention of either tumor differentiation or vein involvement decreased the estimated prognostic effect of TNM stage. In contrast, the significance of chromosome 18q allelic loss as a prognostic factor remained nearly the same despite the inclusion of other factors in the regression analysis. Furthermore, when those models were stratified according to tumor site (colon vs. rectum), the estimated hazard ratios, P values, and confidence intervals were essentially unchanged.

View this table: [in this window] [in a new window]   Table 3. Hazard Ratios for Prognostic Factors in Multiple Regression Models Including All 145 Patients.

 
Discussion

Our study demonstrates that chromosome 18q allelic loss is an important prognostic marker in patients with stage II colorectal cancer. The subgroup of all patients with stage II disease whose tumor had retained both alleles of chromosome 18q (45 percent of all these patients) had an excellent outcome (five-year survival of 93 percent), whereas survival in patients with stage II disease whose tumor had lost one allele of chromosome 18q was similar to that in patients with stage III disease (five-year survival of 54 percent) (Figure 4B). Although the majority of the patients we studied had colon cancer, our results suggest that the prognostic value of allelic loss of chromosome 18q also pertains to rectal cancer. Our study suggests that adjuvant therapy with levamisole and fluorouracil, which reportedly benefits patients with stage III disease,⁸ may also be appropriate for patients with stage II disease whose colonic tumors have lost chromosome 18q.

Patients with stage III disease had a significantly higher frequency of chromosome 18q allelic loss than did those with stage II disease (77 percent vs. 55 percent) (Table 1), but chromosome 18q allelic loss had no significant prognostic value in patients with stage III disease. This finding may relate to the complexity of the metastatic process; allelic loss of chromosome 18q is clearly not a prerequisite for metastasis in colorectal cancer. It is thus possible that some stage III tumors have a worse prognosis through pathways that do not involve chromosome 18q.

In addition to the status of chromosome 18q, several conventional factors also had prognostic value in our study. These included invasion of extramural veins by tumor cells, perineural invasion, and poor tumor differentiation. These factors, however, can vary considerably within the same tumor and can be perceived differently from observer to observer.

Rapid advances in the molecular genetics of colorectal cancer have stimulated attempts to use molecular markers for assessing prognosis in patients with this disease. Altered total DNA content (aneuploidy), assessed by flow cytometry, can correlate with advanced tumor stage, poor tumor differentiation, and relatively poor survival,⁴³ but the technical difficulties of flow cytometry have led to conflicting results^44,45. Fractional allelic loss, assayed by Southern blot analysis, has been used as a measure of chromosomal loss throughout the genome^15,16,39. High fractional allelic loss is associated with poor survival, but the large number of chromosomal sites needed for analysis renders the method impractical for routine use.

Microsatellite instability, a manifestation of the RER phenotype, has been described in sporadic colorectal carcinomas^24,35,36 and hereditary non-polyposis colorectal cancer^37,38. In our study, the five-year survival rate of the 18 patients with RER-positive tumors was indistinguishable from that of the 28 patients whose tumors had retained chromosome 18q and were RER-negative. These results agree with other reports that RER-positive tumors have a lower tendency to metastasize than RER-negative tumors and that patients with RER-positive tumors have relatively good survival^35,36,37. Our pilot study showed that RER-positive tumors do not often lose any allele of chromosome 18q. It is possible that the better outcome in patients with RER-positive tumors is a result of retention of both alleles of chromosome 18q.

Certain specific genetic alterations have also been studied as potential prognostic markers. Activating mutations of ras proto-oncogenes and loss of the nm23 gene have been reported to have prognostic importance^46,47,48. One of the most commonly affected genes in human cancers is p53^49,50. Mutational inactivation of the p53 gene often accompanies the loss of chromosome 17p, and accumulation of the mutated protein occurs frequently in colorectal cancers^13,49. Such mutation or loss of p53 has made it potentially useful for diagnosis and prognosis^{15,16,17,18,50,51,52,53}. In our pilot study, chromosome 17p allelic loss was less closely associated with metastasis than chromosome 18q allelic loss. In our prospective study, overexpression of p53, as assessed by immunohistochemical analysis, was not useful for determining prognosis (data not shown).

Study of the commonly deleted regions on chromosome 18q led to the identification of the candidate tumor-suppressor gene, DCC (deleted in colorectal cancer)¹⁴. The DCC protein has structural features in common with certain types of cell-adhesion molecules and may participate with other proteins in cell-cell and cell-matrix interactions^14,54,55,56. The loss of chromosome 18q could thus lead to impaired contacts between cells, thereby contributing to tumor growth and invasion. Linkage analysis indicates that the DCC gene lies immediately adjacent to the region of chromosome 18q that we evaluated in our prospective study (between D18S69 and D18S65) (Figure 2). Interestingly, expression of the DCC gene was recently shown to be absent in most colorectal cancers that were metastatic to the liver, but it was lost only in a minority of nonmetastatic cancers⁵⁷. This finding supports the idea that the DCC gene is the biologic basis of the association of chromosome 18q with prognosis. However, an additional gene (or genes) on chromosome 18 and elsewhere in the genome may also play a part, and further biochemical and genetic studies are required to resolve this issue.

The prognostic evaluation afforded by the chromosome 18q assay is clinically meaningful but imperfect. Although retention of chromosome 18q is a favorable finding, the outcome in patients whose tumor has chromosome 18q allelic loss is unpredictable, and the prognosis of patients with stage III disease is unchanged by knowledge of the status of chromosome 18q. In the future, tests for the status of chromosome 18q may be combined with other genetic and biochemical assays to improve prognostic evaluation in patients with colorectal cancer.

Supported by the Clayton Fund and by grants (CA-35494, CA-09243, CA-47527, and CA-62924) from the National Cancer Institute.

We are indebted to Ms. A. Kammer of the Johns Hopkins Tumor Registry for assistance, to Dr. L. Grochow for helpful comments, and to Mrs. T. Gwiazda for help in preparing the manuscript.

Source Information

From the Departments of Oncology (J.J., S.P., K.W.K., B.V., S.R.H.), Pathology (H.K., S.R.H.), and Anesthesiology and Critical Care Medicine (Z.-F.L., R.C.L.), Johns Hopkins University School of Medicine, Baltimore; and the Finnish Red Cross Blood Transfusion Service, Helsinki, Finland (P.S.).

Address reprint requests to Dr. Hamilton at the Department of Pathology, Ross Bldg., Rm. 632, Johns Hopkins University School of Medicine, 720 Rutland Ave., Baltimore, MD 21205-2196

References

1. Cancer facts & figures -- 1993. Atlanta: American Cancer Society, 1993. 
2. Adjuvant therapy for patients with colon and rectal cancer. JAMA 1990;264:1444-1450. [CrossRef][Medline]
3. Deans GT, Parks TG, Rowlands BJ, Spence RAJ. Prognostic factors in colorectal cancer. Br J Surg 1992;79:608-613. [Medline]
4. Crissman JD, Barwick KW. Pathologic staging of colon and rectal adenocarcinoma. In: Wanebo HJ, ed. Colorectal cancer. St. Louis: Mosby-Year Book, 1993:57-74.
5. Gastrointestinal Tumor Study Group. Prolongation of the disease-free interval in surgically treated rectal carcinoma. N Engl J Med 1985;312:1465-1472. [Abstract]
6. Douglass HO Jr, Moertel CG, Mayer RJ, et al. Survival after postoperative combination treatment of rectal cancer. N Engl J Med 1986;315:1294-1295. [Medline]
7. Laurie JA, Moertel CG, Fleming TR, et al. Surgical adjuvant therapy of large-bowel carcinoma: an evaluation of levamisole and the combination of levamisole and fluorouracil: the North Central Cancer Treatment Group and the Mayo Clinic. J Clin Oncol 1989;7:1447-1456. [Abstract]
8. Moertel CG, Fleming TR, Macdonald JS, et al. Levamisole and fluorouracil for adjuvant therapy of resected colon carcinoma. N Engl J Med 1990;322:352-358. [Abstract]
9. Krook JE, Moertel CG, Gunderson LL, et al. Effective surgical adjuvant therapy for high-risk rectal carcinoma. N Engl J Med 1991;324:709-715. [Abstract]
10. Vogelstein B, Fearon ER, Hamilton SR, et al. Genetic alterations during colorectal-tumor development. N Engl J Med 1988;319:525-532. [Abstract]
11. Fearon ER, Vogelstein B. A genetic model for colorectal tumorigenesis. Cell 1990;61:759-767. [CrossRef][Medline]
12. Hamilton SR. The molecular genetics of colorectal neoplasia. Gastroenterology 1993;105:3-7. [Medline]
13. Baker SJ, Fearon ER, Nigro JM, et al. Chromosome 17 deletions and p53 gene mutations in colorectal carcinomas. Science 1989;244:217-221. [Free Full Text]
14. Fearon ER, Cho KR, Nigro JM, et al. Identification of a chromosome 18q gene that is altered in colorectal cancers. Science 1990;247:49-56. [Free Full Text]
15. Kern SE, Fearon ER, Tersmette KWF, et al. Clinical and pathological associations with allelic loss in colorectal carcinoma. JAMA 1989;261:3099-3103. [Erratum, JAMA 1989;262:1952.] [Abstract]
16. Offerhaus GJA, De Feyter EP, Cornelisse CJ, et al. The relationship of DNA aneuploidy to molecular genetic alterations in colorectal carcinoma. Gastroenterology 1992;102:1612-1619. [Medline]
17. Laurent-Puig P, Olschwang S, Delattre O, et al. Survival and acquired genetic alterations in colorectal cancer. Gastroenterology 1992;102:1136-1141. [Medline]
18. O'Connell MJ, Schaid DJ, Ganju V, Cunningham J, Kovach JS, Thibodeau SN. Current status of adjuvant chemotherapy for colorectal cancer: can molecular markers play a role in predicting prognosis? Cancer 1992;70:Suppl:1732-1739. [CrossRef][Medline]
19. Beckman JS, Weber JL. Survey of human and rat microsatellites. Genomics 1992;12:627-631. [CrossRef][Medline]
20. Saiki RK, Gelfand DH, Stoffel S, et al. Primer-directed enzymatic amplification of DNA with a thermostable DNA polymerase. Science 1988;239:487-491. [Free Full Text]
21. Louis DN, von Deimling A, Seizinger BR. A (CA)_n dinucleotide repeat assay for evaluating loss of allelic heterozygosity in small and archival human brain tumor specimens. Am J Pathol 1992;141:777-782. [Abstract]
22. NIH/CEPH Collaborative Mapping Group. A comprehensive genetic linkage map of the human genome. Science 1992;258:67-86. [Free Full Text]
23. Vasen HFA, Mecklin J-P, Kahn PM, Lynch HT. Hereditary non-polyposis colorectal cancer. Lancet 1991;338:877-877. 
24. Kim H, Jen J, Vogelstein B, Hamilton SR. Clinical and pathological characteristics of sporadic colorectal carcinomas with DNA replication errors in microsatellite sequences. Am J Pathol 1994;145:148-156. [Abstract]
25. Meltzer SJ, Yin J, Huang Y, et al. Reduction to homozygosity involving p53 in esophageal cancers demonstrated by the polymerase chain reaction. Proc Natl Acad Sci U S A 1991;88:4976-4980. [Free Full Text]
26. Shibata D, Hawes D, Li Z-H, Hernandez AM, Spruck CH, Nichols PW. Specific genetic analysis of microscopic tissue after selective ultraviolet radiation fractionation and the polymerase chain reaction. Am J Pathol 1992;141:539-543. [Abstract]
27. Goelz SE, Hamilton SR, Vogelstein B. Purification of DNA from formaldehyde fixed and paraffin embedded human tissue. Biochem Biophys Res Commun 1985;130:118-126. [CrossRef][Medline]
28. Weissenbach J, Gyapay G, Dib C, et al. A second-generation linkage map of the human genome. Nature 1992;359:794-801. [CrossRef][Medline]
29. Sidransky D, Tokino T, Hamilton SR, et al. Identification of ras oncogene mutations in the stool of patients with curable colorectal tumors. Science 1992;256:102-105. [Free Full Text]
30. Litt M, Hauge X, Sharma V. Shadow bands seen when typing polymorphic dinucleotide repeats: some causes and cures. Biotechniques 1993;15:280-284. [Medline]
31. Risinger JI, Boyd J. Dinucleotide repeat polymorphism in the human DCC gene at chromosome 18q21. Hum Mol Genet 1992;1:657-657. [Free Full Text]
32. Lathrop GM, Lalouel JM, Julier C, Ott J. Strategies for multilocus linkage analysis in humans. Proc Natl Acad Sci U S A 1984;81:3443-3446. [Free Full Text]
33. Hahn M, Serth J, Fislage R, et al. Polymerase chain reaction detection of a highly polymorphic VNTR segment in intron 1 of the human p53 gene. Clin Chem 1993;39:549-550. [Free Full Text]
34. Gruis NA, Abeln ECA, Bardoel AFJ, Devilee P, Frants RR, Cornelisse CJ. PCR-based microsatellite polymorphisms in the detection of loss of heterozygosity in fresh and archival tumour tissue. Br J Cancer 1993;68:308-313. [Medline]
35. Ionov Y, Peinado MA, Malkhosyan S, Shibata D, Perucho M. Ubiquitous somatic mutations in simple repeated sequences reveal a new mechanism for colonic carcinogenesis. Nature 1993;363:558-561. [CrossRef][Medline]
36. Thibodeau SN, Bren G, Schaid D. Microsatellite instability in cancer of the proximal colon. Science 1993;260:816-819. [Free Full Text]
37. Aaltonen LA, Peltomaki P, Leach FS, et al. Clues to the pathogenesis of familial colorectal cancer. Science 1993;260:812-816. [Free Full Text]
38. Peltomaki P, Lothe RA, Aaltonen LA, et al. Microsatellite instability is associated with tumors that characterize the hereditary non-polyposis colorectal carcinoma syndrome. Cancer Res 1993;53:5853-5855. [Free Full Text]
39. Vogelstein B, Fearon ER, Kern SE, et al. Allelotype of colorectal carcinomas. Science 1989;244:207-211. [Free Full Text]
40. Kaplan EL, Meier P. Nonparametric estimation from incomplete observations. J Am Stat Assoc 1958;53:457-81.
41. Mantel N, Haenszel W. Statistical aspects of the analysis of data from retrospective studies of disease. J Natl Cancer Inst 1959;22:719-748.
42. Cox DR. Regression models and life-tables. J R Stat Soc [B] 1972;34:187-220.
43. Jass JR, Mukawa K, Goh HS, Love SB, Capellaro D. Clinical importance of DNA content in rectal cancer measured by flow cytometry. J Clin Pathol 1989;42:254-259. [Free Full Text]
44. Ensley JF, Maciorowski Z, Hassan M, Pietraszkiewicz H, Sakr W, Heilbrun LK. Variations in DNA aneuploid cell content during tumor dissociation in human colon and head and neck cancers analyzed by flow cytometry. Cytometry 1993;14:550-558. [Medline]
45. Crissman JD, Zarbo RJ, Ma CK, Visscher DW. Histopathologic parameters and DNA analysis in colorectal adenocarcinomas. Pathol Annu 1989;24:103-147.
46. Finkelstein SD, Sayegh R, Bakker A, Swalsky P. Determination of tumor aggressiveness in colorectal cancer by K-ras-2 analysis. Arch Surg 1993;128:526-532. [Abstract]
47. Cohn KH, Wang F, DeSoto-LaPaix F, et al. Association of nm23-H1 allelic deletions with distant metastases in colorectal carcinoma. Lancet 1991;338:722-724. [CrossRef][Medline]
48. Bell SM, Scott N, Cross D, et al. Prognostic value of p53 overexpression and c-Ki-ras gene mutations in colorectal cancer. Gastroenterology 1993;104:57-64. [Medline]
49. Nigro JM, Baker SJ, Preisinger AC, et al. Mutations in the p53 gene occur in diverse human tumour types. Nature 1989;342:705-708. [CrossRef][Medline]
50. Harris CC, Hollstein M. Clinical implications of the p53 tumor-suppressor gene. N Engl J Med 1993;329:1318-1327. [Free Full Text]
51. Baas IO, Mulder J-WR, Offerhaus GJA, Vogelstein B, Hamilton SR. An evaluation of six antibodies for immunohistochemistry of mutant p53 gene product in archival colorectal neoplasms. J Pathol 1994;172:5-12. [CrossRef][Medline]
52. Remvikos Y, Tominaga O, Hammel P, et al. Increased p53 protein content of colorectal tumours correlates with poor survival. Br J Cancer 1992;66:758-764. [Medline]
53. Hamelin R, Laurent-Puig P, Olschwang S, et al. Association of p53 mutations with short survival in colorectal cancer. Gastroenterology 1994;106:42-48. [Medline]
54. Hedrick L, Cho KR, Vogelstein B. Cell adhesion molecules as tumour suppressors. Trends Cell Biol 1993;3:36-39.
55. Nigam AK, Savage FJ, Boulos PB, Stamp GWH, Liu D, Pignatelli M. Loss of cell-cell and cell-matrix adhesion molecules in colorectal cancer. Br J Cancer 1993;68:507-514. [Medline]
56. Wielenga VJ, Heider KH, Offerhaus GJ, et al. Expression of CD44 variant proteins in human colorectal cancer is related to tumor progression. Cancer Res 1993;53:4754-4756. [Free Full Text]
57. Zetter BR. Adhesion molecules in tumor metastasis. Semin Cancer Biol 1993;4:219-229. [Medline]

Abstract Letters Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

Related Letters:

Alleles Lost and Gained in Malignant Cells
Chen P.-J., Yeh S.-H., Chen D.-S., Burke H. B., Hamilton S. R., Jen J., Vogelstein B.
Extract | Full Text  
N Engl J Med 1994; 331:1591-1592, Dec 8, 1994. Correspondence

This article has been cited by other articles:

• Leopoldo, S., Lorena, B., Cinzia, A., Gabriella, D. C., Luciana, B. A., Renato, C., Antonio, M., Carlo, S., Cristina, P., Stefano, C., Maurizio, T., Luigi, R., Cesare, B. (2008). Two Subtypes of Mucinous Adenocarcinoma of The Colorectum: Clinicopathological and Genetic Features. Ann. Surg. Oncol. 15: 1429-1439 [Abstract] [Full Text]  
• Ota, D., Nelson, H. (2007). The Surgeon and Adjuvant Therapy for Stage II Colon Cancer. Ann. Surg. Oncol. 14: 272-273 [Full Text]  
• Bamias, A, Yu, Z, Weinberger, P., Markakis, S, Kowalski, D, Camp, R., Rimm, D., Dimopoulos, M., Psyrri, A (2006). Automated quantitative analysis of DCC tumor suppressor protein in ovarian cancer tissue microarray shows association with {beta}-catenin levels and outcome in patients with epithelial ovarian cancer. Ann Oncol 17: 1797-1802 [Abstract] [Full Text]  
• Locker, G. Y., Hamilton, S., Harris, J., Jessup, J. M., Kemeny, N., Macdonald, J. S., Somerfield, M. R., Hayes, D. F., Bast, R. C. Jr (2006). ASCO 2006 Update of Recommendations for the Use of Tumor Markers in Gastrointestinal Cancer. JCO 24: 5313-5327 [Abstract] [Full Text]  
• Paroder, V., Spencer, S. R., Paroder, M., Arango, D., Schwartz, S. Jr., Mariadason, J. M., Augenlicht, L. H., Eskandari, S., Carrasco, N. (2006). Na+/monocarboxylate transport (SMCT) protein expression correlates with survival in colon cancer: Molecular characterization of SMCT. Proc. Natl. Acad. Sci. USA 103: 7270-7275 [Abstract] [Full Text]  
• Adams, V. R. (2006). Evolving role of antineoplastic agents in colorectal cancer. Am J Health Syst Pharm 63: S4-S11 [Abstract] [Full Text]  
• Watanabe, T., Kanazawa, T., Kazama, Y., Tanaka, J., Tanaka, T., Ishihara, S., Nagawa, H. (2006). SMAD4 Levels and Allelic Imbalance in 18q21 in Colorectal Cancer. Clin. Cancer Res. 12: 1654-1654 [Full Text]  
• Arango, D., Alhopuro, P., Aaltonen, L. A. (2006). Reply to the Letter to the Editor by Watanabe et al.. Clin. Cancer Res. 12: 1654-1655 [Full Text]  
• Orita, H., Sakamoto, N., Ajioka, Y., Terai, T., Hino, O., Sato, N., Shimoda, T., Kamano, T., Tsurumaru, M., Fujii, H. (2006). Allelic loss analysis of early-stage flat-type colorectal tumors. Ann Oncol 17: 43-49 [Abstract] [Full Text]  
• Erill, N., Colomer, A., Calvo, M., Vidal, A., Roman, R., Verdu, M., Cordon-Cardo, C., Puig, X. (2005). A Novel Multiplexing, Polymerase Chain Reaction-Based Assay for the Analysis of Chromosome 18q Status in Colorectal Cancer. J. Mol. Diagn. 7: 478-485 [Abstract] [Full Text]  
• Alhopuro, P., Alazzouzi, H., Sammalkorpi, H., Davalos, V., Salovaara, R., Hemminki, A., Jarvinen, H., Mecklin, J.-P., Schwartz, S. Jr., Aaltonen, L. A., Arango, D. (2005). SMAD4 Levels and Response to 5-Fluorouracil in Colorectal Cancer. Clin. Cancer Res. 11: 6311-6316 [Abstract] [Full Text]  
• Baddi, L., Benson, A. III (2005). Adjuvant Therapy in Stage II Colon Cancer: Current Approaches. The Oncologist 10: 325-331 [Full Text]  
• Johnston, P. G. (2005). Stage II Colorectal Cancer: To Treat or not to Treat. The Oncologist 10: 332-334 [Full Text]  
• Kim, J., Takeuchi, H., Lam, S. T., Turner, R. R., Wang, H.-J., Kuo, C., Foshag, L., Bilchik, A. J., Hoon, D. S.B. (2005). Chemokine Receptor CXCR4 Expression in Colorectal Cancer Patients Increases the Risk for Recurrence and for Poor Survival. JCO 23: 2744-2753 [Abstract] [Full Text]  
• Alazzouzi, H., Alhopuro, P., Salovaara, R., Sammalkorpi, H., Jarvinen, H., Mecklin, J.-P., Hemminki, A., Schwartz, S. Jr., Aaltonen, L. A., Arango, D. (2005). SMAD4 as a Prognostic Marker in Colorectal Cancer. Clin. Cancer Res. 11: 2606-2611 [Abstract] [Full Text]  
• Aschele, C., Debernardis, D., Lonardi, S., Bandelloni, R., Casazza, S., Monfardini, S., Gallo, L. (2004). Deleted in Colon Cancer Protein Expression in Colorectal Cancer Metastases: A Major Predictor of Survival in Patients With Unresectable Metastatic Disease Receiving Palliative Fluorouracil-Based Chemotherapy. JCO 22: 3758-3765 [Abstract] [Full Text]  
• Zaniboni, A., Labianca, R. (2004). Adjuvant therapy for stage II colon cancer: an elephant in the living room?. Ann Oncol 15: 1310-1318 [Abstract] [Full Text]  
• Zauber, N P, Wang, C, Lee, P S, Redondo, T C, Bishop, D T, Goel, A (2004). Ki-ras gene mutations, LOH of the APC and DCC genes, and microsatellite instability in primary colorectal carcinoma are not associated with micrometastases in pericolonic lymph nodes or with patients' survival. J. Clin. Pathol. 57: 938-942 [Abstract] [Full Text]  
• Mehlen, P., Fearon, E. R. (2004). Role of the Dependence Receptor DCC in Colorectal Cancer Pathogenesis. JCO 22: 3420-3428 [Abstract] [Full Text]  
• Kambara, T., Sharp, G. B., Nagasaka, T., Takeda, M., Sasamoto, H., Nakagawa, H., Isozaki, H., MacPhee, D. G., Jass, J. R., Tanaka, N., Matsubara, N. (2004). Allelic Loss of a Common Microsatellite Marker MYCL1: A Useful Prognostic Factor of Poor Outcomes in Colorectal Cancer. Clin. Cancer Res. 10: 1758-1763 [Abstract] [Full Text]  
• Garcia, J M, Rodriguez, R, Dominguez, G, Silva, J M, Provencio, M, Silva, J, Colmenarejo, A, Millan, I, Munoz, C, Salas, C, Coca, S, Espana, P, Bonilla, F (2003). Prognostic significance of the allelic loss of the BRCA1 gene in colorectal cancer. Gut 52: 1756-1763 [Abstract] [Full Text]  
• Ward, R. L., Cheong, K., Ku, S.-L., Meagher, A., O'Connor, T., Hawkins, N. J. (2003). Adverse Prognostic Effect of Methylation in Colorectal Cancer Is Reversed by Microsatellite Instability. JCO 21: 3729-3736 [Abstract] [Full Text]  
• Graziano, F., Cascinu, S. (2003). Prognostic molecular markers for planning adjuvant chemotherapy trials in Dukes' B colorectal cancer patients: how much evidence is enough?. Ann Oncol 14: 1026-1038 [Abstract] [Full Text]  
• Ferenci, P (2003). How to identify the genetic basis of gastrointestinal and liver diseases?. Gut 52: ii6-9 [Abstract] [Full Text]  
• Diep, C. B., Thorstensen, L., Meling, G. I., Skovlund, E., Rognum, T. O., Lothe, R. A. (2003). Genetic Tumor Markers With Prognostic Impact in Dukes' Stages B and C Colorectal Cancer Patients. JCO 21: 820-829 [Abstract] [Full Text]  
• Choi, S.-W., Lee, K. J., Bae, Y.-A., Min, K.-O., Kwon, M.-S., Kim, K.-M., Rhyu, M.-G. (2002). Genetic Classification of Colorectal Cancer Based on Chromosomal Loss and Microsatellite Instability Predicts Survival. Clin. Cancer Res. 8: 2311-2322 [Abstract] [Full Text]  
• Wudel, L. J. Jr, Chapman, W. C., Shyr, Y., Davidson, M., Jeyakumar, A., Rogers, S. O. Jr, Allos, T., Stain, S. C. (2002). Disparate Outcomes in Patients With Colorectal Cancer: Effect of Race on Long-term Survival. Arch Surg 137: 550-556 [Abstract] [Full Text]  
• Bepler, G., Gautam, A., McIntyre, L. M., Beck, A. F., Chervinsky, D. S., Kim, Y.-C., Pitterle, D. M., Hyland, A. (2002). Prognostic Significance of Molecular Genetic Aberrations on Chromosome Segment 11p15.5 in Non-Small-Cell Lung Cancer. JCO 20: 1353-1360 [Abstract] [Full Text]  
• Shirota, Y., Stoehlmacher, J., Brabender, J., Xiong, Y.-P., Uetake, H., Danenberg, K. D., Groshen, S., Tsao-Wei, D. D., Danenberg, P. V., Lenz, H.-J. (2001). ERCC1 and Thymidylate Synthase mRNA Levels Predict Survival for Colorectal Cancer Patients Receiving Combination Oxaliplatin and Fluorouracil Chemotherapy. JCO 19: 4298-4304 [Abstract] [Full Text]  
• Houlston, R S (2001). What we could do now: molecular pathology of colorectal cancer. Mol. Pathol. 54: 206-214 [Abstract] [Full Text]  
• Dong, S. M., Traverso, G., Johnson, C., Geng, L., Favis, R., Boynton, K., Hibi, K., Goodman, S. N., D'Allessio, M., Paty, P., Hamilton, S. R., Sidransky, D., Barany, F., Levin, B., Shuber, A., Kinzler, K. W., Vogelstein, B., Jen, J. (2001). Detecting Colorectal Cancer in Stool With the Use of Multiple Genetic Targets. JNCI J Natl Cancer Inst 93: 858-865 [Abstract] [Full Text]  
• Sarela, A. I., Scott, N., Ramsdale, J., Markham, A. F., Guillou, P. J (2001). Immunohistochemical Detection of the Anti-Apoptosis Protein, Survivin, Predicts Survival After Curative Resection of Stage II Colorectal Carcinomas. Ann. Surg. Oncol. 8: 305-310 [Abstract] [Full Text]  
• Watanabe, T., Wu, T.-T., Catalano, P. J., Ueki, T., Satriano, R., Haller, D. G., Benson, A. B., Hamilton, S. R. (2001). Molecular Predictors of Survival after Adjuvant Chemotherapy for Colon Cancer. NEJM 344: 1196-1206 [Abstract] [Full Text]  
• Nishikawa, M., Nishiguchi, S., Shiomi, S., Tamori, A., Koh, N., Takeda, T., Kubo, S., Hirohashi, K., Kinoshita, H., Sato, E., Inoue, M. (2001). Somatic Mutation of Mitochondrial DNA in Cancerous and Noncancerous Liver Tissue in Individuals with Hepatocellular Carcinoma. Cancer Res. 61: 1843-1845 [Abstract] [Full Text]  
• Zhang, J., Fan, Z., Gao, Y., Xiao, Z., Li, C., An, Q., Cheng, S. (2001). Detecting Bladder Cancer in the Chinese by Microsatellite Analysis: Ethnic and Etiologic Considerations. JNCI J Natl Cancer Inst 93: 45-50 [Abstract] [Full Text]  
• Zhao, J., de Krijger, R. R., Meier, D., Speel, E.-J. M., Saremaslani, P., Muletta-Feurer, S., Matter, C., Roth, J., Heitz, P. U., Komminoth, P. (2000). Genomic Alterations in Well-Differentiated Gastrointestinal and Bronchial Neuroendocrine Tumors (Carcinoids) : Marked Differences Indicating Diversity in Molecular Pathogenesis. Am. J. Pathol. 157: 1431-1438 [Abstract] [Full Text]  
• SHAHRIER, M, AHNEN, D J (2000). Colorectal cancer survival in Europe: the Will Rogers phenomenon revisited. Gut 47: 463-464 [Full Text]  
• de Caestecker, M. P., Piek, E., Roberts, A. B. (2000). Role of Transforming Growth Factor-{beta} Signaling in Cancer. JNCI J Natl Cancer Inst 92: 1388-1402 [Abstract] [Full Text]  
• Takebayashi, S., Ogawa, T., Jung, K.-Y., Muallem, A., Mineta, H., Fisher, S. G., Grenman, R., Carey, T. E. (2000). Identification of New Minimally Lost Regions on 18q in Head and Neck Squamous Cell Carcinoma. Cancer Res. 60: 3397-3403 [Abstract] [Full Text]  
• Sarela, A I, Macadam, R C A, Farmery, S M, Markham, A F, Guillou, P J (2000). Expression of the antiapoptosis gene, Survivin, predicts death from recurrent colorectal carcinoma. Gut 46: 645-650 [Abstract] [Full Text]  
• JEN, J., WU, L., SIDRANSKY, D. (2000). An Overview on the Isolation and Analysis of Circulating Tumor DNA in Plasma and Serum. Ann. N. Y. Acad. Sci. 906: 8-12 [Full Text]  
• Yokota, J. (2000). Tumor progression and metastasis. Carcinogenesis 21: 497-503 [Abstract] [Full Text]  
• Berg, K. D., Glaser, C. L., Thompson, R. E., Hamilton, S. R., Griffin, C. A., Eshleman, J. R. (2000). Detection of Microsatellite Instability by Fluorescence Multiplex Polymerase Chain Reaction. J. Mol. Diagn. 2: 20-28 [Abstract] [Full Text]  
• Offit, K. (2000). Genetic Prognostic Markers for Colorectal Cancer. NEJM 342: 124-125 [Full Text]  
• Cagir, B., Gelmann, A., Park, J., Fava, T., Tankelevitch, A., Bittner, E. W., Weaver, E. J., Palazzo, J. P., Weinberg, D., Fry, R. D., Waldman, S. A. (1999). Guanylyl Cyclase C Messenger RNA Is a Biomarker for Recurrent Stage II Colorectal Cancer. ANN INTERN MED 131: 805-812 [Abstract] [Full Text]  
• Arribas, R., Ribas, M., Risques, R.-A., Masramon, L., Tortola, S., Marcuello, E., Aiza, G., Miro, R., Capella, G., Peinado, M. A. (1999). Prospective Assessment of Allelic Losses at 4p14-16 in Colorectal Cancer: Two Mutational Patterns and a Locus Associated with Poorer Survival. Clin. Cancer Res. 5: 3454-3459 [Abstract] [Full Text]  
• Halling, K. C., French, A. J., McDonnell, S. K., Burgart, L. J., Schaid, D. J., Peterson, B. J., Moon-Tasson, L., Mahoney, M. R., Sargent, D. J., O'Connell, M. J., Witzig, T. E., Farr, G. H. Jr., Goldberg, R. M., Thibodeau, S. N. (1999). Microsatellite Instability and 8p Allelic Imbalance in Stage B2 and C Colorectal Cancers. JNCI J Natl Cancer Inst 91: 1295-1303 [Abstract] [Full Text]  
• Lanza, G., Gafa, R., Matteuzzi, M., Santini, A. (1999). Medullary-Type Poorly Differentiated Adenocarcinoma of the Large Bowel: A Distinct Clinicopathologic Entity Characterized by Microsatellite Instability and Improved Survival. JCO 17: 2429-2429 [Abstract] [Full Text]  
• Liu, L U, Holt, P R, Krivosheyev, V, Moss, S F (1999). Human right and left colon differ in epithelial cell apoptosis and in expression of Bak, a pro-apoptotic Bcl-2 homologue. Gut 45: 45-50 [Abstract] [Full Text]  
• Sun, X.-F., Rutten, S., Zhang, H., Nordenskjold, B. (1999). Expression of the Deleted in Colorectal Cancer Gene Is Related to Prognosis in DNA Diploid and Low Proliferative Colorectal Adenocarcinoma. JCO 17: 1745-1745 [Abstract] [Full Text]  
• Rashid, A, Zahurak, M, Goodman, S N, Hamilton, S R (1999). Genetic epidemiology of mutated K-ras proto-oncogene, altered suppressor genes, and microsatellite instability in colorectal adenomas. Gut 44: 826-833 [Abstract] [Full Text]  
• Willenbucher, R. F., Aust, D. E., Chang, C. G., Zelman, S. J., Ferrell, L. D., Moore, D. H. II, Waldman, F. M. (1999). Genomic Instability Is an Early Event during the Progression Pathway of Ulcerative-Colitis-Related Neoplasia. Am. J. Pathol. 154: 1825-1830 [Abstract] [Full Text]  
• Mamounas, E., Wieand, S., Wolmark, N., Bear, H. D., Atkins, J. N., Song, K., Jones, J., Rockette, H. (1999). Comparative Efficacy of Adjuvant Chemotherapy in Patients With Dukes' B Versus Dukes' C Colon Cancer: Results From Four National Surgical Adjuvant Breast and Bowel Project Adjuvant Studies (C-01, C-02, C-03, and C-04). JCO 17: 1349-1349 [Abstract] [Full Text]  
• Paulson, T. G., Galipeau, P. C., Reid, B. J. (1999). Loss of Heterozygosity Analysis Using Whole Genome Amplification, Cell Sorting, and Fluorescence-Based PCR. Genome Res. 9: 482-491 [Abstract] [Full Text]  
• Fujiwara, Y., Chi, D. D. J., Wang, H., Keleman, P., Morton, D. L., Turner, R., Hoon, D. S. B. (1999). Plasma DNA Microsatellites as Tumor-specific Markers and Indicators of Tumor Progression in Melanoma Patients. Cancer Res. 59: 1567-1571 [Abstract] [Full Text]  
• Mueller, J. D., Haegle, N., Keller, G., Mueller, E., Saretzky, G., Bethke, B., Stolte, M., Hofler, H. (1998). Loss of Heterozygosity and Microsatellite Instability in De Novo versus Ex-Adenoma Carcinomas of the Colorectum. Am. J. Pathol. 153: 1977-1984 [Abstract] [Full Text]  
• Fujiwara, T., Stolker, J. M., Watanabe, T., Rashid, A., Longo, P., Eshleman, J. R., Booker, S., Lynch, H. T., Jass, J. R., Green, J. S., Kim, H., Jen, J., Vogelstein, B., Hamilton, S. R. (1998). Accumulated Clonal Genetic Alterations in Familial and Sporadic Colorectal Carcinomas with Widespread Instability in Microsatellite Sequences. Am. J. Pathol. 153: 1063-1078 [Abstract] [Full Text]  
• Liefers, G.-J., Cleton-Jansen, A.-M., van de Velde, C. J.H., Hermans, J., van Krieken, J. H.J.M., Cornelisse, C. J., Tollenaar, R. A.E.M. (1998). Micrometastases and Survival in Stage II Colorectal Cancer. NEJM 339: 223-228 [Abstract] [Full Text]  
• Caldas, C. (1998). Science, medicine, and the future: Molecular assessment of cancer. BMJ 316: 1360-1363 [Full Text]  
• Shibata, D., Reale, M. A., Lavin, P., Silverman, M., Fearon, E. R., Steele, G., Jessup, J. M., Loda, M., Summerhayes, I. C. (1996). The DCC Protein and Prognosis in Colorectal Cancer. NEJM 335: 1727-1732 [Abstract] [Full Text]  
• Parsons, R, Li, G., Longley, M, Modrich, P, Liu, B, Berk, T, Hamilton, SR, Kinzler, K., Vogelstein, B (1995). Mismatch repair deficiency in phenotypically normal human cells. Science 268: 738-740 [Abstract]  
• Hamilton, S. R., Liu, B., Parsons, R. E., Papadopoulos, N., Jen, J., Powell, S. M., Krush, A. J., Berk, T., Cohen, Z., Tetu, B., Burger, P. C., Wood, P. A., Taqi, F., Booker, S. V., Petersen, G. M., Offerhaus, G. J. A., Tersmette, A. C., Giardiello, F. M., Vogelstein, B., Kinzler, K. W. (1995). The Molecular Basis of Turcot's Syndrome. NEJM 332: 839-847 [Abstract] [Full Text]  
• Toribara, N. W., Sleisenger, M. H. (1995). Screening for Colorectal Cancer. NEJM 332: 861-867 [Full Text]  
• Forgacs, I. (1995). Recent Advances: Clinical gastroenterology. BMJ 310: 113-116 [Full Text]  
• Chen, P.-J., Yeh, S.-H., Chen, D.-S., Burke, H. B., Hamilton, S. R., Jen, J., Vogelstein, B. (1994). Alleles Lost and Gained in Malignant Cells. NEJM 331: 1591-1592 [Full Text]  
• (1994). GENETIC MARKERS AND PROGNOSIS OF COLORECTAL CANCER. JWatch General 1994: 4-4 [Full Text]  
• Tempero, M., Anderson, J. (1994). Progress in Colon Cancer -- Do Molecular Markers Matter?. NEJM 331: 267-268 [Full Text]