The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
Original Article
PreviousPrevious
Volume 331:294-299 August 4, 1994 Number 5
NextNext

The Ewing Family of Tumors -- A Subgroup of Small-Round-Cell Tumors Defined by Specific Chimeric Transcripts
Olivier Delattre, Jessica Zucman, Thomas Melot, Xavier Sastre Garau, Jean-Michel Zucker, Gilbert M. Lenoir, Peter F. Ambros, Denise Sheer, Claude Turc-Carel, Timothy J. Triche, Alain Aurias, and Gilles Thomas

 

This Article
-Abstract

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation
ABSTRACT

Background Precise diagnosis of small-round-cell tumors is often a challenge to the pathologist and the clinical oncologist. In Ewing's sarcomas and related peripheral primitive neuroectodermal tumors, a t(11;22) translocation or a (21,22) rearrangement is associated with hybrid transcripts of the EWS gene with the FLI1 or ERG gene. To investigate the diagnostic implication of this observation, we searched for these hybrid transcripts in tumors from patients with clinical and radiologic features of Ewing's sarcoma or peripheral primitive neuroectodermal tumors.

Methods Samples of RNA from 114 tumors were reverse transcribed and subjected to the polymerase chain reaction with primers designed to amplify the relevant chimeric transcripts. All amplified products were sequenced.

Results In-frame hybrid transcripts were observed in 89 cases. A hybrid transcript was found in 83 of 87 cases (95 percent) of Ewing's sarcoma or peripheral primitive neuroectodermal tumors. Samples of RNA from all of 12 tumors that had been proved to be other than Ewing's sarcoma or neuroectodermal tumors had no hybrid transcript. However, 6 of 15 undifferentiated tumors whose type was ambiguous (nonsecreting, poorly differentiated neuroblastoma or undifferentiated sarcoma) contained a hybrid transcript, suggesting that they might have to be reclassified.

Conclusions A subgroup of small-round-cell tumors identified as belonging to the Ewing family of tumors can be defined according to a specific molecular genetic lesion that is detectable by a rapid, reliable, and efficient method. This approach can be applied to small specimens obtained by fine-needle biopsies.


Ewing's sarcoma,1 the second most common malignant bone tumor of children and young adults, is an aggressive osteolytic tumor with a marked propensity for dissemination. Accurate and rapid diagnosis is essential for clinical management, but classification of the neoplasm can be difficult because the microscopical appearance of the tumor is not specific. Ewing's sarcoma belongs to the heterogeneous group of small-round-cell tumors2. The tumor cells are uniformly bland and undifferentiated, with a surprisingly low mitotic index given the rapid growth observed clinically. The presence of large amounts of intracellular glycogen is not a specific finding, since up to 35 percent of Ewing's sarcomas do not contain detectable glycogen, whereas many other childhood tumors do contain it3. The MIC2p30-32 antigen, a membrane protein of unknown function, is a promising new marker4,5,6. However, its presence in several unrelated types of tumors limits its reliability4,5,6,7. The balanced t(11;22)(q24;q12) chromosome translocation,8,9 which occurs in 83 percent of cases of Ewing's sarcoma, is a genotypic marker10. However, cytogenetic analysis is technically difficult, and the results are often obtained too late to influence therapy.

Ewing's sarcoma has phenotypic traits, including a high level of expression of the MIC2p30-32 antigen,4,5,6,7,11 that overlap those of a diverse group of primitive neuroectodermal tumors occurring outside the central nervous system12,13,14. These tumors and Ewing's sarcoma have the same t(11;22) chromosomal translocation15. Different terms have been used to designate these tumors, depending on their location and extent of neural differentiation: peripheral neuroepithelioma, Askin tumor, adult neuroblastoma, peripheral neuroblastoma, and primitive neuroectodermal tumor2,15,16,17. The collective term for these tumors is "peripheral primitive neuroectodermal tumors"18. Together with Ewing's sarcoma, they form the Ewing family of tumors2,18. However, this family is poorly defined, since none of the phenotypic markers can fully discriminate these tumors from other small-round-cell tumors and since the cytogenetically characteristic t(11;22) translocation may be absent from almost 20 percent of cases10,19.

The recent characterization of the EWSR1 and EWSR2 regions of chromosomes 22 and 11, respectively, where translocation breakpoints have been mapped,20 has revealed a molecular abnormality that may be fundamental in Ewing's sarcoma and related tumors. The translocation results in the expression of an aberrant hybrid protein in which the N-terminal part of the EWS protein is linked to the DNA binding domain (Ets domain) of the FLI1 transcription factor21. This hybrid protein may alter the transcriptional regulation of as-yet-unidentified target genes. In a small subgroup of tumors EWS, instead of joining the FLI1 gene, fuses with ERG, a member of the Ets family of transcription factors closely related to FLI122. The chimeric protein resulting from the fusion of EWS with ERG is structurally similar to the typical EWS-FLI1 protein in that the N-terminal portion of EWS is linked to the Ets domain of ERG.

The presence of these fusion genes might be the defining criterion for the Ewing family of tumors.

In this paper we report our search for transcripts of the fused genes in neoplasms belonging to the Ewing family of tumors. For this purpose we amplified complementary DNA from tumor-derived messenger RNA by the polymerase chain reaction (PCR). This method of detecting fusion transcripts has promise as a rapid, specific, and sensitive diagnostic test for the Ewing family of tumors.

Methods

Patients and Tumors

Over a period of 10 years, 114 tumor samples were collected at the time of biopsy from patients whose clinical and radiologic findings supported a diagnosis of either typical or atypical Ewing's sarcoma or peripheral primitive neuroectodermal tumor. The median age at diagnosis was 13 years (range, 1 to 48). Part of each sample was used for histologic and immunohistochemical characterization. Another part was immediately frozen in liquid nitrogen. Permanent cell lines were established for 22 tumors.

Tumors were classified in five groups on the basis of the clinical, radiologic, and pathological data. Group 1 consisted of osseous Ewing's sarcomas: these were osteolytic bone tumors composed of typical bland, periodic-acid-Schiff (PAS)-positive undifferentiated cells with the almost complete absence of intercellular fibers. Group 2 was composed of atypical Ewing's sarcomas (e.g., tumors that lacked one of the features found in the tumors in group 1); it included extraskeletal Ewing's sarcoma and Ewing's sarcoma tumors with atypical morphologic features such as large cells23 or negative PAS staining. Group 3 consisted of peripheral primitive neuroectodermal tumors that had two or more definite features of neural differentiation17. Group 4 contained tumors clearly excluded from the Ewing family of tumors on the basis of their morphologic features or immunophenotypes (or both). Group 5 tumors were small-round-cell tumors for which a definite diagnosis could not be made.

Detection of Hybrid Transcripts

Total RNA was isolated from tumors with the RNAzol extraction kit (Bioprobe Systems, Montreuil-sous-Bois, France). One µg of total RNA was reverse transcribed with oligonucleotide 11A,22 oligonucleotide ErgA (5'TGAGGGGTACTTGTACAGA3'), or oligodeoxythymidine with use of the Gene Amp RNA PCR kit (Cetus, Norwalk, Conn.). The resulting samples of complementary DNA were amplified by PCR with primers 11.11,22 Erg 11 (5'TGTTGGGTTTGCTCTTCCGCTC3'), and 22.822. Thirty cycles were performed; each cycle consisted of denaturation at 94 °C for 30 seconds, annealing at 68 °C for 1 minute, and elongation at 72 °C for 1 minute. As an internal control for amplification, the ubiquitous EWS transcript was sought with primers 22.8 and 22.4 (5'GGGCCGATCTCTGCGCTCCT3') under identical PCR conditions. The products of amplification were analyzed by electrophoresis on 1.2 percent agarose gel. The amplified fragments were purified on Centricon 100 ultrafiltration devices (Amicon, Epernon, France), and direct sequencing was performed with a Taq polymerase kit (Prism, Applied Biosystems, Foster City, Calif.) with fluorescent primers or dideoxynucleotides. Sequencing reactions were analyzed with an Applied Biosystems model 373A automatic sequencer. Northern and Southern blotting was performed according to standard procedures,24 with probes previously described20,22,25.

Results

Types of Fusion Transcripts

From 1984 to 1993, 114 tumor samples were obtained from patients whose clinical and radiologic data were compatible with a diagnosis of Ewing's sarcoma or related tumors. Pathological examination revealed 60 osseous Ewing's sarcomas, 14 atypical Ewing's sarcomas (PAS-negative, 3 cases; extraskeletal, 9 cases; unusual large-cell morphology, 2 cases), 13 peripheral primitive neuroectodermal tumors, 12 tumors subsequently shown not to belong to the Ewing family of tumors, and 15 tumors lacking hallmarks of a specific disease.

RNA was extracted from these samples and analyzed for hybrid transcripts in which EWS was linked to either FLI1 or ERG. The principle of the method is represented in Figure 1. Samples of complementary DNA obtained by reverse transcription of tumor RNA were amplified by PCR with the primers 22.8 and 11.11, which are homologous to the coding regions of EWS (22.8) and FLI1 (11.11). These primers promote amplification only if their targeted regions are physically linked -- i.e., only if the tumor RNA contains an EWS-FLI1 hybrid transcript. A similar approach was used to detect EWS-ERG hybrid transcripts with primers 22.8 and Erg11. For each tumor RNA sample, a control amplification was performed with primers 22.8 and 22.4; these two primers allow amplification of the consistently expressed normal EWS gene.


View larger version (63K):
[in this window]
[in a new window]
 
Figure 1. Detection of a Chimeric Transcript by Reverse Transcription Followed by PCR.

The normal EWS gene on chromosome 22, the normal FLI1 gene on chromosome 11, and the chimeric EWS-FLI1 gene on the der(22) rearrangement generated by the t(11;22) translocation are shown schematically, with their corresponding transcripts. The exons of EWS and FLI1 are represented by solid and open boxes, respectively. EWSR1 and EWSR2 denote the regions on chromosomes 22 and 11 where all chromosome breakpoints have been mapped22. The dashed lines represent the most frequent positions of the breakpoints and their joining on the der(22) chromosome to generate a chimeric EWS-FLI1 gene that will produce a type 1 transcript21,22. The primers used to amplify the fusion transcript and the normal EWS transcript are indicated by arrows. Primers 22.8 and 22.4 allow amplification of the normal EWS transcript; this amplification is used as an internal control. Primer 11.11 does not allow amplification unless a hybrid transcript is generated by the translocation. In this case, together with primer 22.8, it promotes the amplification of the junction region.

 
A hybrid transcript was detected in 89 tumors (Figure 2 and Table 1). The corresponding amplified products were sequenced, revealing in all cases a junction of EWS and FLI1 coding sequences or EWS and ERG coding sequences. Altogether, 78 tumors contained an EWS-FLI1 fusion transcript and 11 tumors had an EWS-ERG fusion transcript.


View larger version (17K):
[in this window]
[in a new window]
 
Figure 2. Gel Electrophoresis of PCR-Amplified RNA from Tumors of 15 Patients with Ewing's Sarcoma or Peripheral Primitive Neuroectodermal Tumor.

Each case number denotes a patient's tumor, SKNBE the SKNBE neuroblastoma cell line, HeLa the HeLa cell line, and Con a control amplification without RNA. Size markers are indicated at right (bp denotes base pairs).

The upper panel shows the internal controls for the amplification of part of the EWS transcript with primers 22.4 and 22.8 (Figure 1). The lower panel shows the EWS-FLI1 fusion transcripts amplified with primers 22.8 and 11.11 (Figure 1) and the EWS-ERG fusion transcripts amplified with primers 22.8 and Erg11. To ensure the absence of amplification products in case 122 and in control RNA samples, the gel was subjected to Southern blotting and probed with an internal primer (data not shown).

 
View this table:
[in this window]
[in a new window]
 
Table 1. Hybrid Transcripts Detected in Tumors with Initial Presentations Compatible with Ewing's Sarcoma or a Peripheral Primitive Neuroectodermal Tumor.

 
The most prevalent junctions were of the previously described type 1 and type 2 junctions that result from linkage of EWS exon 7 to FLI1 exon 6 (type 1) or 5 (type 2). Seven other types of junction were found for EWS-FLI122; they corresponded to various combinations that join EWS exons 7 to 10 with FLI1 exons 4 to 8 (Table 1). Four different EWS-ERG junctions were found. In all cases in which neither the EWS-FLI1 transcript nor the EWS-ERG transcript was detected, internal controls were positive, indicating that the lack of amplified product was not due to failure of the technique (Figure 2).

Fusion Transcript in Ewing's Sarcoma and Peripheral Primitive Neuroectodermal Tumors

A fusion transcript was demonstrated in 97 percent of the osseous Ewing's sarcomas (58 of the 60 tumors in group 1) (Table 1). Reexamination of one of the two tumors without a transcript (case 163) revealed unusual features. In contrast to the strong immunostaining for the MIC2 antigen observed in all the tumors of group 1 that had a fusion transcript, there was no MIC2 immunostaining in this tumor. Furthermore, independent pathological reevaluation of this tumor suggested a diagnosis of alveolar rhabdomyosarcoma. Retrospective characterization of the second tumor (case 145) was not possible.

Fusion transcripts were observed in 93 percent (25 of 27 cases) of the cases for which the diagnosis was atypical Ewing's sarcoma or peripheral primitive neuroectodermal tumors (groups 2 and 3). One of the tumors without a fusion transcript (case 74) originated from the gluteal region, had the morphologic features of a small-round-cell tumor, stained positive for PAS and MIC2, and stained negative for several neuroendocrine markers (Table 2). Cytogenetic analysis showed the karyotype 48,XY,del(1) (p34),+6,+12 with cytogenetically normal pairs of chromosomes 22, 21, and 11. The other tumor without a fusion transcript (case 122) had developed in an extraskeletal location within the chest of a one-year-old child. It had typical small-round-cell morphologic features but a prominent extracellular matrix. It stained slightly positive for PAS and slightly positive for MIC2. Apart from vimentin, all other tested markers were negative (Table 2). Cytogenetic analysis revealed a t(1;22)(p36;q12) translocation, which led the pathologists to propose a diagnosis of Askin tumor with variant translocation. Southern blot analysis of DNA from two tumors (cases 74 and 122) failed to demonstrate rearranged EWSR1. Furthermore, Northern blot analysis of both tumors did not reveal abnormal transcripts of EWS, FLI1, or ERG, strongly suggesting that in these tumors, none of these genes were affected by structural rearrangements.

View this table:
[in this window]
[in a new window]
 
Table 2. Tumors Phenotypically Compatible with a Diagnosis of Ewing's Sarcoma or a Peripheral Primitive Neuroectodermal Tumor, with No Fusion Transcript.

 
Fusion Transcripts in Other Tumors

In 12 tumors a diagnosis other than Ewing's sarcoma or peripheral primitive neuroectodermal tumors (group 4) was firmly established. None of the 12 tumors had a detectable fusion transcript (Table 1).

The 15 tumors in the last category (group 5) were difficult to classify. They did not fulfill the criteria for Ewing's sarcoma or peripheral primitive neuroectodermal tumors, and other tests did not indicate a specific diagnosis. The clinical, radiologic, and histopathological data led to a diagnosis of poorly differentiated, catechol-negative, metaiodobenzylguanidine-negative neuroblastomas in 4 cases and of undifferentiated sarcoma in the other 11 cases (Table 1).

All four cases of apparent neuroblastoma were reevaluated at the time of relapse. The reevaluation of two cases did not reveal a fusion transcript. In one of these two cases, in which the tumor was MIC2-negative, the diagnostic impression of neuroblastoma was confirmed. In the other case, the diagnosis was changed to extrarenal rhabdoid tumor; the data on the tumor's status for MIC2 were not available. The other two tumors contained a fusion transcript. Their strong staining for MIC2 reinforced the opinion that the initial diagnosis was incorrect. This impression was strengthened in one case by the cytogenetic demonstration of the presence of a t(14;22)(q32;q12) translocation. As a control measure, 20 typical neuroblastomas (positive for metaiodobenzylguanidine and catechol) obtained independently from patients other than those in this series were analyzed; none of them contained a fusion transcript (data not shown).

Finally, 4 of the 11 tumors diagnosed as undifferentiated sarcomas contained a fusion transcript. All four tumors were reanalyzed for MIC2 expression. Three tumors were strongly positive for MIC2, and one was weakly positive (Table 3). This last tumor had a complex, although suggestive, t(11;11;22) translocation.

View this table:
[in this window]
[in a new window]
 
Table 3. Characteristics of Undifferentiated Sarcomas.

 
Correlation with Karyotype and Tumor Phenotype

Cytogenetic data were available for 40 tumors (Table 4). As expected, all 23 tumors with typical t(11;22) translocations had EWS-FLI1 transcripts. Of the nine tumors with complex or variant translocations, seven had EWS-FLI1 transcripts and one an EWS-ERG transcript. One tumor (case 122) with a t(1;22)(p36;q12) translocation had no abnormalities of the EWS, FLI1, or ERG gene, thus suggesting that this translocation might have provided an erroneous diagnostic clue. Finally, six of eight tumors with no cytogenetic evidence of structural rearrangement of chromosome 22, 11, or 21 had either an EWS-ERG hybrid transcript (four tumors) or an EWS-FLI1 transcript (two tumors).

View this table:
[in this window]
[in a new window]
 
Table 4. Correlation of Molecular Data with Cytogenetic Findings.

 
With respect to the group of tumors with fusion transcripts, we did not observe obvious phenotypic differences that could be related to specific EWS-FLI1 or EWS-ERG transcripts.

Discussion

Almost all tumors in this series that were diagnosed as osseous Ewing's sarcomas, atypical Ewing's sarcomas, or peripheral primitive neuroectodermal tumors contained EWS-FLI1 or EWS-ERG fusion transcripts. Only 4 of 87 tumors could not be shown to have fusion transcripts, but the 3 tumors without transcripts that could be reevaluated had unusual features (Table 2). Thus, to date, no confirmed, fully typical Ewing's sarcoma or peripheral primitive neuroectodermal tumor has been shown to lack an EWS-FLI1 or an EWS-ERG fusion transcript.

The diagnosis of Ewing's sarcoma is often difficult. It is frequently suggested on the basis of clinical and radiologic information. Pathological data, including the strong clue provided by MIC2 staining, corroborate or exclude the diagnosis in the majority of cases2,14,17,18. However, other possible diagnoses may not be conclusively eliminated by these methods. The cytogenetic demonstration of a t(11;22)(q24;q12) translocation in the tumor cells also favors the diagnosis of Ewing's sarcoma or peripheral primitive neuroectodermal tumor. However, technical constraints and variant translocations that can make interpretation unreliable counterbalance the high specificity of this karyotypic anomaly. Furthermore, as shown here, close to 15 percent of the tumors have fusion transcripts despite the presence of apparently normal pairs of chromosomes 11, 21, and 22.

Our results show that reverse transcription followed by PCR can detect the molecular characteristics of a specific genetic alteration in this family of tumors. Therefore, we propose that the Ewing family of tumors should be redefined as the group of tumors that possesses a fusion transcript involving the EWS-FLI1 or EWS-ERG genes. The analysis can be performed on small samples obtained by minimally invasive biopsies, even if the samples are contaminated by stromal cells. Processing the samples is simple, and the result is available in less than 24 hours. The PCR method can thus be highly advantageous as a diagnostic tool. The presence of fusion transcripts should permit accurate and reproducible separation of the Ewing family from phenotypically similar groups of tumors. Indeed, this study demonstrates that the classic diagnostic problem of distinguishing Ewing's sarcoma from neuroblastoma and sarcoma is readily resolved by molecular analysis.

Although these fusion transcripts vary in their exon composition, the deduced encoded protein products have constant features. The N-terminal domain of EWS and either of the nearly identical Ets domains of FLI1 or ERG are always preserved and linked together. This observation, added to the apparent lack of an association between a specific phenotypic trait of the tumor and a particular hybrid transcript, suggests that the various chimeric proteins may possess subtle functional differences, if any. Therefore, the members of the Ewing family of tumors should arise through a similar tumorigenic process.

The variety of tumor-specific genetic alterations among other small-round-cell tumors (rhabdomyosarcoma, neuroblastoma, and lymphoma) raises the possibility of genotypic diagnosis of them as well. The recent identification of a chimeric gene between PAX3 and FKHR in alveolar rhabdomyosarcoma,26 the result of a t(2;13)(q24;q14) chromosome translocation,27 indicates that a comparable approach using reverse transcription followed by PCR is also feasible here. The specific genetic alterations of the short arm of chromosome 1 and the amplification of the N-myc gene in neuroblastomas28 can also be detected by specific genotypic methods, as can the immunoglobulin or T-cell-receptor gene rearrangements and chromosome translocations in lymphomas29. It is thus now possible to distinguish each member of the group of small-round-cell tumors according to genotype. The extreme specificity and sensitivity of the PCR technique may make some of these genetic markers ideal for detecting minimal metastases and residual tumor cells in biologic samples.

Supported by grants from the Ligue Nationale contre le Cancer, the European Community Commissions, the Ministere de la Recherche et de l'Enseignement Superieur, the Association pour la Recherche sur le Cancer, and the Comite Departemental de l'Yonne de la Ligue Nationale contre le Cancer.

We are indebted to the following clinicians and pathologists for providing tumor samples: C. Bailly, C. Biggs, E. Bouffet, A. Brizard, L. Brugieres, J.-M. Coindre, V. Combaret, F. Doz, J. Dubousset, F. Jaubert, A. Jouvet, H. Krichen, J. Landman, J. Lemerle, M. Malone, J. Michon, O. Oberlin, T. Phillip, P. Pouillart, J. Pritchard, E. Quintana, P. Validire, P. Vielh, and A. Zoubek.


Source Information

From the Laboratoire de Genetique des Tumeurs, INSERM Contrat Jeune Formation, Paris 9201 (O.D., J.Z., T.M., A.A., G.T.); Service d'Oncologie Pediatrique (J.-M.Z.) and Service d'Anatomopathologie (X.S.G.), Institut Curie, Paris; the Department of Pathology and Laboratory Medicine, Childrens Hospital, Los Angeles (T.J.T.); the Human Cytogenetics Laboratory, Imperial Cancer Research Fund, London (D.S.); Laboratoire de Cytogenetique Cancerologique, Centre National de la Recherche Scientifique Unite de Recherche Associee 1462, Nice, France (C.T.-C.); the Children's Cancer Research Institute, St. Anna Kinderspital, Vienna, Austria (P.F.A.); and the International Agency for Research on Cancer, Lyon, France (G.M.L.).

Address reprint requests to Dr. Thomas at the Laboratoire de Genetique des Tumeurs, Institut Curie, 26 rue d'Ulm, 75231 Paris CEDEX 05, France.

References

  1. Ewing J. Diffuse endothelioma of bone. Proc N Y Pathol Soc 1921;21:17-24. 
  2. Triche TJ. Pathology of pediatric malignancies. In: Pizzo PA, Poplack DG, eds. Principles and practice of pediatric oncology. 2nd ed. Philadelphia: J.B. Lippincott, 1993:115-52.
  3. Kissane JM, Askin FB, Foulkes M, Stratton LB, Shirley SF. Ewing's sarcoma of bone: clinicopathologic aspects of 303 cases from the Intergroup Ewing's Sarcoma Study. Hum Pathol 1983;14:773-779. [Medline]
  4. Ambros IM, Ambros PF, Strehl S, Kovar H, Gadner H, Salzer-Kuntschik M. MIC2 is a specific marker for Ewing's sarcoma and peripheral primitive neuroectodermal tumors. Cancer 1991;67:1886-1893. [CrossRef][Medline]
  5. Fellinger EJ, Garin-Chesa P, Triche TJ, Huvos AG, Rettig WJ. Immunohistochemical analysis of Ewing's sarcoma cell surface antigen p30/32MIC2. Am J Pathol 1991;139:317-325. [Abstract]
  6. Hamilton G, Fellinger EJ, Schratter I, Fritsch A. Characterization of a human endocrine tissue and tumor-associated Ewing's sarcoma antigen. Cancer Res 1988;48:6127-6131. [Free Full Text]
  7. Kovar H, Dworzak M, Strehl S, et al. Overexpression of the pseudoautosomal gene MIC2 in Ewing's sarcoma and peripheral primitive neuroectodermal tumor. Oncogene 1990;5:1067-1070. [Medline]
  8. Aurias A, Rimbaut C, Buffe D, Dubousset J, Mazabraud A. Chromosomal translocations in Ewing's sarcoma. N Engl J Med 1983;309:496-497. [Medline]
  9. Turc-Carel C, Philip I, Berger M-P, Philip T, Lenoir GM. Chromosomal translocations in Ewing's sarcoma. N Engl J Med 1983;309:497-498. 
  10. Turc-Carel C, Aurias A, Mugneret F, et al. Chromosomes in Ewing's sarcoma. I. An evaluation of 85 cases and remarkable consistency of t(11;22)(q24;q12). Cancer Genet Cytogenet 1988;32:229-238. [CrossRef][Medline]
  11. Pappo AS, Douglass EC, Meyer WH, Marina N, Parham DM. Use of HBA 71 and anti-{beta}2-microglobulin to distinguish peripheral neuroepithelioma from neuroblastoma. Hum Pathol 1993;24:880-885. [CrossRef][Medline]
  12. Lipinski M, Braham K, Philip I, et al. Neuroectoderm-associated antigens on Ewing's sarcoma cell lines. Cancer Res 1987;47:183-187. [Free Full Text]
  13. Noguera R, Triche TJ, Navarro S, Tsokos M, Lombart-Bosch A. Dynamic model of differentiation in Ewing's sarcoma cells: comparative analysis of morphologic, immunocytochemical, and oncogene expression parameters. Lab Invest 1992;66:143-151. [Medline]
  14. Cavazzana AO, Miser JS, Jefferson J, Triche TJ. Experimental evidence for a neural origin of Ewing's sarcoma of bone. Am J Pathol 1987;127:507-518. [Abstract]
  15. Whang-Peng J, Triche TJ, Knutsen T, Miser J, Douglass EC, Israel MA. Chromosome translocation in peripheral neuroepithelioma. N Engl J Med 1984;311:584-585. [Medline]
  16. Askin FB, Rosai J, Sibley RK, Dehner LP, McAlister WH. Malignant small cell tumor of the thoracopulmonary region in childhood: a distinctive clinicopathologic entity of uncertain histogenesis. Cancer 1979;43:2438-2451. [CrossRef][Medline]
  17. Dehner LP. Primitive neuroectodermal tumor and Ewing's sarcoma. Am J Surg Pathol 1993;17:1-13. [Medline]
  18. Horowitz ME, Malawer MM, Delaney TF, Tsokos MG. Ewing's sarcoma family of tumors: Ewing's sarcoma of bone and soft tissue and the peripheral primitive neuroectodermal tumors. In: Pizzo PA, Poplack DG, eds. Principles and practice of pediatric oncology. 2nd ed. Philadelphia: J.B. Lippincott, 1993:795-821.
  19. Gorman PA, Malone M, Pritchard J, Sheer D. Cytogenetic analysis of primitive neuroectodermal tumors: absence of the t(11;22) in two of three cases and a review of the literature. Cancer Genet Cytogenet 1991;51:13-22. [CrossRef][Medline]
  20. Zucman J, Delattre O, Desmaze C, et al. Cloning and characterization of the Ewing's sarcoma and peripheral neuroepithelioma t(11;22) translocation breakpoints. Genes Chromosomes Cancer 1992;5:271-277. [Medline]
  21. Delattre O, Zucman J, Plougastel B, et al. Gene fusion with an ETS DNA-binding domain caused by chromosome translocation in human tumours. Nature 1992;359:162-165. [CrossRef][Medline]
  22. Zucman J, Melot T, Desmaze C, et al. Combinatorial generation of variable fusion proteins in the Ewing family of tumors. EMBO J 1993;12:4481-4487. [Medline]
  23. Nascimento AG, Unni KK, Pritchard DJ, Cooper KL, Dahlin DC. A clinicopathologic study of 20 cases of large-cell (atypical) Ewing's sarcoma of bone. Am J Surg Pathol 1980;4:29-36. [Medline]
  24. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1989.
  25. Zucman J, Delattre O, Desmaze C, et al. EWS and ATF-1 gene fusion induced by t(12;22) translocation in malignant melanoma of soft parts. Nat Genet 1993;4:341-345. [CrossRef][Medline]
  26. Galili N, Davis RJ, Fredericks WJ, et al. Fusion of a fork head domain gene to PAX3 in the solid tumour alveolar rhabdomyosarcoma. Nat Genet 1993;5:230-235. [CrossRef][Medline]
  27. Barr FG, Biegel JA, Sellinger B, Womer RB, Emanuel BS. Molecular and cytogenetic analysis of chromosomal arms 2q and 13q in alveolar rhabdomyosarcoma. Genes Chromosomes Cancer 1991;3:153-161. [Medline]
  28. Fong C-T, Dracopoli NC, White PS, et al. Loss of heterozygosity for the short arm of chromosome 1 in human neuroblastomas: correlation with N-myc amplification. Proc Natl Acad Sci U S A 1989;86:3753-3757. [Free Full Text]
  29. Gauwerky CE, Croce CM. Chromosomal translocations in leukaemia. Semin Cancer Biol 1993;4:333-340. [Medline]

 

This Article
-Abstract

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation

This article has been cited by other articles:



HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  TERMS OF USE  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved.