The Ewing Family of Tumors -- A Subgroup of Small-Round-Cell Tumors Defined by Specific Chimeric Transcripts
Olivier Delattre, Jessica Zucman, Thomas Melot, Xavier Sastre Garau, Jean-Michel Zucker, Gilbert M. Lenoir, Peter F. Ambros, Denise Sheer, Claude Turc-Carel, Timothy J. Triche, Alain Aurias, and Gilles Thomas
Background Precise diagnosis of small-round-cell tumors is oftena challenge to the pathologist and the clinical oncologist.In Ewing's sarcomas and related peripheral primitive neuroectodermaltumors, a t(11;22) translocation or a (21,22) rearrangementis associated with hybrid transcripts of the EWS gene with theFLI1 or ERG gene. To investigate the diagnostic implicationof this observation, we searched for these hybrid transcriptsin tumors from patients with clinical and radiologic featuresof Ewing's sarcoma or peripheral primitive neuroectodermal tumors.
Methods Samples of RNA from 114 tumors were reverse transcribedand subjected to the polymerase chain reaction with primersdesigned to amplify the relevant chimeric transcripts. All amplifiedproducts were sequenced.
Results In-frame hybrid transcripts were observed in 89 cases.A hybrid transcript was found in 83 of 87 cases (95 percent)of Ewing's sarcoma or peripheral primitive neuroectodermal tumors.Samples of RNA from all of 12 tumors that had been proved tobe other than Ewing's sarcoma or neuroectodermal tumors hadno hybrid transcript. However, 6 of 15 undifferentiated tumorswhose type was ambiguous (nonsecreting, poorly differentiatedneuroblastoma or undifferentiated sarcoma) contained a hybridtranscript, suggesting that they might have to be reclassified.
Conclusions A subgroup of small-round-cell tumors identifiedas belonging to the Ewing family of tumors can be defined accordingto a specific molecular genetic lesion that is detectable bya rapid, reliable, and efficient method. This approach can beapplied to small specimens obtained by fine-needle biopsies.
Ewing's sarcoma,1 the second most common malignant bone tumorof children and young adults, is an aggressive osteolytic tumorwith a marked propensity for dissemination. Accurate and rapiddiagnosis is essential for clinical management, but classificationof the neoplasm can be difficult because the microscopical appearanceof the tumor is not specific. Ewing's sarcoma belongs to theheterogeneous group of small-round-cell tumors2. The tumor cellsare uniformly bland and undifferentiated, with a surprisinglylow mitotic index given the rapid growth observed clinically.The presence of large amounts of intracellular glycogen is nota specific finding, since up to 35 percent of Ewing's sarcomasdo not contain detectable glycogen, whereas many other childhoodtumors do contain it3. The MIC2p30-32 antigen, a membrane proteinof unknown function, is a promising new marker4,5,6. However,its presence in several unrelated types of tumors limits itsreliability4,5,6,7. The balanced t(11;22)(q24;q12) chromosometranslocation,8,9 which occurs in 83 percent of cases of Ewing'ssarcoma, is a genotypic marker10. However, cytogenetic analysisis technically difficult, and the results are often obtainedtoo late to influence therapy.
Ewing's sarcoma has phenotypic traits, including a high levelof expression of the MIC2p30-32 antigen,4,5,6,7,11 that overlapthose of a diverse group of primitive neuroectodermal tumorsoccurring outside the central nervous system12,13,14. Thesetumors and Ewing's sarcoma have the same t(11;22) chromosomaltranslocation15. Different terms have been used to designatethese tumors, depending on their location and extent of neuraldifferentiation: peripheral neuroepithelioma, Askin tumor, adultneuroblastoma, peripheral neuroblastoma, and primitive neuroectodermaltumor2,15,16,17. The collective term for these tumors is "peripheralprimitive neuroectodermal tumors"18. Together with Ewing's sarcoma,they form the Ewing family of tumors2,18. However, this familyis poorly defined, since none of the phenotypic markers canfully discriminate these tumors from other small-round-celltumors and since the cytogenetically characteristic t(11;22)translocation may be absent from almost 20 percent of cases10,19.
The recent characterization of the EWSR1 and EWSR2 regions ofchromosomes 22 and 11, respectively, where translocation breakpointshave been mapped,20 has revealed a molecular abnormality thatmay be fundamental in Ewing's sarcoma and related tumors. Thetranslocation results in the expression of an aberrant hybridprotein in which the N-terminal part of the EWS protein is linkedto the DNA binding domain (Ets domain) of the FLI1 transcriptionfactor21. This hybrid protein may alter the transcriptionalregulation of as-yet-unidentified target genes. In a small subgroupof tumors EWS, instead of joining the FLI1 gene, fuses withERG, a member of the Ets family of transcription factors closelyrelated to FLI122. The chimeric protein resulting from the fusionof EWS with ERG is structurally similar to the typical EWS-FLI1protein in that the N-terminal portion of EWS is linked to theEts domain of ERG.
The presence of these fusion genes might be the defining criterionfor the Ewing family of tumors.
In this paper we report our search for transcripts of the fusedgenes in neoplasms belonging to the Ewing family of tumors.For this purpose we amplified complementary DNA from tumor-derivedmessenger RNA by the polymerase chain reaction (PCR). This methodof detecting fusion transcripts has promise as a rapid, specific,and sensitive diagnostic test for the Ewing family of tumors.
Methods
Patients and Tumors
Over a period of 10 years, 114 tumor samples were collectedat the time of biopsy from patients whose clinical and radiologicfindings supported a diagnosis of either typical or atypicalEwing's sarcoma or peripheral primitive neuroectodermal tumor.The median age at diagnosis was 13 years (range, 1 to 48). Partof each sample was used for histologic and immunohistochemicalcharacterization. Another part was immediately frozen in liquidnitrogen. Permanent cell lines were established for 22 tumors.
Tumors were classified in five groups on the basis of the clinical,radiologic, and pathological data. Group 1 consisted of osseousEwing's sarcomas: these were osteolytic bone tumors composedof typical bland, periodic-acid-Schiff (PAS)-positive undifferentiatedcells with the almost complete absence of intercellular fibers.Group 2 was composed of atypical Ewing's sarcomas (e.g., tumorsthat lacked one of the features found in the tumors in group1); it included extraskeletal Ewing's sarcoma and Ewing's sarcomatumors with atypical morphologic features such as large cells23or negative PAS staining. Group 3 consisted of peripheral primitiveneuroectodermal tumors that had two or more definite featuresof neural differentiation17. Group 4 contained tumors clearlyexcluded from the Ewing family of tumors on the basis of theirmorphologic features or immunophenotypes (or both). Group 5tumors were small-round-cell tumors for which a definite diagnosiscould not be made.
Detection of Hybrid Transcripts
Total RNA was isolated from tumors with the RNAzol extractionkit (Bioprobe Systems, Montreuil-sous-Bois, France). One µgof total RNA was reverse transcribed with oligonucleotide 11A,22oligonucleotide ErgA (5'TGAGGGGTACTTGTACAGA3'), or oligodeoxythymidinewith use of the Gene Amp RNA PCR kit (Cetus, Norwalk, Conn.).The resulting samples of complementary DNA were amplified byPCR with primers 11.11,22 Erg 11 (5'TGTTGGGTTTGCTCTTCCGCTC3'),and 22.822. Thirty cycles were performed; each cycle consistedof denaturation at 94 °C for 30 seconds, annealing at 68°C for 1 minute, and elongation at 72 °C for 1 minute.As an internal control for amplification, the ubiquitous EWStranscript was sought with primers 22.8 and 22.4 (5'GGGCCGATCTCTGCGCTCCT3')under identical PCR conditions. The products of amplificationwere analyzed by electrophoresis on 1.2 percent agarose gel.The amplified fragments were purified on Centricon 100 ultrafiltrationdevices (Amicon, Epernon, France), and direct sequencing wasperformed with a Taq polymerase kit (Prism, Applied Biosystems,Foster City, Calif.) with fluorescent primers or dideoxynucleotides.Sequencing reactions were analyzed with an Applied Biosystemsmodel 373A automatic sequencer. Northern and Southern blottingwas performed according to standard procedures,24 with probespreviously described20,22,25.
Results
Types of Fusion Transcripts
From 1984 to 1993, 114 tumor samples were obtained from patientswhose clinical and radiologic data were compatible with a diagnosisof Ewing's sarcoma or related tumors. Pathological examinationrevealed 60 osseous Ewing's sarcomas, 14 atypical Ewing's sarcomas(PAS-negative, 3 cases; extraskeletal, 9 cases; unusual large-cellmorphology, 2 cases), 13 peripheral primitive neuroectodermaltumors, 12 tumors subsequently shown not to belong to the Ewingfamily of tumors, and 15 tumors lacking hallmarks of a specificdisease.
RNA was extracted from these samples and analyzed for hybridtranscripts in which EWS was linked to either FLI1 or ERG. Theprinciple of the method is represented in Figure 1. Samplesof complementary DNA obtained by reverse transcription of tumorRNA were amplified by PCR with the primers 22.8 and 11.11, whichare homologous to the coding regions of EWS (22.8) and FLI1(11.11). These primers promote amplification only if their targetedregions are physically linked -- i.e., only if the tumor RNAcontains an EWS-FLI1 hybrid transcript. A similar approach wasused to detect EWS-ERG hybrid transcripts with primers 22.8and Erg11. For each tumor RNA sample, a control amplificationwas performed with primers 22.8 and 22.4; these two primersallow amplification of the consistently expressed normal EWSgene.
Figure 1. Detection of a Chimeric Transcript by Reverse Transcription Followed by PCR.
The normal EWS gene on chromosome 22, the normal FLI1 gene on chromosome 11, and the chimeric EWS-FLI1 gene on the der(22) rearrangement generated by the t(11;22) translocation are shown schematically, with their corresponding transcripts. The exons of EWS and FLI1 are represented by solid and open boxes, respectively. EWSR1 and EWSR2 denote the regions on chromosomes 22 and 11 where all chromosome breakpoints have been mapped22. The dashed lines represent the most frequent positions of the breakpoints and their joining on the der(22) chromosome to generate a chimeric EWS-FLI1 gene that will produce a type 1 transcript21,22. The primers used to amplify the fusion transcript and the normal EWS transcript are indicated by arrows. Primers 22.8 and 22.4 allow amplification of the normal EWS transcript; this amplification is used as an internal control. Primer 11.11 does not allow amplification unless a hybrid transcript is generated by the translocation. In this case, together with primer 22.8, it promotes the amplification of the junction region.
A hybrid transcript was detected in 89 tumors (Figure 2 andTable 1). The corresponding amplified products were sequenced,revealing in all cases a junction of EWS and FLI1 coding sequencesor EWS and ERG coding sequences. Altogether, 78 tumors containedan EWS-FLI1 fusion transcript and 11 tumors had an EWS-ERG fusiontranscript.
Figure 2. Gel Electrophoresis of PCR-Amplified RNA from Tumors of 15 Patients with Ewing's Sarcoma or Peripheral Primitive Neuroectodermal Tumor.
Each case number denotes a patient's tumor, SKNBE the SKNBE neuroblastoma cell line, HeLa the HeLa cell line, and Con a control amplification without RNA. Size markers are indicated at right (bp denotes base pairs).
The upper panel shows the internal controls for the amplification of part of the EWS transcript with primers 22.4 and 22.8 (Figure 1). The lower panel shows the EWS-FLI1 fusion transcripts amplified with primers 22.8 and 11.11 (Figure 1) and the EWS-ERG fusion transcripts amplified with primers 22.8 and Erg11. To ensure the absence of amplification products in case 122 and in control RNA samples, the gel was subjected to Southern blotting and probed with an internal primer (data not shown).
Table 1. Hybrid Transcripts Detected in Tumors with Initial Presentations Compatible with Ewing's Sarcoma or a Peripheral Primitive Neuroectodermal Tumor.
The most prevalent junctions were of the previously describedtype 1 and type 2 junctions that result from linkage of EWSexon 7 to FLI1 exon 6 (type 1) or 5 (type 2). Seven other typesof junction were found for EWS-FLI122; they corresponded tovarious combinations that join EWS exons 7 to 10 with FLI1 exons4 to 8 (Table 1). Four different EWS-ERG junctions were found.In all cases in which neither the EWS-FLI1 transcript nor theEWS-ERG transcript was detected, internal controls were positive,indicating that the lack of amplified product was not due tofailure of the technique (Figure 2).
Fusion Transcript in Ewing's Sarcoma and Peripheral Primitive Neuroectodermal Tumors
A fusion transcript was demonstrated in 97 percent of the osseousEwing's sarcomas (58 of the 60 tumors in group 1) (Table 1).Reexamination of one of the two tumors without a transcript(case 163) revealed unusual features. In contrast to the strongimmunostaining for the MIC2 antigen observed in all the tumorsof group 1 that had a fusion transcript, there was no MIC2 immunostainingin this tumor. Furthermore, independent pathological reevaluationof this tumor suggested a diagnosis of alveolar rhabdomyosarcoma.Retrospective characterization of the second tumor (case 145)was not possible.
Fusion transcripts were observed in 93 percent (25 of 27 cases)of the cases for which the diagnosis was atypical Ewing's sarcomaor peripheral primitive neuroectodermal tumors (groups 2 and3). One of the tumors without a fusion transcript (case 74)originated from the gluteal region, had the morphologic featuresof a small-round-cell tumor, stained positive for PAS and MIC2,and stained negative for several neuroendocrine markers (Table 2).Cytogenetic analysis showed the karyotype 48,XY,del(1) (p34),+6,+12with cytogenetically normal pairs of chromosomes 22, 21, and11. The other tumor without a fusion transcript (case 122) haddeveloped in an extraskeletal location within the chest of aone-year-old child. It had typical small-round-cell morphologicfeatures but a prominent extracellular matrix. It stained slightlypositive for PAS and slightly positive for MIC2. Apart fromvimentin, all other tested markers were negative (Table 2).Cytogenetic analysis revealed a t(1;22)(p36;q12) translocation,which led the pathologists to propose a diagnosis of Askin tumorwith variant translocation. Southern blot analysis of DNA fromtwo tumors (cases 74 and 122) failed to demonstrate rearrangedEWSR1. Furthermore, Northern blot analysis of both tumors didnot reveal abnormal transcripts of EWS, FLI1, or ERG, stronglysuggesting that in these tumors, none of these genes were affectedby structural rearrangements.
Table 2. Tumors Phenotypically Compatible with a Diagnosis of Ewing's Sarcoma or a Peripheral Primitive Neuroectodermal Tumor, with No Fusion Transcript.
Fusion Transcripts in Other Tumors
In 12 tumors a diagnosis other than Ewing's sarcoma or peripheralprimitive neuroectodermal tumors (group 4) was firmly established.None of the 12 tumors had a detectable fusion transcript (Table 1).
The 15 tumors in the last category (group 5) were difficultto classify. They did not fulfill the criteria for Ewing's sarcomaor peripheral primitive neuroectodermal tumors, and other testsdid not indicate a specific diagnosis. The clinical, radiologic,and histopathological data led to a diagnosis of poorly differentiated,catechol-negative, metaiodobenzylguanidine-negative neuroblastomasin 4 cases and of undifferentiated sarcoma in the other 11 cases(Table 1).
All four cases of apparent neuroblastoma were reevaluated atthe time of relapse. The reevaluation of two cases did not reveala fusion transcript. In one of these two cases, in which thetumor was MIC2-negative, the diagnostic impression of neuroblastomawas confirmed. In the other case, the diagnosis was changedto extrarenal rhabdoid tumor; the data on the tumor's statusfor MIC2 were not available. The other two tumors containeda fusion transcript. Their strong staining for MIC2 reinforcedthe opinion that the initial diagnosis was incorrect. This impressionwas strengthened in one case by the cytogenetic demonstrationof the presence of a t(14;22)(q32;q12) translocation. As a controlmeasure, 20 typical neuroblastomas (positive for metaiodobenzylguanidineand catechol) obtained independently from patients other thanthose in this series were analyzed; none of them contained afusion transcript (data not shown).
Finally, 4 of the 11 tumors diagnosed as undifferentiated sarcomascontained a fusion transcript. All four tumors were reanalyzedfor MIC2 expression. Three tumors were strongly positive forMIC2, and one was weakly positive (Table 3). This last tumorhad a complex, although suggestive, t(11;11;22) translocation.
Table 3. Characteristics of Undifferentiated Sarcomas.
Correlation with Karyotype and Tumor Phenotype
Cytogenetic data were available for 40 tumors (Table 4). Asexpected, all 23 tumors with typical t(11;22) translocationshad EWS-FLI1 transcripts. Of the nine tumors with complex orvariant translocations, seven had EWS-FLI1 transcripts and onean EWS-ERG transcript. One tumor (case 122) with a t(1;22)(p36;q12)translocation had no abnormalities of the EWS, FLI1, or ERGgene, thus suggesting that this translocation might have providedan erroneous diagnostic clue. Finally, six of eight tumors withno cytogenetic evidence of structural rearrangement of chromosome22, 11, or 21 had either an EWS-ERG hybrid transcript (fourtumors) or an EWS-FLI1 transcript (two tumors).
Table 4. Correlation of Molecular Data with Cytogenetic Findings.
With respect to the group of tumors with fusion transcripts,we did not observe obvious phenotypic differences that couldbe related to specific EWS-FLI1 or EWS-ERG transcripts.
Discussion
Almost all tumors in this series that were diagnosed as osseousEwing's sarcomas, atypical Ewing's sarcomas, or peripheral primitiveneuroectodermal tumors contained EWS-FLI1 or EWS-ERG fusiontranscripts. Only 4 of 87 tumors could not be shown to havefusion transcripts, but the 3 tumors without transcripts thatcould be reevaluated had unusual features (Table 2). Thus, todate, no confirmed, fully typical Ewing's sarcoma or peripheralprimitive neuroectodermal tumor has been shown to lack an EWS-FLI1or an EWS-ERG fusion transcript.
The diagnosis of Ewing's sarcoma is often difficult. It is frequentlysuggested on the basis of clinical and radiologic information.Pathological data, including the strong clue provided by MIC2staining, corroborate or exclude the diagnosis in the majorityof cases2,14,17,18. However, other possible diagnoses may notbe conclusively eliminated by these methods. The cytogeneticdemonstration of a t(11;22)(q24;q12) translocation in the tumorcells also favors the diagnosis of Ewing's sarcoma or peripheralprimitive neuroectodermal tumor. However, technical constraintsand variant translocations that can make interpretation unreliablecounterbalance the high specificity of this karyotypic anomaly.Furthermore, as shown here, close to 15 percent of the tumorshave fusion transcripts despite the presence of apparently normalpairs of chromosomes 11, 21, and 22.
Our results show that reverse transcription followed by PCRcan detect the molecular characteristics of a specific geneticalteration in this family of tumors. Therefore, we propose thatthe Ewing family of tumors should be redefined as the groupof tumors that possesses a fusion transcript involving the EWS-FLI1or EWS-ERG genes. The analysis can be performed on small samplesobtained by minimally invasive biopsies, even if the samplesare contaminated by stromal cells. Processing the samples issimple, and the result is available in less than 24 hours. ThePCR method can thus be highly advantageous as a diagnostic tool.The presence of fusion transcripts should permit accurate andreproducible separation of the Ewing family from phenotypicallysimilar groups of tumors. Indeed, this study demonstrates thatthe classic diagnostic problem of distinguishing Ewing's sarcomafrom neuroblastoma and sarcoma is readily resolved by molecularanalysis.
Although these fusion transcripts vary in their exon composition,the deduced encoded protein products have constant features.The N-terminal domain of EWS and either of the nearly identicalEts domains of FLI1 or ERG are always preserved and linked together.This observation, added to the apparent lack of an associationbetween a specific phenotypic trait of the tumor and a particularhybrid transcript, suggests that the various chimeric proteinsmay possess subtle functional differences, if any. Therefore,the members of the Ewing family of tumors should arise througha similar tumorigenic process.
The variety of tumor-specific genetic alterations among othersmall-round-cell tumors (rhabdomyosarcoma, neuroblastoma, andlymphoma) raises the possibility of genotypic diagnosis of themas well. The recent identification of a chimeric gene betweenPAX3 and FKHR in alveolar rhabdomyosarcoma,26 the result ofa t(2;13)(q24;q14) chromosome translocation,27 indicates thata comparable approach using reverse transcription followed byPCR is also feasible here. The specific genetic alterationsof the short arm of chromosome 1 and the amplification of theN-myc gene in neuroblastomas28 can also be detected by specificgenotypic methods, as can the immunoglobulin or T-cell-receptorgene rearrangements and chromosome translocations in lymphomas29.It is thus now possible to distinguish each member of the groupof small-round-cell tumors according to genotype. The extremespecificity and sensitivity of the PCR technique may make someof these genetic markers ideal for detecting minimal metastasesand residual tumor cells in biologic samples.
Supported by grants from the Ligue Nationale contre le Cancer,the European Community Commissions, the Ministere de la Rechercheet de l'Enseignement Superieur, the Association pour la Recherchesur le Cancer, and the Comite Departemental de l'Yonne de laLigue Nationale contre le Cancer.
We are indebted to the following clinicians and pathologistsfor providing tumor samples: C. Bailly, C. Biggs, E. Bouffet,A. Brizard, L. Brugieres, J.-M. Coindre, V. Combaret, F. Doz,J. Dubousset, F. Jaubert, A. Jouvet, H. Krichen, J. Landman,J. Lemerle, M. Malone, J. Michon, O. Oberlin, T. Phillip, P.Pouillart, J. Pritchard, E. Quintana, P. Validire, P. Vielh,and A. Zoubek.
Source Information
From the Laboratoire de Genetique des Tumeurs, INSERM Contrat Jeune Formation, Paris 9201 (O.D., J.Z., T.M., A.A., G.T.); Service d'Oncologie Pediatrique (J.-M.Z.) and Service d'Anatomopathologie (X.S.G.), Institut Curie, Paris; the Department of Pathology and Laboratory Medicine, Childrens Hospital, Los Angeles (T.J.T.); the Human Cytogenetics Laboratory, Imperial Cancer Research Fund, London (D.S.); Laboratoire de Cytogenetique Cancerologique, Centre National de la Recherche Scientifique Unite de Recherche Associee 1462, Nice, France (C.T.-C.); the Children's Cancer Research Institute, St. Anna Kinderspital, Vienna, Austria (P.F.A.); and the International Agency for Research on Cancer, Lyon, France (G.M.L.).
Address reprint requests to Dr. Thomas at the Laboratoire de Genetique des Tumeurs, Institut Curie, 26 rue d'Ulm, 75231 Paris CEDEX 05, France.
References
Ewing J. Diffuse endothelioma of bone. Proc N Y Pathol Soc 1921;21:17-24.
Triche TJ. Pathology of pediatric malignancies. In: Pizzo PA, Poplack DG, eds. Principles and practice of pediatric oncology. 2nd ed. Philadelphia: J.B. Lippincott, 1993:115-52.
Kissane JM, Askin FB, Foulkes M, Stratton LB, Shirley SF. Ewing's sarcoma of bone: clinicopathologic aspects of 303 cases from the Intergroup Ewing's Sarcoma Study. Hum Pathol 1983;14:773-779. [Medline]
Ambros IM, Ambros PF, Strehl S, Kovar H, Gadner H, Salzer-Kuntschik M. MIC2 is a specific marker for Ewing's sarcoma and peripheral primitive neuroectodermal tumors. Cancer 1991;67:1886-1893. [CrossRef][Medline]
Hamilton G, Fellinger EJ, Schratter I, Fritsch A. Characterization of a human endocrine tissue and tumor-associated Ewing's sarcoma antigen. Cancer Res 1988;48:6127-6131. [Free Full Text]
Kovar H, Dworzak M, Strehl S, et al. Overexpression of the pseudoautosomal gene MIC2 in Ewing's sarcoma and peripheral primitive neuroectodermal tumor. Oncogene 1990;5:1067-1070. [Medline]
Aurias A, Rimbaut C, Buffe D, Dubousset J, Mazabraud A. Chromosomal translocations in Ewing's sarcoma. N Engl J Med 1983;309:496-497. [Medline]
Turc-Carel C, Philip I, Berger M-P, Philip T, Lenoir GM. Chromosomal translocations in Ewing's sarcoma. N Engl J Med 1983;309:497-498.
Turc-Carel C, Aurias A, Mugneret F, et al. Chromosomes in Ewing's sarcoma. I. An evaluation of 85 cases and remarkable consistency of t(11;22)(q24;q12). Cancer Genet Cytogenet 1988;32:229-238. [CrossRef][Medline]
Pappo AS, Douglass EC, Meyer WH, Marina N, Parham DM. Use of HBA 71 and anti-2-microglobulin to distinguish peripheral neuroepithelioma from neuroblastoma. Hum Pathol 1993;24:880-885. [CrossRef][Medline]
Lipinski M, Braham K, Philip I, et al. Neuroectoderm-associated antigens on Ewing's sarcoma cell lines. Cancer Res 1987;47:183-187. [Free Full Text]
Noguera R, Triche TJ, Navarro S, Tsokos M, Lombart-Bosch A. Dynamic model of differentiation in Ewing's sarcoma cells: comparative analysis of morphologic, immunocytochemical, and oncogene expression parameters. Lab Invest 1992;66:143-151. [Medline]
Cavazzana AO, Miser JS, Jefferson J, Triche TJ. Experimental evidence for a neural origin of Ewing's sarcoma of bone. Am J Pathol 1987;127:507-518. [Abstract]
Whang-Peng J, Triche TJ, Knutsen T, Miser J, Douglass EC, Israel MA. Chromosome translocation in peripheral neuroepithelioma. N Engl J Med 1984;311:584-585. [Medline]
Askin FB, Rosai J, Sibley RK, Dehner LP, McAlister WH. Malignant small cell tumor of the thoracopulmonary region in childhood: a distinctive clinicopathologic entity of uncertain histogenesis. Cancer 1979;43:2438-2451. [CrossRef][Medline]
Dehner LP. Primitive neuroectodermal tumor and Ewing's sarcoma. Am J Surg Pathol 1993;17:1-13. [Medline]
Horowitz ME, Malawer MM, Delaney TF, Tsokos MG. Ewing's sarcoma family of tumors: Ewing's sarcoma of bone and soft tissue and the peripheral primitive neuroectodermal tumors. In: Pizzo PA, Poplack DG, eds. Principles and practice of pediatric oncology. 2nd ed. Philadelphia: J.B. Lippincott, 1993:795-821.
Gorman PA, Malone M, Pritchard J, Sheer D. Cytogenetic analysis of primitive neuroectodermal tumors: absence of the t(11;22) in two of three cases and a review of the literature. Cancer Genet Cytogenet 1991;51:13-22. [CrossRef][Medline]
Zucman J, Delattre O, Desmaze C, et al. Cloning and characterization of the Ewing's sarcoma and peripheral neuroepithelioma t(11;22) translocation breakpoints. Genes Chromosomes Cancer 1992;5:271-277. [Medline]
Delattre O, Zucman J, Plougastel B, et al. Gene fusion with an ETS DNA-binding domain caused by chromosome translocation in human tumours. Nature 1992;359:162-165. [CrossRef][Medline]
Zucman J, Melot T, Desmaze C, et al. Combinatorial generation of variable fusion proteins in the Ewing family of tumors. EMBO J 1993;12:4481-4487. [Medline]
Nascimento AG, Unni KK, Pritchard DJ, Cooper KL, Dahlin DC. A clinicopathologic study of 20 cases of large-cell (atypical) Ewing's sarcoma of bone. Am J Surg Pathol 1980;4:29-36. [Medline]
Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1989.
Zucman J, Delattre O, Desmaze C, et al. EWS and ATF-1 gene fusion induced by t(12;22) translocation in malignant melanoma of soft parts. Nat Genet 1993;4:341-345. [CrossRef][Medline]
Galili N, Davis RJ, Fredericks WJ, et al. Fusion of a fork head domain gene to PAX3 in the solid tumour alveolar rhabdomyosarcoma. Nat Genet 1993;5:230-235. [CrossRef][Medline]
Barr FG, Biegel JA, Sellinger B, Womer RB, Emanuel BS. Molecular and cytogenetic analysis of chromosomal arms 2q and 13q in alveolar rhabdomyosarcoma. Genes Chromosomes Cancer 1991;3:153-161. [Medline]
Fong C-T, Dracopoli NC, White PS, et al. Loss of heterozygosity for the short arm of chromosome 1 in human neuroblastomas: correlation with N-myc amplification. Proc Natl Acad Sci U S A 1989;86:3753-3757. [Free Full Text]
Gauwerky CE, Croce CM. Chromosomal translocations in leukaemia. Semin Cancer Biol 1993;4:333-340. [Medline]
Zagar, T. M., Triche, T. J., Kinsella, T. J.
(2008). Extraosseous Ewing's Sarcoma: 25 Years Later. JCO
26: 4230-4232
[Full Text]
Slater, O., Shipley, J.
(2007). Clinical relevance of molecular genetics to paediatric sarcomas. J. Clin. Pathol.
60: 1187-1194
[Abstract][Full Text]
Avigad, S., Naumov, I., Ohali, A., Jeison, M., Berco, G. H., Mardoukh, J., Stark, B., Ash, S., Cohen, I. J., Meller, I., Kollender, Y., Issakov, J., Yaniv, I.
(2007). Short Telomeres: A Novel Potential Predictor of Relapse in Ewing Sarcoma. Clin. Cancer Res.
13: 5777-5783
[Abstract][Full Text]
Wang, L., Bhargava, R., Zheng, T., Wexler, L., Collins, M. H., Roulston, D., Ladanyi, M.
(2007). Undifferentiated Small Round Cell Sarcomas with Rare EWS Gene Fusions: Identification of a Novel EWS-SP3 Fusion and of Additional Cases with the EWS-ETV1 and EWS-FEV Fusions. J. Mol. Diagn.
9: 498-509
[Abstract][Full Text]
Baliko, F., Bright, T., Poon, R., Cohen, B., Egan, S. E., Alman, B. A.
(2007). Inhibition of Notch Signaling Induces Neural Differentiation in Ewing Sarcoma. Am. J. Pathol.
170: 1686-1694
[Abstract][Full Text]
Castex, M.-P., Rubie, H., Stevens, M. C.G., Escribano, C. C., de Gauzy, J. S., Gomez-Brouchet, A., Rey, A., Delattre, O., Oberlin, O.
(2007). Extraosseous Localized Ewing Tumors: Improved Outcome With Anthracyclines--The French Society of Pediatric Oncology and International Society of Pediatric Oncology. JCO
25: 1176-1182
[Abstract][Full Text]
de Hooge, A. S.K., Berghuis, D., Santos, S. J., Mooiman, E., Romeo, S., Kummer, J. A., Egeler, R. M., van Tol, M. J.D., Melief, C. J.M., Hogendoorn, P. C.W., Lankester, A. C.
(2007). Expression of Cellular FLICE Inhibitory Protein, Caspase-8, and Protease Inhibitor-9 in Ewing Sarcoma and Implications for Susceptibility to Cytotoxic Pathways. Clin. Cancer Res.
13: 206-214
[Abstract][Full Text]
Martins, A. S., Mackintosh, C., Martin, D. H., Campos, M., Hernandez, T., Ordonez, J.-L., de Alava, E.
(2006). Insulin-Like Growth Factor I Receptor Pathway Inhibition by ADW742, Alone or in Combination with Imatinib, Doxorubicin, or Vincristine, Is a Novel Therapeutic Approach in Ewing Tumor.. Clin. Cancer Res.
12: 3532-3540
[Abstract][Full Text]
van der Schaft, D. W.J., Hillen, F., Pauwels, P., Kirschmann, D. A., Castermans, K., oude Egbrink, M. G.A., Tran, M. G.B., Sciot, R., Hauben, E., Hogendoorn, P. C.W., Delattre, O., Maxwell, P. H., Hendrix, M. J.C., Griffioen, A. W.
(2005). Tumor Cell Plasticity in Ewing Sarcoma, an Alternative Circulatory System Stimulated by Hypoxia. Cancer Res.
65: 11520-11528
[Abstract][Full Text]
Hu-Lieskovan, S., Heidel, J. D., Bartlett, D. W., Davis, M. E., Triche, T. J.
(2005). Sequence-Specific Knockdown of EWS-FLI1 by Targeted, Nonviral Delivery of Small Interfering RNA Inhibits Tumor Growth in a Murine Model of Metastatic Ewing's Sarcoma. Cancer Res.
65: 8984-8992
[Abstract][Full Text]
Dalal, S., Berry, A. M., Cullinane, C. J., Mangham, D. C., Grimer, R., Lewis, I. J., Johnston, C., Laurence, V., Burchill, S. A.
(2005). Vascular Endothelial Growth Factor: A Therapeutic Target for Tumors of the Ewing's Sarcoma Family. Clin. Cancer Res.
11: 2364-2378
[Abstract][Full Text]
Srivastava, A., Rosenberg, A. E., Selig, M., Rubin, B. P., Nielsen, G. P.
(2005). Keratin-Positive Ewing's Sarcoma: An Ultrastructural Study of 12 Cases. INT J SURG PATHOL
13: 43-50
[Abstract]
Williamson, A. J. K., Dibling, B. C., Boyne, J. R., Selby, P., Burchill, S. A.
(2004). Basic Fibroblast Growth Factor-induced Cell Death Is Effected through Sustained Activation of p38MAPK and Up-regulation of the Death Receptor p75NTR. J. Biol. Chem.
279: 47912-47928
[Abstract][Full Text]
Rorie, C. J., Weissman, B. E.
(2004). The Ews/Fli-1 Fusion Gene Changes the Status of p53 in Neuroblastoma Tumor Cell Lines. Cancer Res.
64: 7288-7295
[Abstract][Full Text]
Bielack, S. S., Paulussen, M., Kohler, G.
(2004). A Patient with Two Ewing's Sarcomas with Distinct EWS Fusion Transcripts. NEJM
350: 1364-1365
[Full Text]
Rorie, C. J., Thomas, V. D., Chen, P., Pierce, H. H., O'Bryan, J. P., Weissman, B. E.
(2004). The Ews/Fli-1 Fusion Gene Switches the Differentiation Program of Neuroblastomas to Ewing Sarcoma/Peripheral Primitive Neuroectodermal Tumors. Cancer Res.
64: 1266-1277
[Abstract][Full Text]
Ohali, A., Avigad, S., Cohen, I.J., Meller, I., Kollender, Y., Issakov, J., Gelernter, I., Goshen, Y., Yaniv, I., Zaizov, R.
(2003). Association Between Telomerase Activity and Outcome in Patients With Nonmetastatic Ewing Family of Tumors. JCO
21: 3836-3843
[Abstract][Full Text]
Kolb, E. A., Kushner, B. H., Gorlick, R., Laverdiere, C., Healey, J. H., LaQuaglia, M. P., Huvos, A. G., Qin, J., Vu, H. T., Wexler, L., Wolden, S., Meyers, P. A.
(2003). Long-Term Event-Free Survival After Intensive Chemotherapy for Ewing's Family of Tumors in Children and Young Adults. JCO
21: 3423-3430
[Abstract][Full Text]
Shing, D. C., McMullan, D. J., Roberts, P., Smith, K., Chin, S.-F., Nicholson, J., Tillman, R. M., Ramani, P., Cullinane, C., Coleman, N.
(2003). FUS/ERG Gene Fusions in Ewing's Tumors. Cancer Res.
63: 4568-4576
[Abstract][Full Text]
Strauss, S.J., McTiernan, A., Driver, D., Hall-Craggs, M., Sandison, A., Cassoni, A.M., Kilby, A., Michelagnoli, M., Pringle, J., Cobb, J., Briggs, T., Cannon, S., Witt, J., Whelan, J.S.
(2003). Single Center Experience of a New Intensive Induction Therapy for Ewing's Family of Tumors: Feasibility, Toxicity, and Stem Cell Mobilization Properties. JCO
21: 2974-2981
[Abstract][Full Text]
Scotlandi, K., Manara, M. C., Strammiello, R., Landuzzi, L., Benini, S., Perdichizzi, S., Serra, M., Astolfi, A., Nicoletti, G., Lollini, P.-L., Bertoni, F., Nanni, P., Picci, P.
(2003). c-kit Receptor Expression in Ewing's Sarcoma: Lack of Prognostic Value but Therapeutic Targeting Opportunities in Appropriate Conditions. JCO
21: 1952-1960
[Abstract][Full Text]
Schleiermacher, G., Peter, M., Oberlin, O., Philip, T., Rubie, H., Mechinaud, F., Sommelet-Olive, D., Landman-Parker, J., Bours, D., Michon, J., Delattre, O.
(2003). Increased Risk of Systemic Relapses Associated With Bone Marrow Micrometastasis and Circulating Tumor Cells in Localized Ewing Tumor. JCO
21: 85-91
[Abstract][Full Text]
Bolontrade, M. F., Zhou, R.-R., Kleinerman, E. S.
(2002). Vasculogenesis Plays a Role in the Growth of Ewing's Sarcoma in Vivo. Clin. Cancer Res.
8: 3622-3627
[Abstract][Full Text]
Ozaki, T., Schaefer, K.-L., Wai, D., Yokoyama, R., Ahrens, S., Diallo, R., Hasegawa, T., Shimoda, T., Hirohashi, S., Kawai, A., Naito, N., Morimoto, Y., Inoue, H., Boecker, W., Juergens, H., Winkelmann, W., Dockhorn-Dworniczak, B., Poremba, C.
(2002). Population-based genetic alterations in Ewing's tumors from Japanese and European Caucasian patients. Ann Oncol
13: 1656-1664
[Abstract][Full Text]
Barr, F. G., Qualman, S. J., Macris, M. H., Melnyk, N., Lawlor, E. R., Strzelecki, D. M., Triche, T. J., Bridge, J. A., Sorensen, P. H. B.
(2002). Genetic Heterogeneity in the Alveolar Rhabdomyosarcoma Subset without Typical Gene Fusions. Cancer Res.
62: 4704-4710
[Abstract][Full Text]
Varveris, H, Mazonakis, M, Damilakis, J, Stefanaki, K, Lyraraki, E, Kachris, S, Orfanoudaki, E, Prassopoulos, P, Samonis, G
(2002). Peripheral primitive neuroectodermal tumour during pregnancy. Br. J. Radiol.
75: 543-547
[Abstract][Full Text]
Gibbs, C. P. Jr., Weber, K., Scarborough, M. T.
(2001). Malignant Bone Tumors. JBJS
83: 1728-1745
[Full Text]
de Alava, E., Pardo, J.
(2001). Ewing Tumor: Tumor Biology and Clinical Applications. INT J SURG PATHOL
9: 7-17
[Abstract]
Scotlandi, K., Baldini, N., Cerisano, V., Manara, M. C., Benini, S., Serra, M., Lollini, P.-L., Nanni, P., Nicoletti, G., Bernard, G., Bernard, A., Picci, P.
(2000). CD99 Engagement: An Effective Therapeutic Strategy for Ewing Tumors. Cancer Res.
60: 5134-5142
[Abstract][Full Text]
Empen, K., Otto, C., Muller-Hocker, J., Zapf, J., Schwandt, P.
(2000). Case 1: Hypoglycemic Syncope Due to a Peripheral Neuroectodermal Tumor. JCO
18: 1594-1596
[Full Text]
Gerald, W. L.
(2000). A Practical Approach to the Differential Diagnosis of Small Round Cell Tumors of Infancy Using Recent Scientific and Technical Advances. INT J SURG PATHOL
8: 87-97
[Abstract]
de Alava, E., Panizo, A., Antonescu, C. R., Huvos, A. G., Pardo-Mindan, F. J., Barr, F. G., Ladanyi, M.
(2000). Association of EWS-FLI1 Type 1 Fusion with Lower Proliferative Rate in Ewing’s Sarcoma. Am. J. Pathol.
156: 849-855
[Abstract][Full Text]
de Alava, E., Gerald, W. L.
(2000). Molecular Biology of the Ewing’s Sarcoma/Primitive Neuroectodermal Tumor Family. JCO
18: 204-204
[Abstract][Full Text]
Grier, H. E.
(1999). Soft Tissue Sarcoma: Apples, Oranges, and Passion Fruit. JCO
17: 3695-3696
[Full Text]
Golub, T. R., Slonim, D. K., Tamayo, P., Huard, C., Gaasenbeek, M., Mesirov, J. P., Coller, H., Loh, M. L., Downing, J. R., Caligiuri, M. A., Bloomfield, C. D., Lander, E. S.
(1999). Molecular Classification of Cancer: Class Discovery and Class Prediction by Gene Expression Monitoring. Science
286: 531-537
[Abstract][Full Text]
Arndt, C. A.S., Crist, W. M.
(1999). Common Musculoskeletal Tumors of Childhood and Adolescence. NEJM
341: 342-352
[Full Text]
Cohn, S. L.
(1999). Diagnosis and Classification of the Small Round-Cell Tumors of Childhood. Am. J. Pathol.
155: 11-15
[Full Text]
Gilbert, J., Haber, M., Bordow, S. B., Marshall, G. M., Norris, M. D.
(1999). Use of Tumor-Specific Gene Expression for the Differential Diagnosis of Neuroblastoma from Other Pediatric Small Round-Cell Malignancies. Am. J. Pathol.
155: 17-21
[Abstract][Full Text]
Ginsberg, J. P., de Alava, E., Ladanyi, M., Wexler, L. H., Kovar, H., Paulussen, M., Zoubek, A., Dockhorn-Dworniczak, B., Juergens, H., Wunder, J. S., Andrulis, I. L., Malik, R., Sorensen, P. H.B., Womer, R. B., Barr, F. G.
(1999). EWS-FLI1 and EWS-ERG Gene Fusions Are Associated With Similar Clinical Phenotypes in Ewing's Sarcoma. JCO
17: 1809-1809
[Abstract][Full Text]
Davison, J. M., Morgan, T. W., Hsi, B.-L., Xiao, S., Fletcher, J. A.
(1998). Subtracted, Unique-Sequence, In Situ Hybridization : Experimental and Diagnostic Applications. Am. J. Pathol.
153: 1401-1409
[Abstract][Full Text]
Rubin, B. P., Chen, C.-J., Morgan, T. W., Xiao, S., Grier, H. E., Kozakewich, H. P., Perez-Atayde, A. R., Fletcher, J. A.
(1998). Congenital Mesoblastic Nephroma t(12;15) Is Associated with ETV6-NTRK3 Gene Fusion : Cytogenetic and Molecular Relationship to Congenital (Infantile)Fibrosarcoma. Am. J. Pathol.
153: 1451-1458
[Abstract][Full Text]
WUNDER, J. S., PAULIAN, G., HUVOS, A. G., HELLER, G., MEYERS, P. A., HEALEY, J. H.
(1998). The Histological Response to Chemotherapy as a Predictor of the Oncological Outcome of Operative Treatment of Ewing Sarcoma. JBJS
80: 1020-33
[Abstract][Full Text]
Toretsky, J. A., Kalebic, T., Blakesley, V., LeRoith, D., Helman, L. J.
(1997). The Insulin-like Growth Factor-I Receptor Is Required for EWS/FLI-1 Transformation of Fibroblasts. J. Biol. Chem.
272: 30822-30827
[Abstract][Full Text]
Karnieli, E., Werner, H., Rauscher, F. J. III, Benjamin, L. E., LeRoith, D.
(1996). The IGF-I Receptor Gene Promoter Is a Molecular Target for the Ewing's Sarcoma-Wilms' Tumor 1Fusion Protein. J. Biol. Chem.
271: 19304-19309
[Abstract][Full Text]
Kretschmar, C. S.
(1994). Ewing's Sarcoma and the "Peanut" Tumors. NEJM
331: 325-327
[Full Text]
Belyanskaya, L. L., Gehrig, P. M., Gehring, H.
(2001). Exposure on Cell Surface and Extensive Arginine Methylation of Ewing Sarcoma (EWS) Protein. J. Biol. Chem.
276: 18681-18687
[Abstract][Full Text]
2-microglobulin to distinguish peripheral neuroepithelioma from neuroblastoma. Hum Pathol 1993;24:880-885. [CrossRef][Medline]
Previous
