|
|
| |||||||||||||||||||||||||||||||
Background Hereditary tyrosinemia type I is an autosomal recessive inborn error of metabolism caused by a deficiency of the enzyme fumarylacetoacetate hydrolase. The disorder clusters in the Saguenay-Lac-St.-Jean area of Quebec. In this region, 1 of 1846 newborns is affected and 1 of every 22 persons is thought to be a carrier. Recently, we identified a splice mutation and two nonsense mutations in the fumarylacetoacetate hydrolase gene in two patients from Quebec with tyrosinemia type I.
Methods We used allele-specific-oligonucleotide hybridization to examine the frequency of these three candidate mutations in patients with tyrosinemia type I and in the population of Quebec.
Results The splice mutation was found in 100 percent of patients from the Saguenay-Lac-St.-Jean area and in 28 percent of patients from other regions of the world. Of 25 patients from the Saguenay-Lac-St.-Jean region, 20 (80 percent) were homozygous for this mutation, a guanine-to-adenine change in the splice-donor sequence in intron 12 of the gene, indicating that it causes most cases of tyrosinemia type I in the region. The frequency of carrier status, based on screening of blood spots from newborns, was about 1 per 25 in the Saguenay-Lac-St.-Jean population and about 1 per 66 overall in Quebec.
Conclusions This study identified the most prevalent mutation causing hereditary tyrosinemia in French Canada; it also showed the feasibility of DNA-based testing for carriers in the population at risk. .
Tyrosinemia type I is a rare condition, but in the Saguenay-Lac-St.-Jean area of Quebec the disorder has been identified in 1 in 1846 newborns in the past 20 years,14 making it one of the most common autosomal recessive diseases in French Canada. The estimated frequency of carrier status ranges from 1 in 16 to 1 in 2214. Although measurement of the hallmark metabolite, succinylacetone, can be used in prenatal testing,15 a reliable and rapid test to identify carriers is not available.
Only a small number of mutant alleles account for several autosomal recessive inherited diseases in this region,16,17,18,19 and a founder effect has also been reported for tyrosinemia type I20. If the most prevalent mutation (or mutations) causing the disease could be identified in the French Canadian population, a program of DNA-based, population-wide screening for carriers could become feasible.
Several mutations in the fumarylacetoacetate hydrolase gene have been identified in French Canadian patients. The first was a missense mutation, which so far has been detected in only a single family21. We recently reported four additional mutations in patients with tyrosinemia type I,22 two of whom were from French Canada. A patient from Eastern Quebec was homozygous for a splice mutation consisting of a guanine-to-adenine alteration in the splice-donor consensus sequence of fumarylacetoacetate hydrolase intron 12 (IVS12 +5 G-to-A). A second patient with one parent from Quebec and the other from England had two different nonsense mutations that changed the codon for glutamic acid at positions 357 and 364 of the enzyme to a stop codon (E357X and E364X). Clearly, one or more of these three candidate mutations of the fumarylacetoacetate hydrolase gene might be the common mutation (or mutations) found in patients with tyrosinemia in the Saguenay-Lac-St.-Jean area.
Here we describe the use of allele-specific-oligonucleotide hybridization to screen patients with tyrosinemia type I from Quebec and also patients from outside French Canada for the presence of these three mutations. In addition, we report the frequency of these alleles in the general population of Saguenay-Lac-St.-Jean and Quebec.
Methods
Study Samples
We studied 61 patients with tyrosinemia type I from around the world. Informed consent was obtained from the parents of each patient, and the studies were approved by the appropriate institutional review committees. Twenty-nine of the patients were from the Canadian province of Quebec; none were related, and 25 were from the Saguenay-Lac-St.-Jean area. The other 32 patients were from outside French Canada: 6 patients were from English Canada, 8 from the United States, 5 from France, 1 from Belgium, 5 from Finland, 2 from Norway, 1 from Hungary, 2 from the former Czechoslovakia, 1 from Mexico, and 1 from Iran. The diagnosis of tyrosinemia type I was based on increased urinary excretion of succinylacetone and was confirmed by the finding of deficient fumarylacetoacetate hydrolase activity in liver specimens or cultured skin fibroblasts. DNA was extracted from peripheral-blood cells or liver tissue obtained at transplantation or at the time of autopsy, as described elsewhere21. In addition, control blood samples from which genomic DNA was isolated were obtained from 24 healthy, unrelated laboratory workers.
In the analysis of the frequency of carrier status in the general population, we analyzed dried blood spots on filter paper. The blood samples had been obtained from 395 anonymous newborn infants born in April 1993, through the neonatal screening program of the Reseau de Medecine Genetique du Quebec. The infants were randomly selected, except for the fact that half of them were from the Saguenay-Lac-St.-Jean area and the other half from other regions of Quebec.
Isolation and Amplification of DNA
Genomic DNA from the patients and control subjects was isolated as previously described,21 and 100 ng was amplified by the polymerase chain reaction (PCR)23. The three abnormal alleles were all contained on the same PCR amplification unit (998 base pairs [bp] long). The primers used were TAN 61 (5'CTGCAGCTGCTCATTCCACCTCGC3'), located in intron 11, and TAN 80 (5'CAAGGAGGAAGACGAGCTGCTGGG3'), located in intron 13. The PCR was carried out at 95 °C for 5 minutes, followed by 35 cycles at 95 °C for 30 seconds, 60 °C for 30 seconds, and 72 °C for 3 minutes. The PCR buffer consisted of 10 mM TRIS hydrochloride (pH 9.0), 50 mM potassium chloride, 1.5 mM magnesium chloride, and 0.1 percent Triton X-100.
For the analysis of the samples from the newborns, DNA was isolated by the Chelex method24 from a 5-mm circle of blood on filter paper. The exon-intron boundary containing the intron 12 splice-donor mutation was then amplified with the primer MG 058, in exon 12, and the primer MG 057, in intron 12: the sequence of MG 058 was 5'GTACATGTACTGGACGATGCTG3', and that of MG 057 was 5'ATCTCTTCTCGAGGCTGAGCTGAG3'. The resulting PCR product was 194 bp long. Five microls of isolated DNA was used for amplification in a total volume of 30 microl of Kogan buffer25. The PCR was carried out at 95 °C for 5 minutes, followed by 40 cycles at 90 °C for 30 seconds, 52 °C for 30 seconds, and 72 °C for 1 minute, and then at 72 °C for 2 minutes.
The locations of the mutant alleles and the PCR primers are shown in Figure 1.
|
Oligonucleotides (15 bp long)26 homologous to the wild-type and mutant sequences were designed. The wild-type and mutant sequences for the intron 12 splice-donor mutation were 5'CCGGTGAGTATCTGG3' and 5'CCGGTGAATATCTGG3', respectively; the sequences for the codon 357 nonsense mutation were 5'GGAGCCAGAAAACTT3' and 5'GGAGCCATAAAACTT3'; and the sequences for the codon 364 nonsense mutation were 5'CATGTTGGAACTGTC3' and 5'CATGTTGTAACTGTC3'. Ten percent of each PCR product described above was denatured in 100 microl of 0.4 M sodium hydroxide and 25 mM EDTA and spotted onto a Hybond-N+ membrane (Amersham) in a dot blot apparatus (Schleicher and Schuell). Five picomoles of each oligonucleotide was end-labeled with T4 polynucleotide kinase and [32P]gamma adenosine triphosphate27. The kinase was heat-inactivated, and 50 pmol of the opposing, unlabeled oligonucleotide was added. This mixture was hybridized overnight to the dot blots at 31 °C in 5x SSPE (150 mM sodium chloride, 10 mM sodium phosphate, and 1 mM EDTA), 1 percent sodium dodecyl sulfate, and 5x Denhardt's solution. The blots then were washed for 10 minutes in 2x SSC (150 mM sodium chloride and 15 mM sodium citrate) and 0.5 percent sodium dodecyl sulfate at 46 °C for all wild-type allele-specific oligonucleotides and at 41 °C for all mutant allele-specific oligonucleotides.
Results
We initially screened 10 patients with tyrosinemia type I from Quebec by allele-specific-oligonucleotide hybridization (Figure 2). Six patients were homozygous and three were heterozygous for the intron 12 splice-donor mutation, indicating a high prevalence of this allele in the French Canadian population. The two nonsense mutations previously found in one patient from French Canada22 were not found in these initial studies. Subsequently, DNA samples from 29 French Canadian patients (including 25 patients from the Saguenay-Lac-St.-Jean area) and 32 other patients were analyzed. The results are summarized in Table 1. All 25 patients from the Saguenay-Lac-St.-Jean area were positive for the intron 12 splice-donor mutation, 20 being homozygous for this mutation and 5 being heterozygous. The four French Canadian patients from outside of the Saguenay-Lac-St.-Jean region did not have the splice allele. Thus, 25 of 29 patients (86 percent) from Quebec carried the splice-donor allele on at least one chromosome, with 20 (69 percent) of them being homozygous for the mutation (all 20 were from the Saguenay-Lac-St.-Jean area). In contrast, the splice mutation was less frequent among the 32 patients from outside Quebec, 9 (28 percent) of whom had this mutation. The one homozygous patient was from Iran (this patient has been previously described22), and the heterozygous patients were from Norway (two pa-tients), Finland (one patient), English Canada (three patients), and the United States (two patients).
|
|
To determine the frequency of carriers of the intron 12 splice mutation in the general population, we obtained blood-spot samples from the Quebec neonatal screening program. Testing these samples is a valid method of estimating the frequency of an allele, since the samples are obtained at random and in a blinded fashion. The results of the assays are shown in Figure 3. In the Saguenay-Lac-St.-Jean region, 8 of 198 infants (4 percent; 95 percent confidence interval, 1.3 to 6.7 percent)28 were carriers, as compared with 3 of 197 infants (1.5 percent; 95 percent confidence interval, 0 to 3.2 percent) from the rest of the province of Quebec.
|
The results of this study demonstrate that the intron 12 splice-site mutation22 is responsible for most cases of hereditary tyrosinemia type I in the northeastern region of Quebec, where a high prevalence of the disease has been reported. All 25 patients from this region who were tested were positive for the mutation, and only 4 of the 29 patients from Quebec did not carry this allele on at least one chromosome. The other two candidate alleles, E357X and E364X, are rare.
A founder effect has been proposed as the cause of the clustering of cases of tyrosinemia type I and other autosomal recessive diseases in Quebec20. The results of our study support the hypothesis that the intron 12 splice mutation was carried by one or several ancestors of the Saguenay-Lac-St.-Jean population. Data obtained by haplotype analysis using restriction-fragment-length polymorphisms in patients with tyrosinemia type I and in the French Canadian population also support this founder-effect hypothesis29. The frequency of a single fumarylacetoacetate hydrolase haplotype (haplotype 6), estimated to be 18 percent in the population of the Saguenay-Lac-St.-Jean region, was 96 percent in the group of patients from this area.
Although 69 percent of patients with tyrosinemia type I from Quebec were homozygous for the splice mutation, 86 percent were homozygous for haplotype 6. Thus, there are other mutations on haplotype 6, three of which were recently identified21,30,31. It remains to be seen whether additional disease alleles, not yet described, are related to this haplotype.
Interestingly, not only is the intron 12 splice mutation prevalent among French Canadians, but it has also been found in about 28 percent of patients with tyrosinemia type I from around the world. Indeed, one of the patients previously described by us was Iranian and was homozygous for the splice allele on a haplotype 6 background, like the Saguenay-Lac-St.-Jean patients. This finding probably indicates that this is an ancient mutation.
The results of the analysis of blood spots from newborn infants confirm at a molecular level the high carrier rate, about 1 in 25 among residents of the Saguenay-Lac-St.-Jean area and 1 in 66 in the population of Quebec. The frequency of carrier status corresponds well to the observed incidence of affected newborns in the Saguenay-Lac-St.-Jean area (1 in 1846) and Quebec (1 in 16,000)14. This correlation again indicates that the splice-site mutation accounts for the majority of cases of tyrosinemia type I in the Saguenay-Lac-St.-Jean region.
Our findings have important implications for medical care in the Saguenay-Lac-St.-Jean region specifically and in the province of Quebec in general. Ninety percent of the alleles responsible for tyrosinemia type I in this region are due to the intron 12 splice-site mutation, and therefore about 81 percent of couples at risk for having an affected child could be identified by screening both prospective parents. In addition, the frequency of carriers of the splice mutation is high. The assay described here is a simple test that could be used in population-based screening for carriers in Quebec. The high rate of carrier status, the devastating nature of the condition, and the high cost of current treatment make such testing a realistic possibility. Since the techniques are available, considerations of ethics, the cost-benefit ratio, and the public health will determine whether the test will be used.
Supported by a grant (MT-11081, to Dr. Tanguay) from the Medical Research Council of Canada, by a grant (HD-28585-01) from the National Institute of Child Health and Human Development, and by a Basil O'Connor Award (to Dr. Grompe) by the March of Dimes Foundation. Ms. Demers was the recipient of a studentship from the Medical Research Council of Canada.
We are indebted to Drs. C. Laberge and A. Grenier (Reseau de Medecine Genetique du Quebec) for providing the blood-spot samples from the newborn infants; to Dr. J. Larochelle and C. Prevost for the samples from the patients in the Saguenay-Lac-St.-Jean area; and to the numerous physicians who kindly provided blood or tissue specimens from their patients with tyrosinemia type I: Drs. R. Laframboise and R. Gagne (Ste.-Foy); Drs. G.A. Mitchell and M. Lambert and the transplantation staff (Montreal); Dr. C.R. Scriver (Montreal); Drs. J. Laine, C. Holmberg, and M.K. Salo (Tampere, Finland); Dr. M.T. Zabot (Lyon, France); Dr. E.A. Kvittingen (Oslo, Norway); Dr. L. Kovak (Prague, Czech Republic); and others.
Source Information
From the Department of Molecular and Medical Genetics and the Department of Pediatrics, Oregon Health Sciences University, Portland (M.G., M.A.-D.); and the Laboratoire de genetique cellulaire et moleculaire, Medicine Genetique et Moleculaire, Centre de recherche du Centre Hospitalier de l'Universite Laval, Ste.-Foy, Quebec (M.S.-L., S.I.D., B.L., R.M.T.).
Address reprint requests to Dr. Grompe at the Department of Molecular and Medical Genetics, Mail Code L103, Oregon Health Sciences University, 3181 S.W. Sam Jackson Park Rd., Portland, OR 97201-3098.
References
| |||||||||||||||||||||||||||||||
This article has been cited by other articles:
HOME | SUBSCRIBE | SEARCH | CURRENT ISSUE | PAST ISSUES | COLLECTIONS | PRIVACY | HELP | beta.nejm.org Comments and questions? Please contact us. The New England Journal of Medicine is owned, published, and copyrighted © 2008 Massachusetts Medical Society. All rights reserved. |
Previous
