|
| |||||||||||||||||||||||||||||||
Background Infection with human herpesvirus-6 (HHV-6) is nearly universal in infancy or early childhood. However, the course of this infection, its complications, and its potential for persistence or reactivation remain unclear.
Methods We studied infants and children under the age of three years who presented to our emergency department with acute illnesses. Infants and young children without acute illness were studied as controls. HHV-6 infection was identified by blood-mononuclear-cell culture, serologic testing, and the polymerase chain reaction (PCR).
Results No primary HHV-6 infection was found among 582 infants and young children with acute nonfebrile illnesses or among 352 controls without acute illness. Of 1653 infants and young children with acute febrile illnesses, 160 (9.7 percent) had primary HHV-6 infection, as documented by viremia and seroconversion. They ranged in age from 2 weeks to 25 months; 23 percent were under the age of 6 months. HHV-6 infections accounted for 20 percent of 365 visits to the emergency department for febrile illnesses among children 6 to 12 months old. Of the 160 infants and young children with acute HHV-6 infections, 21 (13 percent) were hospitalized, and 21 had seizures. Often the seizures appeared late and were prolonged or recurrent. HHV-6 infections accounted for one third of all febrile seizures in children up to the age of two years.
Conclusions: In infants and young children HHV-6 infection is a major cause of visits to the emergency department, febrile seizures, and hospitalizations. Perinatal transmission may occur, with possible asymptomatic, transient, or persistent neonatal infection. (N Engl J Med 1994;331:432-8).
Although human herpesvirus-6 (HHV-6) was initially recovered from immunocompromised adults,1 subsequent reports from Japan showed that primary infection occurs in early childhood, predominantly as roseola2,3,4,5,6,7. Reports from other countries and our initial studies in infants in the United States showed a similar epidemiologic pattern, except that roseola was the clinical presentation in a minority of our cases despite the similarity of the strains recovered from the infants we studied and from the Japanese infants8,9,10,11,12,13,14,15,16,17. Many questions remained about the occurrence of primary infection, its subsequent course, the immune response, and complications that would be best addressed in a large prospective study of normal children with acute febrile and nonfebrile illnesses. The study we report here seeks to answer questions about routes of transmission, complications, and the frequency and circumstances of viral persistence and reactivation.
Methods
Subjects
Over a three-year period from July 1990 to July 1993 (a period that did not overlap with that of our initial study14), children under three years of age who presented to our emergency department with acute infections of all types were enrolled in the study. None of the children were included in the earlier study. Children were excluded from the study if blood sufficient for complete laboratory studies was not obtainable or if they had an underlying condition affecting immune function. Primary HHV-6 infection was diagnosed only if both HHV-6 viremia at the initial visit and subsequent seroconversion were documented. The child's history, the results of the physical examination, and the laboratory findings obtained in the emergency department were recorded on a standard form. Children with HHV-6 viremia proved by culture of peripheral-blood mononuclear cells obtained during the initial visit were followed by contacting each child's physician and family. A history was taken, clinical findings were assessed, additional blood specimens were obtained for HHV-6 isolation, and serologic tests, the polymerase chain reaction (PCR), and tests for other viral and bacterial agents were performed during convalescence and at the time of subsequent examinations conducted in the home, the physician's office, or the emergency department.
To compare the clinical findings associated with acute HHV-6 illness with those of other acute illnesses, a matched subgroup of children with acute illnesses that were subsequently shown not to be caused by HHV-6 was chosen and followed in a similar manner. Two or, when possible, three children with illnesses not caused by HHV-6 were matched to each child with HHV-6 illness, according to age, season of acute illness, and sex.
An additional group of children who were of similar ages were studied as normal controls. This group comprised normal, healthy children who were seen for routine care or who had conditions that were not acute, febrile, or infectious, such as orthopedic and surgical conditions.
Isolation of HHV-6
Mononuclear cells were separated from anticoagulated blood samples (0.5 to 3 ml) by density-gradient centrifugation (Histopaque 1077, Sigma Diagnostics, St. Louis) and cultivated with fresh cord-blood mononuclear cells as described elsewhere14. Positive cultures were confirmed by indirect immunofluorescent staining with monoclonal antibodies directed against the HHV-6 A or B variants and subsequently by PCR18,19.
Serologic Testing
IgG antibody to HHV-6 was determined by an indirect immunofluorescent-antibody assay described elsewhere14 that uses twofold dilutions (starting at 1:10) of serum and HSB-2 cells infected with an HHV-6 isolate containing both the HHV-6A and HHV-6B genomes16,17. Serum samples obtained during the acute illness and during convalescence were assayed simultaneously.
PCR
The sequences of the nested primers and the probe were derived from a segment of the HHV-6 genome near the left end of the portion unique to HHV-620. The primer sequences, which are conserved in HHV-6A (U1102) and HHV-6B (Z29), were as follows: external primers, 5'ATTGTGATGTACGTGGCCGTCTC and 5'GATCCATGGTCGTCTTTCCACG; and internal primers, 5'GCGGTCAACGTGCCGCTATCTAT and 5'GACATTTATAAGGGACCCGTTCG. The probe sequence was 5'GTCACGTATACCATTCCCAACC. The final nested product was 151 base pairs (bp) in length. DNA from blood mononuclear cells was prepared as described elsewhere,14 and PCR was performed on 2-microl samples in a final volume of 25 microl. HHV-6 specificity was confirmed by Southern blot hybridization. This method can reliably detect 10 copies of the HHV-6 genome. All tests on follow-up samples were repeated at least once. The primers were tested against other herpesviruses, including HHV-7, without detectable amplification. Each assay contained positive and negative controls, including uninfected cord-blood mononuclear cells, reaction mixture without DNA, and
-globin primers as performance controls21.
Statistical Analysis
Data pertaining to intervals were compared by the unpaired Student's t-test with Statworks, and proportions were compared by the chi-square test with Epi Info (Centers for Disease Control and Prevention, Atlanta). Odds ratios and 95 percent confidence intervals were calculated with Epi Info22.
Results
A total of 2587 children under three years of age were enrolled in this study (Table 1). Primary HHV-6 infection documented by both viremia and seroconversion occurred in 160 children, all of whom were in a group of 1653 children presenting with acute febrile illnesses. None of the blood-mononuclear-cell cultures for children without fever or for 352 normal control children grew HHV-6.
|
The incidence of HHV-6 did not vary according to the season, but the mean age at the time of the primary illness was 9.4 months (median, 8; range, 2 weeks to 25 months). Relatively few cases occurred in the first several months of life, and only one child became ill at an age greater than 24 months (Figure 1). Children with acute HHV-6 illness accounted for 10 percent (159) of the 1553 children in the first 2 years of life and 21 percent (75) of the 365 children 6 to 12 months old who presented to our emergency department with acute febrile illnesses (Figure 1). The peak age at which the virus was acquired was six to nine months, with HHV-6 accounting for 45 of 186 visits (24 percent) for acute febrile illness. Children presenting to the emergency department with acute illnesses not caused by HHV-6 were similar in age (mean, 9.9 months) to those with HHV-6, but more of the children without HHV-6 were boys (64 percent vs. 50 percent, P<0.001).
|
Irritability, inflamed tympanic membranes, and the appearance of serious systemic illness were also noted significantly more often in HHV-6 primary infection. Cough and lower respiratory tract findings were associated less often with HHV-6 infection. Upper respiratory tract signs, however, occurred in 41 percent of HHV-6 illnesses, and gastrointestinal signs in one third. A rash, clinically compatible with roseola, was noted at the initial visit in nine children (6 percent). A characteristic rash developed in an additional 18 children on defervescence. Hence, roseola was eventually diagnosed in 27 children with HHV-6 illness (17 percent). The diagnoses assigned most frequently at the end of the evaluation by the emergency department among 157 children with primary HHV-6 infection were fever with otitis in 47 children (30 percent) and "fever of undetermined cause" or possible sepsis in 45 (29 percent). Among 401 matched children who were negative for HHV-6, these two diagnoses were assigned in 70 children (17 percent, P = 0.001) and 104 children (26 percent), respectively.
Children with HHV-6 illness had significantly lower mean numbers of peripheral-blood white cells (8900 vs. 14,300 per cubic millimeter, P<0.001), lymphocytes (3400 vs. 5300 per cubic millimeter, P = 0.01), and neutrophils (4500 vs. 7700 per cubic millimeter, P = 0.006) at the onset of illness and during the first four days.
Since roseola occurs primarily in children at an age of six months to three years,23,24,25 we examined the clinical features of HHV-6 illness in 36 children under the age of six months, or 23 percent of those with primary infection. Thirteen percent were under two months of age. Younger infants had a lower mean temperature than infants over the age of six months (38.9 °C vs. 39.8 °C, P<0.001) and less otitis, but more diarrhea, irritability, and need for hospitalization (12 of 35 [34 percent] vs. 9 of 121 [7 percent], P<0.001; odds ratio, 6.49; 95 percent confidence interval, 2.23 to 19.25).
Outcome and Complications
The mean duration of illness was 6 days (range, 1 to 21). Twenty-one children (13 percent) required hospitalization. The reasons for hospitalization were suspected sepsis and toxicity (65 percent), diarrhea and dehydration (15 percent), lower respiratory symptoms (10 percent), and seizures (10 percent). The average duration of hospitalization was four days (range, two to seven). Respiratory syncytial virus, isolated from one infant, was the only other pathogen found.
The principal complication was seizures, which occurred in 21 of the 160 children with HHV-6 (13 percent). Among the 1394 HHV-6-negative children 24 months of age or less, seizures complicated 9 percent of the febrile illnesses (P = 0.18). Among the 160 children with HHV-6 and the 401 matched controls, all of whom presented with acute febrile illnesses but no history of seizure, febrile seizures were documented in 67 (12 percent). Acute HHV-6 infection was associated with 21 of these seizures (31 percent). Thus, HHV-6 accounted for approximately one third of the first-time febrile seizures evaluated in the emergency department among these children two years old or younger. The median age of the children with HHV-6 who had seizures was 14 months (range, 7 to 24). The risk that seizures would complicate a primary infection was greatest among children 12 to 15 months old; 8 of 22 such children had seizures (36 percent). Among febrile HHV-6-negative children 12 to 15 months old, 17 of 131 had seizures (13 percent; P = 0.01; odds ratio, 0.26; 95 percent confidence interval, 0.09 to 0.8). Primary HHV-6 infection at any time in the second year of life carried an appreciable risk of seizures: the risk was 29 percent among children 12 to 18 months old and 36 percent among 14 children more than 18 months of age who had infection. All children were febrile at the time of their seizures; none had previously had seizures. Nine children had seizures late in the febrile course, on days 2 to 9. In three children seizures were prolonged and recurred within three days. Four children had seizures subsequently.
Cerebrospinal fluid was obtained from 36 children, including 9 with seizures, during the primary infection. Four samples in which there were appreciable numbers of red cells were uninterpretable. The other samples of cerebrospinal fluid were normal for the child's age with regard to numbers of white cells and concentrations of protein and glucose. No cerebrospinal fluid sample grew HHV-6, but HHV-6 was detected by PCR in 7 of 29 samples tested, including 2 of 7 samples from children with seizures.
Other complications that were observed in one to three children each were fever lasting two to three weeks, intermittent rash, arthralgias, arthritis, and encephalopathy.
Antibody Response, Initially and over Time
Serum samples obtained initially from 126 children with primary infection (79 percent) had little or no detectable HHV-6 antibody, whereas serum samples obtained during convalescence demonstrated seroconversion. The remaining infants, who had measurable antibody in the initial serum samples, were young infants with presumably maternal antibody. Serum samples obtained during convalescence demonstrated increases in antibody concentrations by four times or more, except that one young infant had a twofold increase rather than the decline expected in the absence of infection. The mean initial titer was 3.1 log2; during convalescence, the titer was 9.3 log2. Infants under the age of six months had higher initial titers (4.11 log2 vs. 2.93 log2, P<0.001). As compared with uninfected infants of the same age, infants who became infected with HHV-6 before they were two months old had significantly lower titers at the initial visit (5.02 log2 vs. 6.94 log2, P = 0.003).
There was an increase in HHV-6 antibody within three months of the acute infection that was maintained at average levels of 9 to 10 log2 for one year and that declined thereafter (Figure 2). Eleven infants with infection before three months of age had diminished antibody responses and a greater subsequent decline (Figure 2).
|
|
In all children with primary infection, PCR detected HHV-6 in peripheral-blood mononuclear cells during the acute illness. PCR remained positive in 53 of 68 sequential blood samples (78 percent) obtained within two months of the acute infection and in 37 of 56 samples (66 percent) obtained two months to two years after the primary infection.
PCR was also used to detect the HHV-6 genome in peripheral-blood mononuclear cells from the 2427 children without acute HHV-6 infection (Figure 3). PCR was positive in 23 of 204 infants (11 percent) in the first month of life who did not have acute HHV-6 illness. As the level of passive antibody declined, the rate of positivity by PCR rose rapidly, to 66 percent by one year of age. This correlated with a similar increase in mean antibody levels about two months later, indicating rapid acquisition of infection within six to nine months of the nadir of passive-antibody levels (Figure 3).
The rate of PCR positivity in children with acute illnesses not attributable to HHV-6 infection was compared with the rate in healthy controls to determine whether subsequent acute illness enhanced the detection of HHV-6, possibly from reactivation. When rates of PCR positivity were compared according to age, they were not significantly different in well and acutely ill children.
Reactivation
The possibility of reactivation was assessed with HHV-6 cultures, measurement of antibody titers, and PCR analysis of sequential blood samples in 301 children (102 with primary HHV-6 infection and 199 negative for HHV-6) followed for one to two years (Table 2). HHV-6 was not grown from any follow-up blood sample. The only evidence of a possible reactivation in children with HHV-6 infection was a second fourfold increase in the antibody titer in 27 of 102 children (26 percent) and PCR findings in 7 of 102 (7 percent). Among all 301 children followed, evidence of possible reactivation was detected by measurement of antibody titers in 30 of 187 children (16 percent) and by PCR in 17 of 278 (6 percent). Only three children had concurrent increases in antibody titers and recurrent PCR positivity. The testing of multiple specimens for concurrent pathogens possibly associated with reactivation was rewarding in only one child, in whom a positive PCR recurred during infection with respiratory syncytial virus.
|
To evaluate the frequency and meaning of detection of the HHV-6 genome by PCR in mononuclear cells of neonates, we performed sequential PCR analyses of blood samples (not cord blood) obtained from 41 infants in the first month of life. The infants had no evidence of acute HHV-6 infection, and the samples were analyzed over an average period of 8 months (range, 2 to 32). Twelve neonates (29 percent) were positive by PCR. Six of them were shown during follow-up to have acquired primary HHV-6 infection subsequently. Five of the others became negative by PCR, and the sixth remained positive without evidence of acquiring infection. Of the 29 infants initially negative by PCR, 14 acquired primary HHV-6 infection during the follow-up period.
Discussion
HHV-6 infection is ubiquitous in young children and results in an appreciable burden on our health care resources. It accounted for 10 percent of visits to the emergency department for acute febrile illness among children in the first 2 years of life, and for 20 percent of such visits among those 6 to 12 months old. Its protean manifestations and the lack of means of diagnosis often resulted in lengthy and costly evaluations and hospitalizations. The actual human and financial costs, however, cannot be estimated without a better understanding of the spectrum and consequences of HHV-6 infection.
Although we could not detect HHV-6 viremia in any of the 582 children with afebrile conditions or in the 352 healthy controls, the frequency of mild or asymptomatic primary infection remains undefined and the sequelae of such infections remain unknown. Most initial HHV-6 infections in normal children are benign, although there are case reports of occasional complications, including thrombocytopenia, granulocytopenia, hepatitis, and disseminated infection26,27,28,29. The most common complications are central nervous system manifestations, as has been long suggested by reports associating roseola with seizures, bulging of the anterior fontanelle, meningoencephalitis, and encephalopathy4,26,30,31,32,33,34. HHV-6 accounted for one third of the febrile seizures evaluated in children two years of age or less in our emergency department. Seizures occurred in 19.4 percent of those 6 months or older and in 36 percent of those 12 to 15 months of age -- significantly more often than in age-matched children with febrile illnesses not due to HHV-6. The mechanism by which HHV-6 causes central nervous system manifestations remains unclear, but it may involve more than the high fevers. The lack of an inflammatory response in the cerebrospinal fluid samples from our children with or without seizures is noteworthy. However, we have detected HHV-6 DNA in the cerebrospinal fluid of children with past primary infection as well as in those with acute infection35,36. In several recent Japanese reports HHV-6 DNA was detected in the cerebrospinal fluid of infants with roseola complicated by neurologic symptoms and in eight patients with recurrent febrile convulsions37,38,39. These findings raise the possibility of direct invasion of the central nervous system during the viremic phase of the initial illness, with possible subsequent latency. One infant with fatal HHV-6-associated encephalitis, however, had HHV-6 DNA in cerebrospinal fluid but not in brain tissue40.
The potential of HHV-6 to become latent and to reactivate has been suggested by reports, mostly in adults, of increases in antibody levels during concurrent illnesses and by the recovery of virus from blood and respiratory secretions in previously infected immunocompromised patients5,13,41,42,43,44,45,46. In normal children there is little information on the potential of HHV-6 for latency and reactivation after primary infection. Our follow-up of children after primary infection indicates that the HHV-6 genome persists in the majority for months. Whether this is persistence rather than true latency is unclear. Few of these normal children had evidence to suggest subsequent reactivation. The apparent reappearance of HHV-6 in the blood mononuclear cells could be a consequence of our technical ability to detect the genome at low levels, although all PCR results were confirmed by repeat testing. The results of the serial antibody measurements also suggest that persistent virus may occasionally be restimulated under certain conditions, even in normal children. Another possibility, however, is reinfection with another strain.
Viremia was detected only during primary HHV-6 illness and not during follow-up or in the 2235 children with other acute illnesses. Although reactivation of HHV-6 with viremia was reported in three Japanese children convalescing from measles,47 we could not show that subsequent illnesses engendered a reactivation with viremia. Measles was not among the acute febrile illnesses in our population, but in normal children HHV-6 viremia appears to be rare, even with subsequent febrile illness. Nevertheless, the diagnosis of primary HHV-6 infection should probably not be based on the presence of viremia alone. Diagnosis based on seroconversion alone is even less reliable, considering the number of children who after seroconversion from primary infection had a second fourfold increase in titers. Even IgM antibody may be present during reactivation and in 4 to 5 percent of normal adolescents and adults48.
Classic descriptions of roseola have noted that it characteristically occurs between six months and three years of age, and rarely in the first few months of life, presumably because of protection by maternal antibody23,24,49,50. An appreciable proportion of the primary infections documented in our study occurred in the first months of life; 19 percent of infants were 4 months old or less, and 13 percent were under 2 months, including one 14-day-old. That maternal antibody was present at the time of these acute infections suggests that passive antibody is not uniformly protective. The level of maternal antibody may partly determine the degree and durability of protection and thus the age at which infection occurs. Our infants who acquired their infections in the first months of life had lower mean antibody titers than infants of similar age who were not yet infected. Alternatively, infection in young infants may be acquired from the mother before or during birth or through breast-feeding. The youngest infant previously described to have virologically confirmed infection was 21 days old, and perinatal transmission was questioned but not confirmed51. However, specific IgM antibody has been detected in 2 of 799 samples of cord blood, but HHV-6 DNA was not detected concurrently52. HHV-6 DNA has been detected, however, in one fetus of a mother with human immunodeficiency virus infection,53 suggesting potential intrauterine transmission with compromised maternal immunity. The absence of HHV-6 DNA in samples of breast milk suggests that breast-feeding is not a major mode of transmission54.
Primary infection is most likely acquired by contact with HHV-6 silently shed in secretions of caretakers once the level of passive maternal antibody has declined5,23,24. Vertical transmission also appears plausible, considering the frequency of viremia in our young infants and that of HHV-6 DNA in blood mononuclear cells. The import of these findings and the effect on the infant's subsequent immunity remain uncertain. Many neonates with HHV-6 DNA in their blood mononuclear cells appeared to have HHV-6 only transiently, and protection against subsequent primary infection did not necessarily result. These findings could support several hypotheses. The presence of the HHV-6 genome in the infant's mononuclear cells during the neonatal period indicates intrauterine or perinatal transmission of maternally reactivated HHV-6, which in the face of adequate levels of maternal antibody may become an "aborted infection" without immunologic memory. Alternatively or in addition, perinatal or neonatal acquisition of HHV-6 could lead to an altered immunologic response to HHV-6 or to an increased risk of latency.
Supported by a grant (R01 AI33020-02) from the National Institute of Allergy and Infectious Diseases and in part by a grant (5-MO1-RR-000-44) to the General Clinical Research Center of the University of Rochester from the National Center for Research Resources, National Institutes of Health.
We are indebted to Bruce P. Lanphear, M.D., M.P.H., and to Richard F. Raubertas, Ph.D., for their excellent review of the manuscript.
Source Information
From the Departments of Pediatrics (C.B.H., K.C.S., M.T.C., K.M.M., M.A.C., A.K., R.A.I., L.G.E.), Medicine (C.B.H., C.E.L.), Microbiology and Immunology (S.D., L.G.E.), and Neurology (L.G.E.), University of Rochester School of Medicine and Dentistry, Rochester, N.Y.
References
| |||||||||||||||||||||||||||||||
This article has been cited by other articles:
HOME | SUBSCRIBE | SEARCH | CURRENT ISSUE | PAST ISSUES | COLLECTIONS | PRIVACY | TERMS OF USE | HELP | beta.nejm.org Comments and questions? Please contact us. The New England Journal of Medicine is owned, published, and copyrighted © 2010 Massachusetts Medical Society. All rights reserved. |