|
| |||||||||||||||||||||||||||||||||||||||||
Background Children with the acquired immunodeficiency syndrome (AIDS) have an unusually high incidence of smooth-muscle tumors (leiomyomas and leiomyosarcomas) in addition to malignant lymphomas. We tested the hypothesis that the smooth-muscle tumors in these children are associated with the EpsteinBarr virus (EBV).
Methods Tissue specimens of five leiomyosarcomas and two leiomyomas from five children and one young man with AIDS were studied for evidence of the human immunodeficiency virus (HIV) and EBV by in situ hybridization and quantitative polymerase chain reaction (PCR). Comparison specimens included samples of leiomyosarcoma and leiomyoma from HIV-negative children. EBV clonality of leiomyosarcomas was determined by Southern blot analysis with oligonucleotide probes for EBV terminal-repeat fragments. Tumor specimens were tested by immunoperoxidase staining for infiltration by B lymphocytes and expression of the EBV receptor. Serologic testing for EBV was performed.
Results In situ hybridization showed EBV genomes in all muscle cells of the five leiomyosarcomas and the two leiomyomas from the six HIV-infected patients. Quantitative PCR demonstrated strikingly high levels of EBV in tumor tissue, with as many as 4.3 genome copies per cell. Two colonic leiomyosarcomas obtained from different sites at different times from one patient contained different episomal EBV clones, signifying the presence of distinct monoclonal EBV-related tumors. We found biclonal EBV infection in the leiomyosarcoma of another patient. No EBV was detected in normal muscle or tumor specimens from HIV-negative patients. Immunostaining for the EBV receptor was strongly positive in six of the seven leiomyomas and leiomyosarcomas from the patients with AIDS.
Conclusions EBV can infect smooth-muscle cells, at least in patients with AIDS, and it may contribute to the pathogenesis of leiomyomas and leiomyosarcomas in patients with AIDS. EBV seems to play no part in smooth-muscle tumors in HIV-negative patients.
Methods
Patients
Three children and one young man who had AIDS and leiomyosarcoma, one child with AIDS and a leiomyoma, and a sixth child with AIDS and both a leiomyosarcoma and a leiomyoma were identified from 1988 through 1993 (Table 1). These six patients represent all the cases of smooth-muscle tumors reported to the Pediatric AIDS Lymphoma Network. For comparison, samples of leiomyosarcoma from three HIV-negative children were obtained from the Pediatric Oncology Group Protocol 8653, a study of soft-tissue sarcomas. These three patients were similar to the five patients with AIDS and leiomyosarcoma with regard to age, sex, and race or ethnic group. Four samples of leiomyoma from HIV-negative children, representing all the cases of leiomyoma seen at Texas Children's Hospital over a period of 40 years, also served as comparison specimens. Tumor tissue suitable for in situ hybridization was available from all patients. Samples of tumor, peripheral-blood mononuclear cells, bone marrow mononuclear cells, and plasma from the HIV-positive patients were tested for EBV and HIV by quantitative PCR. Three tumor samples from two HIV-positive patients were evaluated for EBV clonality.
|
Anti-EBV antibodies in plasma were measured by standard immunofluorescence methods.13 These assays included tests for IgG, IgM, and IgA antibodies to viral capsid antigen (VCA-IgG, VCA-IgM, and VCA-IgA, respectively); IgG antibodies to early antigens, including both the diffuse and the restricted components; and IgG antibodies to EpsteinBarr nuclear antigen (EBNA).
In Situ Hybridization
Sections of tumors were prepared on glass slides by the methods of Chang et al. and were hybridized with biotinylated oligonucleotides complementary to three regions of the EBV EBER-1 (EBER) gene or the HIV gag gene.14 The genes were detected with the Detek Hrp Signal Generating System (Enzo Diagnostics, Farmingdale, N.Y.).
Quantitative PCR
Tumor samples, peripheral-blood mononuclear cells, and bone marrow mononuclear cells were obtained from Patient 4 at the time of tumor diagnosis and from Patient 5 during the period from 0.1 to 1.1 years after diagnosis. Plasma samples obtained from Patient 4 4.6 to 1.5 years before tumor diagnosis were available. Plasma samples obtained from Patient 6 at the time of tumor diagnosis and samples of peripheral-blood mononuclear cells and plasma from Patient 7 obtained 2.4 years after diagnosis also were tested.
Mononuclear cells were collected from the peripheral-blood samples and bone marrow aspirates by FicollHypaque density-gradient centrifugation. For PCR, cell samples were lysed15 and plasma was heated at 70°C for 45 seconds.16 Tumor specimens required DNA extraction by standard methods.
PCR was performed in a total volume of 20 µl with 5 µl of sample containing 100,000 cells, 0.67 µg of tumor DNA, or 1 µl of plasma diluted in standard PCR buffer. Primers W-1 (5'GTTCGCGTTGCTAGGCCACC3') and W-2b (5'TGGCGCTCTGATGCGACCAG3'), which amplify a 140-base-pair portion of the BamHI W fragment of EBV, were used to amplify EBV.17,18 Each PCR run included a set of copy-number controls consisting of 1 to 1000 copies of a plasmid containing the amplified region and converted to linear form, diluted in a background of 100,000 lysed, uninfected H9 cells. As an internal control, primers PCO4 and GH20, which amplify a conserved
-globin sequence, were included in each reaction.19 The cycling conditions were 94°C for 3 minutes, 40 cycles at 68°C for 2 minutes and 94°C for 1 minute, and a final incubation at 68°C for 10 minutes. Hybridization was performed with EBV probe BamHI W18 and
-globin probe 19A19 labeled with
-[32P]ATP.
To amplify HIV, primers SK38 and SK39 were used.15 A plasmid containing the HIV-1 gag region and converted to linear form was used as a copy-number control.20 The cycling conditions were identical to those used to amplify EBV, except that annealing and extension were performed at 65°C. Radiolabeled probes SK19 (HIV) and 19A (
-globin) were used for hybridization.
Radioactivity in each band was measured with a Betascope imager (Betagen, Framingham, Mass.) and quantitated with a standard curve for each PCR run. The
-globin signal was used to correct the PCR signal for EBV or HIV in cell samples to correspond to 100,000 cell genomes. An average of six repeats of the BamHI W fragment was assumed for each EBV genome.21 Appropriate dilutions were made in all instances so that the number of copies of EBV or HIV in each sample was well within the standard curve.
EBV Clonality
Sufficient DNA to permit Southern blot analysis for EBV clonality was available from a single tumor-biopsy specimen from Patient 4 and from two colon-tumor specimens obtained at different times from Patient 5. Intracellular DNA was digested with BamHI, analyzed by Southern blotting, probed with a fragment of EcoRI I located near the terminal repeat at one end of the genome, and then stripped and probed with a fragment of XhoI a located near the opposite end of the genome.22
Immunostaining for EBV Receptor and Cell Phenotype
Tissue sections were deparaffinized and immunostained23 with mouse monoclonal anti-CD21 antibodies to the human EBV receptor (CD21)24 and anti-CD20 antibodies to the human B-cell antigen (CD20) (Becton Dickinson, San Jose, Calif.) with Vectastain Elite ABCDAB Substrate kits (Vector Laboratories, Burlingame, Calif.). Two independent observers agreed on the grade of staining in all cases.
Results
Pathological Characterization of Smooth-Muscle Tumors
On light-microscopical examination, the leiomyosarcomas had a uniformly dense cellularity. The fusiform cells of the tumors were arranged in fascicles; their hyperchromatic nuclei had up to five mitotic figures per high-power field. Muscle-specific stains for actin and desmin were uniformly positive. The leiomyomas were composed of fusiform-to-spindle-shaped cells, with few mitotic figures or none.
Immunohistochemical stains were positive for antimuscle actin and desmin in all tumors. Electron-microscopical analysis of specimens from Patients 2, 4, and 5 (not shown) showed thin intracytoplasmic filaments with focal densities, abundant micropinocytotic vesicles, thin but definite external laminae, and folded nuclei. These features further confirmed the smooth-muscle origin of the tumor cells.
EBV Serologic Testing
Plasma samples obtained at the time of tumor diagnosis were available from three HIV-positive patients and one HIV-negative patient. All four patients had evidence of past EBV infection, as indicated by the presence of VCA-IgG antibodies and the absence of VCA-IgM antibodies. VCA-IgA antibodies were found at the minimal detectable dilution (1:8) in Patient 5, who had high VCA-IgG antibody titers (1:1280). Low levels of IgG antibodies to the restricted component of early antigen were found in Patients 4 and 7; Patient 5 had a high level of IgG antibodies to the diffuse component of early antigen (1:320). Two HIV-positive patients and the HIV-negative patient had antibodies to EpsteinBarr nuclear antigen.
In Situ Hybridization
None of the tumors from the HIV-positive or HIV-negative patients had evidence of intracellular HIV infection on in situ hybridization. In contrast, the five leiomyosarcoma specimens and two leiomyoma specimens from the patients with AIDS had strong nuclear staining for EBV in essentially all tumor cells (Figure 1A). Treatment of the tissue sections with RNase-T1 prevented hybridization of the EBER probes (data not shown). Normal smooth muscle in the HIV-positive and HIV-negative patients was uniformly negative for EBER hybridization, indicating the absence of EBV. Nor did the three leiomyosarcomas and the four leiomyomas from the HIV-negative patients have evidence of EBER on in situ hybridization (Figure 1C).
|
Available samples of tumor, peripheral-blood mononuclear cells, bone marrow mononuclear cells, and plasma were analyzed by quantitative PCR for HIV and EBV (Table 2). Strikingly high levels of EBV were found in the two initial tumor samples: 282,422 and 426,455 copies per 100,000 cells (from Patients 4 and 5, respectively). If all the tumor cells were uniformly infected with EBV (as indicated by in situ hybridization), the average number of copies of the EBV genome per cell in the two samples would be 2.8 and 4.3. The levels of EBV in serial specimens of peripheral-blood mononuclear cells (range, 0 to 436,461 copies per 100,000 cells) and plasma (range, 0 to 16,740 copies per milliliter) varied and did not show a discernible trend (Table 2).
|
EBV Clonality
EBV clonality was assessed in tumors from the two patients for whom there were adequate tissue samples (Figure 2 and Figure 3). Identical results were obtained with the EcoRI I and the XhoI a terminal probes; there was no evidence of EBV integration into the cell genome. Both the Raji and the B95-8 cell lines showed the expected monoclonal EBV bands; replicating forms of EBV were also found in B95-8 cells. Both tumor samples from Patient 5 yielded a single band on the Southern blot assay, indicating the presence of monoclonal EBV, but the differing sizes of these terminal-repeat bands indicated that there were separate EBV infections in each tumor. The tumor from Patient 4 had EBV genomes from two clones in approximately equal proportions, a finding consistent with either dual EBV infection or the presence of mixed monoclonal infections in equal numbers.
|
|
Cells in all the leiomyosarcomas and leiomyomas from the HIV-positive and HIV-negative patients were positive for the EBV receptor (CD21) on immunostaining (Table 3). Six of the seven tissue samples from the HIV-positive patients were strongly positive for the EBV receptor (Figure 1B). The samples of leiomyosarcoma and leiomyoma tissue from all seven HIV-negative patients were also positive for CD21, but generally at a lower intensity than that of the tumor samples from the HIV-positive patients (Figure 1D). Normal smooth muscle and normal striated muscle had some immunostaining with the CD21 antibody. None of the muscle tissues reacted with the pan-B-cell antibody (CD20). Tonsil epithelium reacted strongly with both CD20 and CD21.
|
EBV has been intimately associated, though not necessarily in a causal fashion, with endemic (African) Burkitt's lymphoma, nasopharyngeal carcinoma, Hodgkin's disease, and the B-cell lymphomas that arise in organ-transplant recipients and patients with immunodeficiency disorders, including AIDS.25,26 Gastric carcinoma, which is morphologically similar to nasopharyngeal carcinoma, has also been found to harbor EBV, particularly in patients who have a prominent lymphoid infiltration in the tumor stroma.27,28 There is a single report of the presence of EBV DNA in striated muscle29; muscle-biopsy specimens from 8 of 86 patients with the postviral fatigue syndrome contained 3 to 50 copies of EBV DNA per cellular equivalent of genomic DNA, as judged by Southern blot hybridization.
We found evidence of EBV infection in five leiomyosarcomas and two leiomyomas from six HIV-infected patients, but not in smooth-muscle tumors from HIV-negative patients. All the tumors we studied, regardless of source, contained the CD21 EBV receptor. Our results support the hypothesis that EBV has an etiologic role in the soft-tissue tumors that arise in patients with AIDS. EBV may contribute to smooth-muscle tumorigenesis in other immunosuppressed states as well.12
The results of EBV serologic testing in the four patients tested were consistent with past EBV infection. There was no specific evidence of acute infection or of the characteristic profile of anti-EBV antibodies found in patients with nasopharyngeal carcinoma or Burkitt's lymphoma.13
The EBV receptor (CD21) may be a prerequisite for EBV infection of smooth-muscle cells. However, some authors suggest that cell fusion with EBV-infected lymphocytes is the route of viral entry into nonlymphoid cells.30 We found no evidence of EBER-positive cells or lymphocytic infiltrates in tissue surrounding the tumors of the HIV-positive patients. If fusion between EBV-infected lymphocytes and muscle cells had indeed occurred, it must have been at such an early stage of tumor development that we could not detect it. The EBV receptor has been identified on striated-muscle and other cells.30
We found higher levels of the EBV receptor on tumor cells from HIV-infected patients than on tumor cells from HIV-negative patients or in normal smooth muscle (Table 3). This result suggests that perturbation of the immune system in AIDS can increase production of the EBV receptor. It is also possible that EBV infection itself causes increased expression of the receptor. It is not known whether the identical EBV receptor is found on smooth-muscle cells, epithelial cells, and B lymphocytes. Both the reactivity of the smooth-muscle tumors with a monoclonal antibody that detects the receptor on B cells and the presence of EBV in the tumor strongly suggest a biologically relevant association between the EBV receptor in smooth muscle and the virus.
Adequate amounts of specimens for quantitative PCR were available from three HIV-positive patients and one HIV-negative patient. The extraordinarily high copy numbers of EBV in the muscle-tumor cells from HIV-infected patients are consistent with the results of in situ hybridization, which showed EBV in all tumor cells. Burkitt's lymphoma cells also have high copy numbers of EBV.31 High levels of free EBV were detected in the plasma of all three HIV-infected patients who were tested. The finding of 16,740 and 3973 genome copies per milliliter of plasma at the time of tumor diagnosis in Patients 4 and 6, respectively, and 6315 genome copies per milliliter of plasma six weeks after diagnosis in Patient 5 indicates the high level of EBV replication in these patients. The negligible levels of HIV in tumor cells at or near the time of diagnosis in Patients 4 and 5 (4 and 5 genome copies per 100,000 tumor cells, respectively) are also consistent with the negative results of in situ hybridization for HIV.
We cannot tell whether EBV infected the smooth-muscle cells before they were transformed into leiomyosarcomas or whether EBV is causally related to the malignant transformation of the smooth-muscle cells. The high levels of EBV are indirect evidence of a biologically relevant association between the virus and the transformation of myocytes. The presence of EBV in both a leiomyoma and leiomyosarcoma in one patient (Patient 1) suggests that EBV infection precedes malignant transformation. Another important indication that EBV infected the muscle cells before their transformation is the monoclonality of the EBV in two tumor specimens from Patient 5, obtained at different times from different sites. The most plausible explanation of this result is that the tumors arose from two different EBV-infected myocytes (Figure 1A). The biclonal EBV in the tumor from Patient 4 is consistent with either a simultaneous infection of tumor cells by two different EBV viruses (an unlikely possibility) or a tumor-cell population derived from two EBV-infected precursor cells (a likely occurrence). The nearly identical intensity of the two bands representing the terminal fragments of EBV suggests that the extent of viral proliferation was similar in each clone. The lack of EBV polyclonality in these specimens argues against infection of the myocytes after they had been transformed into leiomyosarcomas. The finding of molecularly distinct viruses in two tumors from one of these patients (Patient 5) suggests that EBV infection of smooth-muscle cells is not uncommon in young people with AIDS. Decreased immune surveillance, increased expression of the EBV receptor, and high levels of EBV in plasma may all contribute to the pathogenesis of smooth-muscle tumors in such patients.
Supported by grants (CA56296, CA55507, CA30969, and CA29139) from the National Cancer Institute.
We are indebted to Edith Hawkins, M.D., David Parkam, M.D., Kiran Belani, M.D., Larry Frankel, M.D., Bruce Camitta, M.D., and Lolie Yu, M.D., for providing histopathological review, tissue samples, and clinical data; to Jacqueline Repetski, Patricia Dunhardt, Yasmin Ench, Ming-E Wang, Patrick Kelley, and Bonnie Finley for technical assistance; and to Peggy James for assistance in the preparation of the manuscript.
Source Information
From the Department of Pediatrics, Baylor College of Medicine, Houston (K.L.M.); the Department of Pediatrics, University of Texas Health Science Center at San Antonio (C.T.L., H.B.J.); the Department of Pathology and Laboratory Medicine, East Carolina University, Greenville, N.C. (V.V.J.); the Department of Pediatrics, University of Florida College of Medicine, Gainesville (B.H.P.); Carolinas Medical Center, Charlotte, N.C. (R.T.P.); the Department of Pathology, Children's Hospital of New Jersey, Newark (F.J.D.); and the Department of Pediatrics, Northwestern University Medical School and the Children's Memorial Hospital, Chicago (E.G.C., S.B.M.).
Address reprint requests to Dr. McClain at the Texas Children's Hospital, Children's Cancer Center MC 3-3320, 6621 Fannin St., Houston, TX 77030.
References
| |||||||||||||||||||||||||||||||||||||||||
Related Letters:
More on Reaction to a Foreign Body after Hip Replacement
Jacobs J. J., Urban R. M., Péoc'h M., Pasquier B.
Extract |
Full Text
N Engl J Med 1996;
335:1690-1691, Nov 28, 1996.
Correspondence
This article has been cited by other articles:
HOME | SUBSCRIBE | SEARCH | CURRENT ISSUE | PAST ISSUES | COLLECTIONS | PRIVACY | TERMS OF USE | HELP | beta.nejm.org Comments and questions? Please contact us. The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved. |