A Prospective Evaluation of an Angiotensin-ConvertingEnzyme Gene Polymorphism and the Risk of Ischemic Heart Disease
Klaus Lindpaintner, M.D., Marc A. Pfeffer, M.D., Ph.D., Reinhold Kreutz, M.D., Meir J. Stampfer, M.D., Dr.P.H., Francine Grodstein, Sc.D., Fran LaMotte, B.S., Julie Buring, Sc.D., and Charles H. Hennekens, M.D., Dr.P.H.
Background In a previous study, men with a history of myocardialinfarction were found to have an increased prevalence of homozygosityfor the deletional allele (D) of the angiotensin-convertingenzyme(ACE) gene. The D allele is associated with higher levels ofACE, which may predispose a person to ischemic heart disease.We investigated the association between the ACE genotype andthe incidence of myocardial infarction, as well as other manifestationsof ischemic heart disease, in a large, prospective cohort ofU.S. male physicians.
Methods In the Physicians' Health Study, ischemic heart diseaseas defined by angina, coronary revascularization, or myocardialinfarction developed in 1250 men by 1992. They were matchedwith 2340 controls according to age and smoking history. Zygosityfor the deletioninsertion (DI) polymorphism ofthe ACE gene was determined by an assay based on the polymerasechain reaction. Data were analyzed for both matched pairs andunmatched samples, with adjustment for the effects of knownor suspected risk factors by conditional and nonconditionallogistic regression, respectively.
Results The ACE genotype was not associated with the occurrenceof either ischemic heart disease or myocardial infarction. Theadjusted relative risk associated with the D allele was 1.07(95 percent confidence interval, 0.96 to 1.19; P = 0.24) forischemic heart disease and 1.05 (95 percent confidence interval,0.89 to 1.25; P = 0.56) for myocardial infarction, if an additivemode of inheritance is assumed. Additional analyses assumingdominant and recessive effects of the D allele also failed toshow any association, as did the examination of low-risk subgroups.
Conclusions In a large, prospectively followed population ofU.S. male physicians, the presence of the D allele of the ACEgene conferred no appreciable increase in the risk of ischemicheart disease or myocardial infarction.
Ischemic heart disease is a multifactorial disease, influencedby environmental and genetic factors. Although the recognitionof a number of environmental risk factors has led to importantadvances in the prevention and treatment of the disease, ourknowledge of its heritability, except in the case of uncommonmonogenetic disorders,1 is limited to the predictive importanceof a positive family history2,3 and to observations of familialaggregation.4,5 Thus, a recently reported association betweena polymorphism of the angiotensin-convertingenzyme (ACE)gene and the occurrence of myocardial infarction generated greatinterest.6
The ACE gene (encoding kininase II, EC 3.4.15.1)7,8 containsa polymorphism based on the presence (insertion [I]) or absence(deletion [D]) within an intron of a 287-base-pair (bp) nonsenseDNA domain,9,10 resulting in three genotypes (DD and II homozygotes,and DI heterozygotes). In a retrospective study in France andUlster, men with the DD genotype were found to have 1.34 timesthe risk of myocardial infarction found in those with the DIor II genotype.6 Moreover, in a "low risk" subgroup of thesemen, those with the DD genotype had an even higher risk of myocardialinfarction (odds ratio, 3.2).
Several biologic actions of ACE could be involved in the pathogenesisof ischemic heart disease: the activation of angiotensin I andthe inactivation of bradykinin potentially result in decreasedtissue perfusion11,12,13; angiotensin-induced stimulation ofplasminogen-activator inhibitor type 114 may foster the formationof occlusive coronary thrombi; and angiotensin-mediated promotionof growth may be involved in the pathogenesis of cardiac hypertrophyand ventricular remodeling.15,16,17 The observed codominantassociation between the DI polymorphism and plasma ACEactivity (with values in people with the DD genotype about doublethe values in those with II, and intermediate values found inthose with DI)10,18,19 could be consistent with the reportedincrease in cardiovascular risk associated with the DD genotype.
Beyond the potential importance of the polymorphism as a predictorof risk, the recognition of a genetic variant of the ACE geneas a pathogenetic factor in myocardial infarction is of particularinterest because of the ready availability of target-specificpharmacologic agents in the form of ACE inhibitors. Clearly,the clinical implications of this finding would be even morefar-reaching if the ACE genotype not only was associated withthe occurrence of myocardial infarction, but also representeda modifiable risk factor for ischemic heart disease. The potentialimportance of the finding mandates that it be based on investigationaldesigns that meet rigid epidemiologic and molecular geneticstandards. We therefore conducted a large-scale, prospectivestudy to address this question.
Methods
Study Population
From the Physicians' Health Study, 1250 patients with ischemicheart disease reported by late 1992 and 2340 controls were identifiedamong those for whom blood samples were available. The Physicians'Health Study is a randomized trial of aspirin and beta carotene,initiated in 1982 in 22,071 male, predominantly white, U.S.physicians 40 to 84 years of age at study entry.20,21 Men witha history of angina, myocardial infarction, stroke, transientischemic attacks, or cancer were excluded from the study.
Before randomization, the physicians received blood-collectionkits and were asked to submit EDTA-anticoagulated blood samplesfor storage at -80°C, a request with which 14,916 participantscomplied. Follow-up questionnaires were sent 6 and 12 monthsafter randomization, and yearly thereafter, to obtain updatedinformation on exposures and newly diagnosed disease. Whenevera myocardial infarction was reported, the medical records ofthe patient were reviewed by an end-points committee of physicians.Cases of myocardial infarction were confirmed if they met theWorld Health Organization criteria in terms of symptoms, enzymeelevations, or electrocardiographic changes. Electrocardiographicchanges consistent with infarction that were discovered on routineexamination were not included because the date of their occurrencecould not be ascertained. Physicians reporting angina receiveda questionnaire on which they were asked for further detailsproviding evidence of the diagnosis. The performance of coronarybypass surgery or angioplasty was ascertained from the patients'reports. Causes of death were ascertained from medical records,autopsy results, death certificates, and details of the circumstancesof death. Deaths were classified as resulting from coronaryheart disease on the basis of these records. Sudden death wasnot attributed to ischemic heart disease unless there was additionalsupportive evidence.
In completing the questionnaire, the physicians provided informationon a variety of characteristics relevant to the assessment ofcoronary risk, including diabetes mellitus, hypertension, cigarettesmoking, body weight, height, hypercholesterolemia, physicalactivity, alcohol intake, and family history of cardiovasculardisease. Plasma samples were analyzed to determine lipid profiles.22
For each patient with myocardial infarction (387 men) or anginaor revascularization (865 men), a control matched accordingto age (within one year of the age of the case patient), smokinghistory (current, past, or none), and time of randomization(in six-month periods) was selected among men eligible on thebasis of health status (no reported signs or symptoms of ischemicheart disease). An additional 3 matched controls were identifiedfor 314 case patients with myocardial infarction, and an additional2 matched controls for the remaining 73 patients with myocardialinfarction, to increase the statistical power of the subsampleof persons with myocardial infarction. These procedures yielded1250 case patients with ischemic heart disease and 2340 controls(2 of the case patients with angina had blood specimens unsuitablefor analysis).
Determination of ACE Genotypes
The D and I alleles were identified on the basis of polymerase-chain-reaction(PCR) amplification of the respective fragments from intron16 of the ACE gene and size fractionation and visualizationby electrophoresis.
One microliter of whole blood was added to 5 µl of GeneReleaser(Bioventures, Murfreesboro, Tenn.) and taken through two cyclesof heating to 97°C and cooling to 8°C according to themanufacturer's recommendations. After incubation at 80°Cfor 30 minutes, 20 µl of a PCR master mix containing 1µM primers, 200 µM deoxynucleotide triphosphates,1.3 mM magnesium chloride, 50 mM potassium chloride, 10 mM TRIShydrochloricacid (pH 8.4 at 25°C), 0.1 percent Triton X-100, and 0.35unit of Thermus aquaticus DNA polymerase was added. We usedan optimized primer pair to amplify the D and I alleles, resultingin 319-bp and 597-bp amplicons, respectively (hace3s, 5'GCCCTGCAGGTGTCTGCAGCATGT3';hace3as, 5'GGATGGCTCTCCCCGCCTTGTCTC3'). The thermocycling procedure(PTC 100 apparatus, MJ Research, Watertown, Mass.) consistedof denaturation at 94°C for 30 seconds, annealing at 56°Cfor 45 seconds, and extension at 72°C for 2 minutes, repeatedfor 35 cycles, followed by a final extension at 72°C for7 minutes. After the addition of 5 µl of a glycerol-basedloading buffer, 7 µl of the mixture was loaded onto a1.5 percent submarine agarose slab (FMC, Rockland, Me.) containing40 mM TRIS acetate, 2 mM EDTA, and 1 µg of ethidium bromideper milliliter of solution and fractionated according to sizeat 5 V per centimeter. The amplification products of the D andI alleles were identified by 300-nm ultraviolet transilluminationas distinct bands; in heterozygous samples a third band, assumedto represent a heteroduplex DNA product, was commonly seen (Figure 1Aand Figure 1B).
Figure 1. Determination of ACE Genotypes by PCR Amplification.
Samples were loaded into an upper and a lower row of wells in each panel shown. Panel A shows part of a representative 1.5 percent agarose gel stained with ethidium bromide and photographed under ultraviolet transillumination. Ninety samples from case patients and controls were loaded, along with four standards (DD, DI, II, and a reaction with no DNA [0]), which are seen in the lower right-hand corner of the gel.
Panel B shows the method of screening for the erroneous assignment of the DD genotype to DI samples with use of an insertion-specific primer. At the top, several samples (lanes 1 through 6) are identified as DD by the hace3 primer pair, followed by a blank control (lane 7) and three standards for DD, DI, and II (lanes 8 through 10, respectively). The DI standard in lane 9 is an example of preferential amplification of the D band as compared with the I band; a presumed heteroduplex band (faint line below the I band) is also present. At the bottom, the same samples are shown amplified with the hace5 primer pair, which recognizes insertion-specific sequences. A sample previously misclassified as DD appears in lane 4.
Because the D allele in heterozygous samples is preferentiallyamplified,23 each sample found to have the DD genotype was subjectedto a second, independent PCR amplification with a primer pairthat recognizes an insertion-specific sequence (hace5a, 5'TGGGACCACAGCGCCCGCCACTAC3';hace5c, 5'TCGCCAGCCCTCCCATGCCCATAA3'), with identical PCR conditionsexcept for an annealing temperature of 67°C. The reactionyields a 335-bp amplicon only in the presence of an I allele,and no product in samples homozygous for DD (Figure 1B). Thisprocedure correctly identified the 4 to 5 percent of sampleswith the DI genotype that are misclassified as DD with the insertion-spanningprimers.
The PCR results were scored by two independent investigatorswho did not know whether the sample was from a case patientor a control. No intraobserver variability was found on repeatedreadings of the same gel, and the interobserver variabilitywas less than 1 percent. All ambiguous samples were analyzeda second time; a second analysis was necessary for only 27 ofthe 3590 samples studied.
As an additional measure of quality control, the group of bloodsamples from case patients and controls received at the genotypinglaboratory was randomly and anonymously "spiked" with standards,all of which were interpreted accurately. We also compared dataon the genotypes of 30 samples obtained from Dr. FrançoisCambien and found 100 percent concordance between his resultsand ours.
Other Laboratory Measurements
Plasma levels of apolipoprotein B had previously been determinedin a subgroup of patients with myocardial infarction and intheir matched controls. Plasma was obtained by centrifugationof EDTA-anticoagulated blood at 4°C and 2500xg for 20 minutes,and apolipoprotein B levels were measured with a previouslydescribed specific radioimmunoassay.24
Statistical Analysis
The frequencies of the alleles and genotypes among the casepatients and controls were counted and were compared by thechi-square test with the values predicted by the assumptionof HardyWeinberg equilibrium in the sample. Odds ratioswere calculated as a measure of the association of the ACE genotypewith the phenotype of ischemic heart disease, with the effectsof the D allele assumed to be additive (with scores of 0, 1,and 2 assigned for II, DI, and DD, respectively), dominant (withscores of 0 for II and 1 for DI and DD combined), or recessive(with scores of 0 for II and DI combined and 1 for DD). Foreach odds ratio we calculated two-tailed P values and 95 percentconfidence intervals. We performed both matched-pair and unmatchedanalyses, with adjustment for additional risk factors (exercise,alcohol use, and history of hypertension or hypercholesterolemia)by conditional and unconditional logistic regression, respectively.25To duplicate the identification of a "low risk" subgroup inan earlier study,6 we partitioned our sample at the median valuefor body-mass index (the weight in kilograms divided by thesquare of the height in meters), in the case of ischemic heartdisease, and the median values for body-mass index and apolipoproteinB, in the myocardial-infarction subgroup, since this seemedto approximate most closely the procedure used previously.
Results
Characteristics of the Study Population
The mean ages of the case patients and controls in the studysample were 59.5±8.7 and 59.1±8.6 years, respectively(P not significant), with a mean follow-up period of 9.7±0.9years. In the overall sample, 11.1 percent of the case patientsand 13.4 percent of the controls were current smokers, 46.9percent of the case patients and 43.8 percent of the controlswere former smokers, and 41.9 percent of the case patients and42.6 percent of the controls had never smoked (P not significantfor any comparison). These results reflect the matching characteristics(age and smoking) used to select the case patients and controls.The distribution of several other risk factors among the casepatients and controls is shown in Table 1 and reflects the expecteddifferences in the prevalence of recognized risk factors.
Table 1. Base-Line Characteristics of the Case Patients with Ischemic Heart Disease and Their Matched Controls.
Frequencies of Alleles and Genotypes
Among the controls, the I and D alleles had frequencies of 44.49and 55.51 percent, respectively. The frequencies of the DD,II, and DI genotypes (30.89, 19.87, and 49.23 percent, respectively)were virtually identical to those predicted by the HardyWeinbergequilibrium (30.81, 19.79, and 49.39 percent; chi-square = 0.01;P = 0.92). The frequencies of alleles determined separatelyamong the controls with and without myocardial infarction didnot differ significantly from those in the overall control sampleand were, in either case, in agreement with the frequenciespredicted by the HardyWeinberg equilibrium. The samewas true of the overall study sample, in which the observedfrequencies of the I and D alleles were 43.81 and 56.19 percent,respectively.
None of the recognized risk factors shown in Table 1 differedin distribution or mean value according to ACE genotype (datanot shown).
Associations between Genotype and Phenotype
Genotype frequencies in the overall sample are shown in Table 2according to the patient's status as a case patient or a control.The relative risk of ischemic heart disease conferred by theD allele (assuming an additive effect) was 1.08 in the matched-pairanalysis (95 percent confidence interval, 0.90 to 1.20; P =0.16) (Table 3); for DD, as compared with the DI and II genotypes(assuming a recessive effect of the D allele, as has been doneformerly6), it was 1.09 (95 percent confidence interval, 0.92to 1.27; P = 0.3). These data are unadjusted except for smokinghistory and age, as specified by the study design. Additionalanalyses assuming a dominant effect of the D allele did notchange this result. Likewise, matched-pair analyses (data notshown) and unmatched analyses (Table 4) adjusted for covariatesfailed to demonstrate an effect of the ACE genotype on the phenotype.
Table 4. Odds Ratios for Ischemic Heart Disease According to ACE Genotype and Other Variables, by Multivariate Analysis.
Separate subgroup analyses of pairs in which the case patientwas defined according to whether he had a myocardial infarction,using the same models and analytic algorithms, showed no effectof either ACE allele on the patient's status as a case patientor control (Table 2 and Table 3; data not shown for the entiremodel).
Analysis of a "low risk" subgroup as defined by a body-massindex below the median value (24.5) and of a subgroup from themyocardial-infarction sample with body-mass index and apolipoproteinB values below the medians (24.7 and 109.1 mg per deciliter,respectively) demonstrated again that there was no associationbetween ACE genotype and disease status (Table 2 and Table 3).
Discussion
Heritable factors, in combination with a number of recognizedenvironmental risk factors, are important determinants of thepathogenesis and natural history of ischemic heart disease.The notion that the presence of the D allele may identify ACEas one of the genes contributing to an increased risk of ischemicheart disease is both intriguing and provocative. The rangeof hemodynamic effects of an activated reninangiotensinsystem, in the context of a correlation between the ACE genotypeand plasma ACE activity, is compatible with the concept of anincreased risk of myocardial ischemia conferred by the DD genotype.However, our results in a large, prospective study do not supportthe postulated role of the ACE genotype as a marker for eithermyocardial infarction or ischemic heart disease. In fact, theupper bounds of the 95 percent confidence intervals were 1.24for ischemic heart disease and 1.25 for myocardial infarction,rendering the relative risk of 1.34 reported in retrospectivedata6 very unlikely in the sample we studied.
How can we explain the discrepancy in findings between the presentinvestigation and the earlier study?6 The most likely reasonsare differences in the criteria used to select the patientsand controls and the possibility of differences in genetic backgroundin the samples examined, confounded by the low informativenessof the marker used.
The differences in patient selection between the two studiesare highlighted by the fact that patients were recruited intothe earlier study from three to nine months after their myocardialinfarctions6; thus, none of those who died within this periodwere represented. In contrast, our study design included allmyocardial infarctions, even if they were associated with earlydeath, if a proper diagnosis could be established. The generalizabilityof our findings is limited by the low risk profile overall andthe low incidence of ischemic heart disease among physicians;given the exaggerated effect of the ACE polymorphism previouslyreported in low-risk populations, an opposite bias should havebeen introduced. Whereas the case patients in our study werean average of 5.5 years older than those in the earlier study,this difference does not provide a likely explanation for thediscrepancy, because two recent studies in small cohorts26,27indicated that an increased risk was also associated with theDD genotype in older subjects.
In discussing the possible role of the ACE genotype as a riskfactor for the occurrence of disease, one must bear in mindthat although it is not impossible, it is rather unlikely thatthe intronic DI polymorphism in itself is a disease-causingmutation. It may, however, exist in linkage disequilibrium witha putative pathogenetic mutation elsewhere in the ACE gene andtherefore serve as a useful genetic marker. Among unrelatedpeople, such linkage disequilibrium is maintained only if themarker and the disease mutation are in very close proximityon the chromosome, and the disequilibrium depends on their relativeallelic frequencies. Highly informative markers are usuallypresent in a large number of allelic variants, with individualalleles with low frequencies conferring high specificity. Atthe other end of the spectrum, the specificity of a diallelicmarker system with similar allelic frequencies, exemplifiedby the ACEDI polymorphism, can be expected to be low,but the polymorphism may still be useful in a genetic isolatein which both the marker and disease mutations are of similarphylogenetic antiquity. Admixture from populations in whichno such linkage disequilibrium prevails will rapidly interferewith the usefulness of the marker.
It is possible that the presumably more heterogeneous geneticbackground of a North American population, as compared withsomewhat less ethnically diverse European cohorts, may accountfor a decline in the degree of linkage disequilibrium betweenthe DI marker and a putative disease mutation, thus yieldingnegative results. Therefore, our study does not rule out thepossibility that certain mutant alleles of the ACE gene maybe associated with a predisposition to ischemic heart disease;it simply indicates that in middle-aged U.S. men the ACEDIpolymorphism does not serve as a useful indicator of a putativedisease-causing mutation on the ACE gene.
Recently, a number of small casecontrol studies havereported an association between the prevalence of the ACE genotypeand such diverse entities as dilated cardiomyopathy,28 coronary-arteryrestenosis,29 hypertrophic cardiomyopathy,30 parental historyof myocardial infarction,31,32 and cardiac hypertrophy,33 withvariable results.34,35 It is important to recognize that studiesof linkage disequilibrium (association) are highly sensitiveto the selection of a genetically appropriate control sample.Indeed, the frequency of the DD genotype in the control samplesin these studies ranged from 17 percent33 to 39 percent,34 indicatingmajor inconsistencies in the selection of controls. The frequencyof the DD genotype in our controls was 31 percent, a figurethat is in agreement with the originally published data9,10,18and was independently verified by the genotyping of an additional,large cross-population sample consisting of more than 3900 people(unpublished data), providing a sample for our estimates ofD and I allelic frequencies in normal populations that exceedsthose of previous analyses. It should be emphasized that thefrequency of the DD genotype reported here among the case patients(but also among the controls) is identical to that found amongthe case patients in the original study.6 It is interestingto note, in hindsight, that our earliest preliminary resultswere flawed by a chance underrepresentation of the DD genotypein a small cohort of some 400 controls; this problem was correctedonce the sample was expanded.36
Primarily on the basis of the successful reduction of morbidityand mortality after myocardial infarction by treatment withACE inhibitors,37,38,39 we believe that the reninangiotensinsystem is likely to play an important part in ischemic heartdisease. However, the mechanism has so far remained elusive.Although the present data do not exclude a pathogenetic roleof mutations of the ACE gene in ischemic heart disease and myocardialinfarction, the results of this large, prospective investigationindicate that the ACE DI polymorphism is not useful forassessing the risk of ischemic heart disease or myocardial infarction.
Supported in part by a Research Career Development Award (K04-HL03138-01)from the National Heart, Lung, and Blood Institute; by a HarcourtGeneral Charitable Foundation Young Investigator's Award (toDr. Lindpaintner); by a Howard Hughes Medical Institute PostdoctoralFellowship Award (to Dr. Kreutz); and by grants (CA40360 andCA42182) from the National Institutes of Health.
We are indebted to Mr. Huang Chao and Ms. Stefanie Bechtel fortheir expert technical assistance.
Source Information
From the Divisions of Cardiovascular Diseases (K.L., M.A.P., R.K.) and Preventive Medicine (F.L., J.B., C.H.H.), and the Channing Laboratory (M.J.S., F.G.), Department of Medicine, Brigham and Women's Hospital; the Department of Cardiology, Children's Hospital (K.L.); the Department of Ambulatory Care and Prevention, Harvard Medical School (J.B., C.H.H.); and the Departments of Epidemiology and Nutrition, Harvard School of Public Health (M.J.S., C.H.H.) all in Boston.
Address reprint requests to Dr. Lindpaintner at the Cardiovascular Division, Brigham and Women's Hospital, 75 Francis St., Boston, MA 02115.
References
Brown MS, Goldstein JL. A receptor-mediated pathway for cholesterol homeostasis. Science 1986;232:34-47. [Free Full Text]
Hoit BD, Gilpin EA, Henning H, et al. Myocardial infarction in young patients: an analysis by age subsets. Circulation 1986;74:712-721. [Free Full Text]
Underwood DA, Proudfit WL, Lim J, MacMillan JP. Symptomatic coronary disease in patients aged 21 to 30 years. Am J Cardiol 1985;55:631-634. [Medline]
Herman B, Schmitz PI, Leyten AC, et al. Multivariate logistic analysis of risk factors for stroke in Tilburg, the Netherlands. Am J Epidemiol 1983;118:514-525. [Free Full Text]
Jorde LB, Williams RR. Relation between family history of coronary artery disease and coronary risk variables. Am J Cardiol 1988;62:708-713. [CrossRef][Medline]
Cambien F, Poirier O, Lecerf L, et al. Deletion polymorphism in the gene for angiotensin-converting enzyme is a potent risk factor for myocardial infarction. Nature 1992;359:641-644. [CrossRef][Medline]
Soubrier F, Alhenc-Gelas F, Hubert C, et al. Two putative active centers in human angiotensin I-converting enzyme revealed by molecular cloning. Proc Natl Acad Sci U S A 1988;85:9386-9390. [Free Full Text]
Hubert C, Houot AM, Corvol P, Soubrier F. Structure of the angiotensin I-converting enzyme gene: two alternate promoters correspond to evolutionary steps of a duplicated gene. J Biol Chem 1991;266:15377-15383. [Free Full Text]
Rigat B, Hubert C, Corvol P, Soubrier F. PCR detection of the insertion/deletion polymorphism of the human angiotensin converting enzyme gene (DCP1) (dipeptidyl carboxypeptidase 1). Nucleic Acids Res 1992;20:1433-1433. [Free Full Text]
Rigat B, Hubert C, Alhenc-Gelas F, Cambien F, Corvol P, Soubrier F. An insertion/deletion polymorphism in the angiotensin I-converting enzyme gene accounting for half the variance of serum enzyme levels. J Clin Invest 1990;86:1343-1346.
Mochizuki T, Eberli FR, Apstein CS, Lorell BH. Exacerbation of ischemic dysfunction by angiotensin II in red cell-perfused rabbit hearts: effects on coronary flow, contractility, and high-energy phosphate metabolism. J Clin Invest 1992;89:490-498.
Britton S, DiSalvo J. Effects of angiotensin I and angiotensin II on hindlimb and coronary vascular resistance. Am J Physiol 1973;225:1226-1231.
Magrini F, Reggiani P, Roberts N, Meazza R, Ciulla M, Zanchetti A. Effects of angiotensin and angiotensin blockade on coronary circulation and coronary reserve. Am J Med 1988;84:Suppl 3A:55-60. [CrossRef][Medline]
Ridker PM, Gaboury CL, Conlin PR, Seely EW, Williams GH, Vaughan DE. Stimulation of plasminogen activator inhibitor in vivo by infusion of angiotensin II: evidence of a potential interaction between the renin-angiotensin system and fibrinolytic function. Circulation 1993;87:1969-1973. [Free Full Text]
Lindpaintner K, Lu W, Neidermajer N, et al. Selective activation of cardiac angiotensinogen gene expression in post-infarction ventricular remodeling in the rat. J Mol Cell Cardiol 1993;25:133-143. [CrossRef][Medline]
Hirsch AT, Talsness CE, Schunkert H, Paul M, Dzau VJ. Tissue-specific activation of cardiac angiotensin converting enzyme in experimental heart failure. Circ Res 1991;59:475-482.
Fabris B, Jackson B, Kohzuki M, Perich R, Johnston CI. Increased cardiac angiotensin-converting enzyme in rats with chronic heart failure. Clin Exp Pharmacol Physiol 1990;17:309-314. [Medline]
Tiret L, Rigat B, Visvikis S, et al. Evidence, from combined segregation and linkage analysis, that a variant of the angiotensin I-converting enzyme (ACE) gene controls plasma ACE levels. Am J Hum Genet 1992;51:197-205. [Medline]
Costerousse O, Allegrini J, Lopez M, Alhenc-Gelas F. Angiotensin I-converting enzyme in human circulating mononuclear cells: genetic polymorphism of expression in T-lymphocytes. Biochem J 1993;290:33-40.
The Steering Committee of the Physicians' Health Study Research Group. Preliminary report: findings from the aspirin component of the ongoing Physicians' Health Study. N Engl J Med 1988;318:262-264. [Medline]
The Steering Committee of the Physicians' Health Study Research Group. Final report on the aspirin component of the ongoing Physicians' Health Study. N Engl J Med 1989;321:129-135. [Abstract]
Stampfer MJ, Sacks FM, Salvini S, Willett WC, Hennekens CH. A prospective study of cholesterol, apolipoproteins, and the risk of myocardial infarction. N Engl J Med 1991;325:373-381. [Abstract]
Rosner B, Hennekens CH. Analytic methods in matched pair epidemiological studies. Int J Epidemiol 1978;7:367-372. [Free Full Text]
Evans AE, Poirier O, Kee F, et al. Polymorphisms of the angiotensin-converting-enzyme gene in subjects who die from coronary heart disease. Q J Med 1994;87:211-214. [Free Full Text]
Ruiz J, Blanche H, Cohen N, et al. Insertion/deletion polymorphism of the angiotensin-converting enzyme gene is strongly associated with coronary heart disease in non-insulin-dependent diabetes mellitus. Proc Natl Acad Sci U S A 1994;91:3662-3665. [Free Full Text]
Raynolds MV, Bristow MR, Bush EW, et al. Angiotensin-converting enzyme DD genotype in patients with ischaemic or idiopathic dilated cardiomyopathy. Lancet 1993;342:1073-1075. [CrossRef][Medline]
Ohishi M, Fujii K, Minamino T, et al. A potent genetic risk factor for restenosis. Nat Genet 1993;5:324-325. [CrossRef][Medline]
Marian AJ, Yu QT, Workman R, Greve G, Roberts R. Angiotensin-converting enzyme polymorphism in hypertrophic cardiomyopathy and sudden cardiac death. Lancet 1993;342:1085-1086. [CrossRef][Medline]
Bohn M, Berge KE, Bakken A, Erikssen J, Berg K. Insertion/deletion (I/D) polymorphism at the locus for angiotensin I-converting enzyme and parental history of myocardial infarction. Clin Genet 1993;44:298-301. [Medline]
Tiret L, Kee F, Poirier O, et al. Deletion polymorphism in angiotensin-converting enzyme gene associated with parental history of myocardial infarction. Lancet 1993;341:991-992. [CrossRef][Medline]
Schunkert H, Hense H-W, Holmer SR, et al. Association between a deletion polymorphism of the angiotensin-converting-enzyme gene and left ventricular hypertrophy. N Engl J Med 1994;330:1634-1638. [Free Full Text]
Bohn M, Berge KE, Bakken A, Erikssen J, Berg K. Insertion/deletion (I/D) polymorphism at the locus for angiotensin I-converting enzyme and myocardial infarction. Clin Genet 1993;44:292-297. [Medline]
Schächter F, Faure-Delanef L, Guénot F, et al. Genetic associations with human longevity at the ApoE and ACE loci. Nat Genet 1994;6:29-32. [CrossRef][Medline]
Lindpaintner K, Pfeffer MA, Kreutz RH, et al. Angiotensin converting enzyme (ACE) genotype and risk of myocardial infarction (MI). Clin Res 1993;41:Suppl:216A-216A.abstract
Pfeffer MA, Braunwald E, Moyé LA, et al. Effect of captopril on mortality and morbidity in patients with left ventricular dysfunction after myocardial infarction -- results of the Survival and Ventricular Enlargement Trial. N Engl J Med 1992;327:669-677. [Abstract]
Yusuf S, Pepine CJ, Garces C, et al. Effect of enalapril on myocardial infarction and unstable angina in patients with low ejection fractions. Lancet 1992;340:1173-1178. [CrossRef][Medline]
Rutherford JD, Pfeffer MA, Moye LA, et al. Effects of captopril on ischemic events after myocardial infarction. Circulation 1994;90:1731-1738. [Free Full Text]
Bunout, D., Barrera, G., de la Maza, M. P., Leiva, L., Backhouse, C., Hirsch, S.
(2009). Effects of enalapril or nifedipine on muscle strength or functional capacity in elderly subjects. A double blind trial. Journal of Renin-Angiotensin-Aldosterone System
10: 77-84
[Abstract]
Settin, A., ElBaz, R., Abbas, A., Abd-Al-Samad, A., Noaman, A.
(2009). Angiotensin-converting enzyme gene insertion/deletion polymorphism in Egyptian patients with myocardial infarction. Journal of Renin-Angiotensin-Aldosterone System
10: 96-100
[Abstract]
Yang, J.-K., Gong, Y.-Y., Liang Xie, , Lian, S.-G., Juan Yang, , Xu, L.-Y., Gao, S.-J., Zhang, Y.-P.
(2009). Lack of genetic association between the angiotensin-converting enzyme gene insertion/deletion polymorphism and longevity in a Han Chinese population. Journal of Renin-Angiotensin-Aldosterone System
10: 115-118
[Abstract]
Ozben, B., Altun, I., Sabri Hancer, V., Bilge, A. K., Tanrikulu, A. M., Diz-Kucukkaya, R., Fak, A. S., Yilmaz, E., Adalet, K.
(2008). Angiotensin-converting enzyme gene polymorphism in arrhythmogenic right ventricular dysplasia: is DD genotype helpful in predicting syncope risk?. Journal of Renin-Angiotensin-Aldosterone System
9: 215-220
[Abstract]
Zintzaras, E., Raman, G., Kitsios, G., Lau, J.
(2008). Angiotensin-Converting Enzyme Insertion/Deletion Gene Polymorphic Variant as a Marker of Coronary Artery Disease: A Meta-analysis. Arch Intern Med
168: 1077-1089
[Abstract][Full Text]
Bonnet, F., Patel, S., Laville, M., Balkau, B., Favuzzi, A., Monti, L. D., Lalic, N., Walker, M., on behalf of the European Group for the Study of I,
(2008). Influence of the ACE Gene Insertion/Deletion Polymorphism on Insulin Sensitivity and Impaired Glucose Tolerance in Healthy Subjects. Diabetes Care
31: 789-794
[Abstract][Full Text]
Yamin, C., Amir, O., Sagiv, M., Attias, E., Meckel, Y., Eynon, N., Sagiv, M., Amir, R. E.
(2007). ACE ID genotype affects blood creatine kinase response to eccentric exercise. J. Appl. Physiol.
103: 2057-2061
[Abstract][Full Text]
Amir, O., Amir, R., Yamin, C., Attias, E., Eynon, N., Sagiv, M., Sagiv, M., Meckel, Y.
(2007). Human, Environmental & Exercise: The ACE deletion allele is associated with Israeli elite endurance athletes. Exp Physiol
92: 881-886
[Abstract][Full Text]
Ertas, F. S., Hasan, T., Ozdol, C., Gulec, S., Atmaca, Y., Tulunay, C., Karabulut, H., Kocum, H. T., Dincer, I., Kose, K. S., Erol, C.
(2007). Relationship Between Angiotensin-Converting Enzyme Gene Polymorphism and Severity of Aortic Valve Calcification. Mayo Clin Proc.
82: 944-948
[Abstract][Full Text]
Yazdanpanah, M., Aulchenko, Y. S., Hofman, A., Janssen, J. A.M.J.L., Sayed-Tabatabaei, F. A., van Schaik, R. H.N., Klungel, O. H., Stricker, B. H.C.H., Pols, H. A.P., Witteman, J. C.M., Lamberts, S. W.J., Oostra, B. A., van Duijn, C. M.
(2007). Effects of the Renin-Angiotensin System Genes and Salt Sensitivity Genes on Blood Pressure and Atherosclerosis in the Total Population and Patients With Type 2 Diabetes. Diabetes
56: 1905-1912
[Abstract][Full Text]
Adamzik, M., Frey, U., Sixt, S., Knemeyer, L., Beiderlinden, M., Peters, J., Siffert, W.
(2007). ACE I/D but not AGT (-6)A/G polymorphism is a risk factor for mortality in ARDS. Eur Respir J
29: 482-488
[Abstract][Full Text]
Bilici, A., Ulgen, M. S., Nazaroglu, H., Ozturk, O., Ekici, F., Akgul, C., Alan, B.
(2007). The Effect of ACE Gene Polymorphisms on Doppler Blood Flow Parameters of Carotid and Brachial Arteries in Patients With Myocardial Infarction. ANGIOLOGY
57: 681-685
[Abstract]
Sugimoto, M., Furuta, T., Shirai, N., Ikuma, M., Sugimura, H., Hishida, A.
(2006). Influences of chymase and Angiotensin I-converting enzyme gene polymorphisms on gastric cancer risks in Japan.. Cancer Epidemiol. Biomarkers Prev.
15: 1929-1934
[Abstract][Full Text]
Ashley, E. A., Kardos, A., Jack, E. S., Habenbacher, W., Wheeler, M., Kim, Y. M., Froning, J., Myers, J., Whyte, G., Froelicher, V., Douglas, P.
(2006). Angiotensin-Converting Enzyme Genotype Predicts Cardiac and Autonomic Responses to Prolonged Exercise. J Am Coll Cardiol
48: 523-531
[Abstract][Full Text]
Sanada, H., Yatabe, J., Midorikawa, S., Hashimoto, S., Watanabe, T., Moore, J. H., Ritchie, M. D., Williams, S. M., Pezzullo, J. C., Sasaki, M., Eisner, G. M., Jose, P. A., Felder, R. A.
(2006). Single-Nucleotide Polymorphisms for Diagnosis of Salt-Sensitive Hypertension. Clin. Chem.
52: 352-360
[Abstract][Full Text]
Schelleman, H., Klungel, O. H, van Duijn, C. M, Witteman, J. C., Hofman, A., de Boer, A., Stricker, B. H.
(2006). Drug-Gene Interaction Between the Insertion/Deletion Polymorphism of the Angiotensin-Converting Enzyme Gene and Antihypertensive Therapy. The Annals of Pharmacotherapy
40: 212-218
[Abstract][Full Text]
Chunlan Yan, , Jinbiao Zhan, , Weihong Feng,
(2005). Gene Polymorphisms of Angiotensin II Type 1 Receptor and Angiotensin-Converting Enzyme in Two Ethnic Groups Living in Zhejiang Province, China. Journal of Renin-Angiotensin-Aldosterone System
6: 132-137
[Abstract]
Gonzalez-Zuloeta Ladd, A. M., Arias Vasquez, A., Sayed-Tabatabaei, F. A., Coebergh, J.W., Hofman, A., Njajou, O., Stricker, B., van Duijn, C.
(2005). Angiotensin-Converting Enzyme Gene Insertion/Deletion Polymorphism and Breast Cancer Risk. Cancer Epidemiol. Biomarkers Prev.
14: 2143-2146
[Abstract][Full Text]
Catarsi, P., Ravazzolo, R., Emma, F., Fruci, D., Finos, L., Frau, A., Morreale, G., Carrea, A., Ghiggeri, G. M.
(2005). Angiotensin-converting enzyme (ACE) haplotypes and cyclosporine A (CsA) response: a model of the complex relationship between ACE quantitative trait locus and pathological phenotypes. Hum Mol Genet
14: 2357-2367
[Abstract][Full Text]
Koch, W., Latz, W., Eichinger, M., Ganser, C., Schomig, A., Kastrati, A.
(2005). Genotyping of the Angiotensin I-Converting Enzyme Gene Insertion/Deletion Polymorphism by the TaqMan Method. Clin. Chem.
51: 1547-1549
[Full Text]
BEDNARSKA-MAKARUK, M., RODO, M., MARKUSZEWSKI, C., ROZENFELD, A., SWIDERSKA, M., HABRAT, B., WEHR, H.
(2005). POLYMORPHISMS OF APOLIPOPROTEIN E AND ANGIOTENSIN-CONVERTING ENZYME GENES AND CAROTID ATHEROSCLEROSIS IN HEAVY DRINKERS. Alcohol Alcohol
40: 274-282
[Abstract][Full Text]
Hashizume, K., Mashima, Y., Fumayama, T., Ohtake, Y., Kimura, I., Yoshida, K., Ishikawa, K., Yasuda, N., Fujimaki, T., Asaoka, R., Koga, T., Kanamoto, T., Fukuchi, T., Miyaki, K., The Glaucoma Gene Research Group,
(2005). Genetic Polymorphisms in the Angiotensin II Receptor Gene and Their Association with Open-Angle Glaucoma in a Japanese Population. IOVS
46: 1993-2001
[Abstract][Full Text]
Ozisik, K., Misirlioglu, M., Ulus, T. A, Tuncer, S., Emir, M., Katircioglu, F.
(2005). Renin-Angiotensin System Polymorphisms and Coronary Artery Surgery Patients. Asian Cardiovasc. Thorac. Ann.
13: 153-156
[Abstract][Full Text]
Sprovieri, S R., Sens, Y A.
(2005). Polymorphisms of the renin-angiotensin system genes in Brazilian patients with lupus nephropathy. Lupus
14: 356-362
[Abstract]
Wang, Y., Ng, M. C.Y., So, W. Y., Tong, P. C.Y., Ma, R. C.W., Chow, C. C., Cockram, C. S., Chan, J. C.N.
(2005). Prognostic Effect of Insertion/Deletion Polymorphism of the ACE Gene on Renal and Cardiovascular Clinical Outcomes in Chinese Patients With Type 2 Diabetes. Diabetes Care
28: 348-354
[Abstract][Full Text]
Sayed-Tabatabaei, F A, Schut, A F C, Arias Vasquez, A, Bertoli-Avella, A M, Hofman, A, Witteman, J C M, van Duijn, C M
(2005). Angiotensin converting enzyme gene polymorphism and cardiovascular morbidity and mortality: the Rotterdam Study. J. Med. Genet.
42: 26-30
[Abstract][Full Text]
Schut, A. F.C., Bleumink, G. S., Stricker, B. H.Ch., Hofman, A., Witteman, J. C.M., Pols, H. A.P., Deckers, J. W., Deinum, J., van Duijn, C. M.
(2004). Angiotensin converting enzyme insertion/deletion polymorphism and the risk of heart failure in hypertensive subjects. Eur Heart J
25: 2143-2148
[Abstract][Full Text]
McNamara, D. M., Holubkov, R., Postava, L., Janosko, K., MacGowan, G. A., Mathier, M., Murali, S., Feldman, A. M., London, B.
(2004). Pharmacogenetic interactions between angiotensin-converting enzyme inhibitor therapy and the angiotensin-converting enzyme deletion polymorphism in patients with congestive heart failure. J Am Coll Cardiol
44: 2019-2026
[Abstract][Full Text]
Kuznetsova, T., Staessen, J. A., Thijs, L., Kunath, C., Olszanecka, A., Ryabikov, A., Tikhonoff, V., Stolarz, K., Bianchi, G., Casiglia, E., Fagard, R., Brand-Herrmann, S.-M., Kawecka-Jaszcz, K., Malyutina, S., Nikitin, Y., Brand, E., for the European Project On Genes in Hypertension,
(2004). Left Ventricular Mass in Relation to Genetic Variation in Angiotensin II Receptors, Renin System Genes, and Sodium Excretion. Circulation
110: 2644-2650
[Abstract][Full Text]
Cascorbi, I., Paul, M., Kroemer, H. K.
(2004). Pharmacogenomics of heart failure - focus on drug disposition and action. Cardiovasc Res
64: 32-39
[Abstract][Full Text]
Hotta, J., Hanaoka, M., Droma, Y., Katsuyama, Y., Ota, M., Kobayashi, T.
(2004). Polymorphisms of Renin-Angiotensin System Genes With High-Altitude Pulmonary Edema in Japanese Subjects. Chest
126: 825-830
[Abstract][Full Text]
Rosas-Vargas, H., Coral-Vazquez, R. M., Tapia, R., Borja, J. L., Salas, R. A., Salamanca, F.
(2004). Glu298Asp Endothelial Nitric Oxide Synthase Polymorphism Is a Risk Factor for Erectile Dysfunction in the Mexican Mestizo Population. J Androl
25: 728-732
[Abstract][Full Text]
Doherty, T. M., Fitzpatrick, L. A., Inoue, D., Qiao, J.-H., Fishbein, M. C., Detrano, R. C., Shah, P. K., Rajavashisth, T. B.
(2004). Molecular, Endocrine, and Genetic Mechanisms of Arterial Calcification. Endocr. Rev.
25: 629-672
[Abstract][Full Text]
Heled, Y., Moran, D. S., Mendel, L., Laor, A., Pras, E., Shapiro, Y.
(2004). Human ACE I/D polymorphism is associated with individual differences in exercise heat tolerance. J. Appl. Physiol.
97: 72-76
[Abstract][Full Text]
Wiwanitkit, V.
(2004). Angiotensin-converting Enzyme Gene Polymorphism: I and D Alleles From Some Different Countries. CLIN APPL THROMB HEMOST
10: 179-182
[Abstract]
Eriksson, A.-L., Skrtic, S., Niklason, A., Hulten, L. M., Wiklund, O., Hedner, T., Ohlsson, C.
(2004). Association between the low activity genotype of catechol-O-methyltransferase and myocardial infarction in a hypertensive population. Eur Heart J
25: 386-391
[Abstract][Full Text]
Siani, A., Russo, P., Paolo Cappuccio, F., Iacone, R., Venezia, A., Russo, O., Barba, G., Iacoviello, L., Strazzullo, P.
(2004). Combination of Renin-Angiotensin System Polymorphisms Is Associated With Altered Renal Sodium Handling and Hypertension. Hypertension
43: 598-602
[Abstract][Full Text]
Sayed-Tabatabaei, F A, Schut, A F C, Hofman, A, Bertoli-Avella, A M, Vergeer, J, Witteman, J C M, van Duijn, C M
(2004). A study of gene-environment interaction on the gene for angiotensin converting enzyme: a combined functional and population based approach. J. Med. Genet.
41: 99-103
[Abstract][Full Text]
Doherty, T. M., Fitzpatrick, L. A., Shaheen, A., Rajavashisth, T. B., Detrano, R. C.
(2004). Genetic Determinants of Arterial Calcification Associated With Atherosclerosis. Mayo Clin Proc.
79: 197-210
[Abstract]
Di Pasquale, P., Cannizzaro, S., Paterna, S.
(2004). Does angiotensin-converting enzyme gene polymorphism affect blood pressure? Findings after 6 years of follow-up in healthy subjects. Eur J Heart Fail
6: 11-16
[Abstract][Full Text]
Huang, W., Xie, C., Zhou, H., Yang, T., Sun, M.
(2004). Association of the angiotensin-converting enzyme gene polymorphism with chronic heart failure in Chinese Han patients. Eur J Heart Fail
6: 23-27
[Abstract][Full Text]
Haiman, C. A., Henderson, S. O., Bretsky, P., Kolonel, L. N., Henderson, B. E.
(2003). Genetic Variation in Angiotensin I-Converting Enzyme (ACE) and Breast Cancer Risk: The Multiethnic Cohort. Cancer Res.
63: 6984-6987
[Abstract][Full Text]
Hernandez, D., de la Rosa, A., Barragan, A., Barrios, Y., Salido, E., Torres, A., Martin, B., Laynez, I., Duque, A., De Vera, A., Lorenzo, V., Gonzalez, A.
(2003). The ACE/DD genotype is associated with the extent of exercise-induced left ventricular growth in endurance athletes. J Am Coll Cardiol
42: 527-532
[Abstract][Full Text]
Schmidt, M. A, Chakrabarti, A. K, Kehrer, C., Pfeninnger, D., Brook, R. D, Kaciroti, N., Duvernoy, C., Killeen, A. A, Rajagopalan, S.
(2003). Interactive effects of the ACE DD polymorphism with the NOS III homozygous G849T (Glu298->Asp) variant in determining endothelial function in coronary artery disease. Vasc Med
8: 177-183
[Abstract]
Sayed-Tabatabaei, F. A., Houwing-Duistermaat, J. J., van Duijn, C. M., Witteman, J. C.M.
(2003). Angiotensin-Converting Enzyme Gene Polymorphism and Carotid Artery Wall Thickness: A Meta-Analysis. Stroke
34: 1634-1639
[Abstract][Full Text]
Koch, W., Mehilli, J., von Beckerath, N., Bottiger, C., Schomig, A., Kastrati, A.
(2003). Angiotensin I-converting enzyme (ACE) inhibitors and restenosis after coronary artery stenting in patients with the DD genotype of the ACE gene. J Am Coll Cardiol
41: 1957-1961
[Abstract][Full Text]
Kehoe, P. G
(2003). Review: The renin-angiotensin-aldosterone system and Alzheimer's disease?. Journal of Renin-Angiotensin-Aldosterone System
4: 80-93
[Abstract]
Jacoby, D. S., Rader, D. J.
(2003). Renin-Angiotensin System and Atherothrombotic Disease: From Genes to Treatment. Arch Intern Med
163: 1155-1164
[Abstract][Full Text]
Hamon, M, Fradin, S, Denizet, A, Filippi-Codaccioni, E, Grollier, G, Morello, R
(2003). Prospective evaluation of the effect of an angiotensin I converting enzyme gene polymorphism on the long term risk of major adverse cardiac events after percutaneous coronary intervention. Heart
89: 321-325
[Abstract][Full Text]
Sciarrone, M. T., Stella, P., Barlassina, C., Manunta, P., Lanzani, C., Bianchi, G., Cusi, D.
(2003). ACE and {alpha}-Adducin Polymorphism as Markers of Individual Response to Diuretic Therapy. Hypertension
41: 398-403
[Abstract][Full Text]
Strazzullo, P., Iacone, R., Iacoviello, L., Russo, O., Barba, G., Russo, P., D'Orazio, A., Barbato, A., Cappuccio, F. P., Farinaro, E., Siani, A.
(2003). Genetic Variation in the Renin-Angiotensin System and Abdominal Adiposity in Men: The Olivetti Prospective Heart Study. ANN INTERN MED
138: 17-23
[Abstract][Full Text]
Ruberg, F. L, Loscalzo, J.
(2002). Prothrombotic determinants of coronary atherothrombosis. Vasc Med
7: 289-299
[Abstract]
Abraham, M.R., Olson, L. J., Joyner, M. J., Turner, S. T., Beck, K. C., Johnson, B. D.
(2002). Angiotensin-Converting Enzyme Genotype Modulates Pulmonary Function and Exercise Capacity in Treated Patients With Congestive Stable Heart Failure. Circulation
106: 1794-1799
[Abstract][Full Text]
Fernandez-Sola, J., Nicolas, J. M., Oriola, J., Sacanella, E., Estruch, R., Rubin, E., Urbano-Marquez, A.
(2002). Angiotensin-Converting Enzyme Gene Polymorphism Is Associated with Vulnerability to Alcoholic Cardiomyopathy. ANN INTERN MED
137: 321-326
[Abstract][Full Text]
Volzke, H., Engel, J., Kleine, V., Schwahn, C., Dahm, J. B., Eckel, L., Rettig, R.
(2002). Angiotensin I-Converting Enzyme Insertion/Deletion Polymorphism and Cardiac Mortality and Morbidity After Coronary Artery Bypass Graft Surgery*. Chest
122: 31-36
[Abstract][Full Text]
Taute, B.-M., Glaser, C., Taute, R., Podhaisky, H.
(2002). Progression of Atherosclerosis in Patients with Peripheral Arterial Disease as a Function of Angiotensin-Converting Enzyme Gene Insertion/Deletion Polymorphism. ANGIOLOGY
53: 375-382
[Abstract]
van der Kleij, F. G. H., de Jong, P. E., Henning, R. H., de Zeeuw, D., Navis, G.
(2002). Enhanced Responses of Blood Pressure, Renal Function, and Aldosterone to Angiotensin I in the DD Genotype Are Blunted by Low Sodium Intake. J. Am. Soc. Nephrol.
13: 1025-1033
[Abstract][Full Text]
Lapointe, N., Rouleau, J.-L.
(2002). Activation of vascular tissue angiotensin-converting enzyme (ACE) in heart failure: Effects of ACE inhibitors. J Am Coll Cardiol
39: 776-779
[Full Text]
Ortlepp, J R, Vosberg, H P, Reith, S, Ohme, F, Mahon, N G, Schroder, D, Klues, H G, Hanrath, P, McKenna, W J
(2002). Genetic polymorphisms in the renin-angiotensin-aldosterone system associated with expression of left ventricular hypertrophy in hypertrophic cardiomyopathy: a study of five polymorphic genes in a family with a disease causing mutation in the myosin binding protein C gene. Heart
87: 270-275
[Abstract][Full Text]
Mayer, N J, Forsyth, A, Kantachuvesiri, S, Mullins, J J, Fleming, S
(2002). Association of the D allele of the angiotensin I converting enzyme polymorphism with malignant vascular injury. Mol. Pathol.
55: 29-33
[Abstract][Full Text]
Ferrari, R., Guardigli, G., Cicchitelli, G., Valgimigli, M., Merli, E., Soukhomorskaia, O., Ceconi, C.
(2002). Angiotensin II overproduction: enemy of the vessel wall. Eur Heart J Suppl
4: A26-A30
[Abstract]
Sierra, C., Coca, A., Gomez-Angelats, E., Poch, E., Sobrino, J., de la Sierra, A.
(2002). Renin-Angiotensin System Genetic Polymorphisms and Cerebral White Matter Lesions in Essential Hypertension. Hypertension
39: 343-347
[Abstract][Full Text]
Elung-Jensen, T., Heisterberg, J., Kamper, A.-L., Sonne, J., Strandgaard, S., Larsen, N. E.
(2001). High serum enalaprilat in chronic renal failure. Journal of Renin-Angiotensin-Aldosterone System
2: 240-245
[Abstract]
Fava, S., Azzopardi, J., Ellard, S., Hattersley, A. T.
(2001). ACE Gene Polymorphism as a Prognostic Indicator in Patients With Type 2 Diabetes and Established Renal Disease. Diabetes Care
24: 2115-2120
[Abstract][Full Text]
Agema, W. R. P., Jukema, J. W., Pimstone, S. N., Kastelein, J. J. P.
(2001). Genetic aspects of restenosis after percutaneous coronary interventions;towards more tailored therapy. Eur Heart J
22: 2058-2074
Jorgensen, E., Kelbaek, H., Helqvist, S., Jensen, G. V. H., Saunamaki, K., Kastrup, J., Havndrup, O., Bundgaard, H., Kyst Madsen, J., Christiansen, M., Andersen, P. S., Reiber, J. H. C.
(2001). Predictors of coronary in-stent restenosis: importance of angiotensin-converting enzyme gene polymorphism and treatment with angiotensin-converting enzyme inhibitors. J Am Coll Cardiol
38: 1434-1439
[Abstract][Full Text]
Markus, H., Kapozsta, Z., Ditrich, R., Wolfe, C., Ali, N., Powell, J., Mendell, M., Cullinane, M.
(2001). Increased Common Carotid Intima-Media Thickness in UK African Caribbeans and Its Relation to Chronic Inflammation and Vascular Candidate Gene Polymorphisms. Stroke
32: 2465-2471
[Abstract][Full Text]
Balkestein, E. J., Staessen, J. A., Wang, J.-G., van der Heijden-Spek, J. J., Van Bortel, L. M., Barlassina, C., Bianchi, G., Brand, E., Herrmann, S.-M., Struijker-Boudier, H. A.
(2001). Carotid and Femoral Artery Stiffness in Relation to Three Candidate Genes in a White Population. Hypertension
38: 1190-1197
[Abstract][Full Text]
Kennon, S., Barakat, K., Hitman, G. A., Price, C. P., Mills, P. G., Ranjadayalan, K., Cooper, J., Clark, H., Timmis, A. D.
(2001). Angiotensin-converting enzyme inhibition is associated with reduced troponin release in non-ST-elevation acute coronary syndromes. J Am Coll Cardiol
38: 724-728
[Abstract][Full Text]
Sonna, L. A., Sharp, M. A., Knapik, J. J., Cullivan, M., Angel, K. C., Patton, J. F., Lilly, C. M.
(2001). Angiotensin-converting enzyme genotype and physical performance during US Army basic training. J. Appl. Physiol.
91: 1355-1363
[Abstract][Full Text]
Ryan, A. S., Nicklas, B. J., Berman, D. M., Ferrell, R. E.
(2001). The Insertion/Deletion Polymorphism of the ACE Gene Is Related to Insulin Sensitivity in Overweight Women. Diabetes Care
24: 1646-1652
[Abstract][Full Text]
Somogyvari, F., Szolnoki, Z., Marki-Zay, J., Fodor, L.
(2001). Real-Time PCR Assay with Fluorescent Hybridization Probes for Exact and Rapid Genotyping of the Angiotensin-converting Enzyme Gene Insertion/Deletion Polymorphism. Clin. Chem.
47: 1728-1729
[Full Text]
Harrap, S. B., Petrou, S.
(2001). Utility of genetic approaches to common cardiovascular diseases. Am. J. Physiol. Heart Circ. Physiol.
281: H1-H6
[Full Text]
Mannami, T., Katsuya, T., Baba, S., Inamoto, N., Ishikawa, K., Higaki, J., Ogihara, T., Ogata, J.
(2001). Low Potentiality of Angiotensin-Converting Enzyme Gene Insertion/Deletion Polymorphism as a Useful Predictive Marker for Carotid Atherogenesis in a Large General Population of a Japanese City : The Suita Study. Stroke
32: 1250-1256
[Abstract][Full Text]
Rodriguez-Perez, J. C., Rodriguez-Esparragon, F., Hernandez-Perera, O., Anabitarte, A., Losada, A., Medina, A., Hernandez, E., Fiuza, D., Avalos, O., Yunis, C., Ferrario, C. M., for the PROCAGENE Study Investigators,
(2001). Association of angiotensinogen m235t and a(-6)g gene polymorphisms with coronary heart disease with independence of essential hypertension: the procagene study. J Am Coll Cardiol
37: 1536-1542
[Abstract][Full Text]
van Geel, P P, Pinto, Y M, Zwinderman, A H, Henning, R H, van Boven, A J, Jukema, J W, Bruschke, A V G, Kastelein, J J P, van Gilst, W H, BAXTER, G F
(2001). Increased risk for ischaemic events is related to combined RAS polymorphism. Heart
85: 458-462
[Abstract][Full Text]
McNamara, D. M., Holubkov, R., Janosko, K., Palmer, A., Wang, J. J., MacGowan, G. A., Murali, S., Rosenblum, W. D., London, B., Feldman, A. M.
(2001). Pharmacogenetic Interactions Between {beta}-Blocker Therapy and the Angiotensin-Converting Enzyme Deletion Polymorphism in Patients With Congestive Heart Failure. Circulation
103: 1644-1648
[Abstract][Full Text]
Zee, R. Y. L., Fernandez-Ortiz, A., Macaya, C., Pintor, E., Lindpaintner, K., Fernandez-Cruz, A.
(2001). ACE D/I Polymorphism and Incidence of Post-PTCA Restenosis : A Prospective, Angiography-Based Evaluation. Hypertension
37: 851-855
[Abstract][Full Text]
Rossi, G. P., Taddei, S., Virdis, A., Ghiadoni, L., Albertin, G., Favilla, S., Sudano, I., Pessina, A. C., Salvetti, A.
(2001). Exclusion of the ACE D/I Gene Polymorphism as a Determinant of Endothelial Dysfunction. Hypertension
37: 293-300
[Abstract][Full Text]
Schmieder, R. E., Erdmann, J., Delles, C., Jacobi, J., Fleck, E., Hilgers, K., Regitz-Zagrosek, V.
(2001). Effect of the angiotensin II type 2-receptor gene (+1675 G/A) on left ventricular structure in humans. J Am Coll Cardiol
37: 175-182
[Abstract][Full Text]
Gainer, J. V., Stein, C. M., Neal, T., Vaughan, D. E., Brown, N. J.
(2001). Interactive Effect of Ethnicity and ACE Insertion/Deletion Polymorphism on Vascular Reactivity. Hypertension
37: 46-51
[Abstract][Full Text]
Padmanabhan, N., Padmanabhan, S., Connell, J. M.
(2000). Genetic basis of cardiovascular disease -- the renin-angiotensin-aldosterone system as a paradigm. Journal of Renin-Angiotensin-Aldosterone System
1: 316-324
Batalla, A., Alvarez, R., Reguero, J. R., Hevia, S., Iglesias-Cubero, G., Alvarez, V., Cortina, A., Gonzalez, P., Celada, M. M., Medina, A., Coto, E.
(2000). Synergistic Effect between Apolipoprotein E and Angiotensinogen Gene Polymorphisms in the Risk for Early Myocardial Infarction. Clin. Chem.
46: 1910-1915
[Abstract][Full Text]
Naber, C. K., Husing, J., Wolfhard, U., Erbel, R., Siffert, W.
(2000). Interaction of the ACE D Allele and the GNB3 825T Allele in Myocardial Infarction. Hypertension
36: 986-989
[Abstract][Full Text]
Prasad, A., Narayanan, S., Waclawiw, M. A., Epstein, N., Quyyumi, A. A.
(2000). The insertion/deletion polymorphism of the angiotensin-converting enzyme gene determines coronary vascular tone and nitric oxide activity. J Am Coll Cardiol
36: 1579-1586
[Abstract][Full Text]
Knowles, J. W., Maeda, N.
(2000). Genetic Modifiers of Atherosclerosis in Mice. Arterioscler. Thromb. Vasc. Bio.
20: 2336-2345
[Abstract][Full Text]
Wierzbicki, A. S., Lambert-Hammill, M., Lumb, P. J., Crook, M. A.
(2000). Renin-Angiotensin System Polymorphisms and Coronary Events in Familial Hypercholesterolemia. Hypertension
36: 808-812
[Abstract][Full Text]
Crisan, D., Carr, J.
(2000). Angiotensin I-Converting Enzyme: Genotype and Disease Associations. J. Mol. Diagn.
2: 105-115
[Full Text]
Koch, W., Kastrati, A., Mehilli, J., Bottiger, C., von Beckerath, N., Schomig, A.
(2000). Insertion/Deletion Polymorphism of the Angiotensin I-Converting Enzyme Gene Is Not Associated With Restenosis After Coronary Stent Placement. Circulation
102: 197-202
[Abstract][Full Text]
Prasad, A., Narayanan, S., Husain, S., Padder, F., Waclawiw, M., Epstein, N., Quyyumi, A. A.
(2000). Insertion-Deletion Polymorphism of the ACE Gene Modulates Reversibility of Endothelial Dysfunction With ACE Inhibition. Circulation
102: 35-41
[Abstract][Full Text]
Rankinen, T., Gagnon, J., Perusse, L., Chagnon, Y. C., Rice, T., Leon, A. S., Skinner, J. S., Wilmore, J. H., Rao, D. C., Bouchard, C.
(2000). AGT M235T and ACE ID polymorphisms and exercise blood pressure in the HERITAGE Family Study. Am. J. Physiol. Heart Circ. Physiol.
279: H368-H374
[Abstract][Full Text]
Higaki, J., Baba, S., Katsuya, T., Sato, N., Ishikawa, K., Mannami, T., Ogata, J., Ogihara, T.
(2000). Deletion Allele of Angiotensin-Converting Enzyme Gene Increases Risk of Essential Hypertension in Japanese Men : The Suita Study. Circulation
101: 2060-2065
[Abstract][Full Text]
Rankinen, T., Wolfarth, B., Simoneau, J.-A., Maier-Lenz, D., Rauramaa, R., Rivera, M. A., Boulay, M. R., Chagnon, Y. C., Perusse, L., Keul, J., Bouchard, C.
(2000). No association between the angiotensin-converting enzyme ID polymorphism and elite endurance athlete status. J. Appl. Physiol.
88: 1571-1575
[Abstract][Full Text]
Fatini, C, Abbate, R, Pepe, G, Battaglini, B, Gensini, F, Ruggiano, G, Gensini, G.F, Guazzelli, R
(2000). Searching for a better assessment of the individual coronary risk profile. The role of angiotensin-converting enzyme, angiotensin II type 1 receptor and angiotensinogen gene polymorphisms. Eur Heart J
21: 633-638
[Abstract]
Komiya, I., Yamada, T., Takara, M., Asawa, T., Shimabukuro, M., Nishimori, T., Takasu, N.
(2000). Lys173Arg and -344T/C Variants of CYP11B2 in Japanese Patients With Low-Renin Hypertension. Hypertension
35: 699-703
[Abstract][Full Text]
Delafontaine, P.
(2000). IRS-1 Variant : A New Risk Factor for Coronary Artery Disease?. Arterioscler. Thromb. Vasc. Bio.
20: 283-284
[Full Text]
Agerholm-Larsen, B., Nordestgaard, B. G., Tybjarg-Hansen, A.
(2000). ACE Gene Polymorphism in Cardiovascular Disease : Meta-Analyses of Small and Large Studies in Whites. Arterioscler. Thromb. Vasc. Bio.
20: 484-492
[Abstract][Full Text]
Marian, A. J., Safavi, F., Ferlic, L., Dunn, J. K., Gotto, A. M., Ballantyne, C. M.
(2000). Interactions between angiotensin-I converting enzyme insertion/deletion polymorphism and response of plasma lipids and coronary atherosclerosis to treatment with fluvastatin: The lipoprotein and coronary atherosclerosis study. J Am Coll Cardiol
35: 89-95
[Abstract][Full Text]
Giner, V., Poch, E., Bragulat, E., Oriola, J., Gonzalez, D., Coca, A., Alejandro de la Sierra,
(2000). Renin-Angiotensin System Genetic Polymorphisms and Salt Sensitivity in Essential Hypertension. Hypertension
35: 512-517
[Abstract][Full Text]