Mutation in the Gene Coding for Coagulation Factor V and the Risk of Myocardial Infarction, Stroke, and Venous Thrombosis in Apparently Healthy Men
Paul M. Ridker, M.D., Charles H. Hennekens, M.D., Klaus Lindpaintner, M.D., Meir J. Stampfer, M.D., Paul R. Eisenberg, M.D., and Joseph P. Miletich, M.D.
Background A specific point mutation in the gene coding forcoagulation factor V is associated with resistance to degradationby activated protein C, a recently described abnormality ofcoagulation that may be associated with an increased risk ofvenous thrombosis. Whether this mutation also predisposes patientsto arterial thrombosis is unknown, as is the value of screeningfor the mutation in order to define the risk of venous thrombosisamong unselected healthy people.
Methods Among 14,916 apparently healthy men in the physicians'Health Study who provided base-line blood samples, 374 had myocardialinfarctions, 209 had strokes, and 121 had deep venous thrombosis,pulmonary embolism, or both, during a mean follow-up of 8.6years. We determined whether a mutation at nucleotide position1691 of the factor V gene was present or absent in these 704men and in an equal number of matched participants who remainedfree of vascular disease.
Results The prevalence of heterozygosity for the mutation amongmen who had myocardial infarctions (6.1 percent, P = 0.9) orstrokes (4.3 percent, P = 0.4) was similar to that among menwho remained free of vascular disease (6.0 percent). However,the prevalence of the mutation was significantly higher amongmen who had venous thrombosis, pulmonary embolism, or both (11.6percent, P = 0.02). In adjusted analyses, the relative riskof venous thrombosis among men with the mutation was 2.7 (95percent confidence interval, 1.3 to 5.6; P = 0.008). This increasedrisk was seen with primary venous thrombosis (relative risk,3.5; 95 percent confidence interval, 1.5 to 8.4; P = 0.004)but not with secondary venous thrombosis (relative risk, 1.7;95 percent confidence interval, 0.6 to 5.3; P = 0.3), and itwas most apparent among older men. Specifically, the prevalenceof the mutation among men over the age of 60 in whom primaryvenous thrombosis developed was 25.8 percent (relative risk,7.0; 95 percent confidence interval, 2.6 to 19.1; P < 0.001).
Conclusions In a large cohort of apparently healthy men, thepresence of a specific point mutation in the factor V gene wasassociated with an increased risk of venous thrombosis, particularlyprimary venous thrombosis. The presence of the mutation wasnot associated with an increased risk of myocardial infarctionor stroke. This mutation appears to be the most common inheritedfactor thus far recognized that predisposes patients to venousthrombosis.
A point mutation in which adenine is substituted for guanineat nucleotide 1691 in the gene coding for coagulation factorV has recently been reported to be associated with resistanceto degradation by activated protein C.1,2,3,4 In selected referralpatients evaluated in retrospective case–control studies,this functional abnormality of hemostasis appears to be associatedwith an increased risk of venous thromboembolism.5,6,7,8,9 Resistanceto activated protein C has been described in 7 percent of aSwedish control group,6 whereas the G1691A mutation in the factorV gene is present in 3 to 5 percent of the Dutch population.2,7Among selected young patients with venous thrombosis but nounderlying cancer, the prevalence of resistance to activatedprotein C has ranged from 20 percent to 60 percent.2,6,8 Thus,the available data suggest that this newly described geneticabnormality of coagulation may be substantially more frequentthan all other known inherited predispositions to thrombosis.10,11
It is unknown whether the mutation in the factor V gene predisposeshealthy people to venous thrombosis. Furthermore, whether resistanceto activated protein C is associated with arterial thrombosisis unknown, although several factors associated with coagulation,fibrinolysis, or both, including fibrinogen,12,13,14 factorVII,13 fibrin degradation products,15,16 tissue plasminogenactivator,17,18 and plasminogen-activator inhibitor,19,20 haveall been associated with an increased risk of myocardial infarction,stroke, or both. We therefore investigated whether resistanceto activated protein C, as assessed by the presence of the G1691Amutation in the factor V gene, was associated with the occurrenceof thrombosis in the coronary and cerebral arterial circulations,as well as in venous vessels.
Methods
We evaluated the presence of the G1691A mutation in the coagulationfactor V gene and the risk of thrombosis by studying prospectivelycollected DNA samples from a cohort of apparently healthy menparticipating in the Physicians' Health Study,21 a randomized,double-blind, placebo-controlled trial of aspirin and beta carotenefor the primary prevention of cardiovascular disease and cancer.The details of the Physicians' Health Study have been presentedelsewhere21; in brief, 22,071 predominantly white U.S. malephysicians 40 to 84 years old who were free of prior myocardialinfarction, stroke, transient ischemic attack, and cancer wererandomly assigned in a two-by-two factorial design to one offour treatments: 325 mg of aspirin (Bufferin, Bristol-MyersSquibb), given on alternate days; 50 mg of beta carotene (Lurotin,BASF), given on alternate days; both; and neither. Six monthsafter randomization and once a year thereafter, these physicianswere sent questionnaires on which they were asked to assessrisk factors and disease outcomes; follow-up has been completedfor all deaths and for 99.7 percent of all reported morbid events.
At the time of enrollment, all potentially eligible men wereassigned to receive aspirin as an active drug and placebo manufacturedto resemble beta carotene during an 18-week run-in period inorder to identify those with potentially good compliance forlong-term follow-up. During the run-in period, all participantswere asked to provide base-line EDTA-anticoagulated samplesof whole blood and to return them to the laboratory in a coldpack by overnight courier. On arrival in the laboratory, thespecimens were divided into aliquots and stored at -80°C.Of the 22,071 physicians randomized, 14,916 returned base-lineblood samples (68 percent).
For all reported cases of fatal or nonfatal myocardial infarction,stroke, deep venous thrombosis, or pulmonary embolism occurringafter randomization, the hospital records were requested. Theserecords, as well as death certificates and autopsy reports,were reviewed by an end-points committee of physicians who usedstandardized criteria to confirm or reject the diagnosis ofeach reported event. A diagnosis of myocardial infarction wasconsidered to be confirmed if the reported event met the WorldHealth Organization criteria for myocardial infarction, whichinclude symptoms plus either elevations of cardiac-enzyme levelsor diagnostic changes on the electrocardiogram.22 In the caseof a fatal myocardial infarction, we also accepted diagnosesbased on autopsy findings and deaths confirmed by the medicalrecords as due to coronary heart disease (codes 411 to 414 ofthe International Classification of Diseases). A diagnosis ofstroke was considered to be confirmed if the patient had a newfocal neurologic deficit and if the symptoms and signs persistedfor more than 24 hours. Computed tomographic scans were availablefor more than 95 percent of the confirmed strokes. A diagnosisof deep venous thrombosis was considered to be confirmed whenthere was documentation of a positive venographic study or apositive ultrasonographic study. Reported cases of deep venousthrombosis that were documented by impedance plethysmographyor Doppler examination but not by ultrasonography were not consideredconfirmed. A diagnosis of pulmonary embolism was consideredto be confirmed when a positive angiogram or a completed ventilation–perfusionscan showed at least two segmental perfusion defects withoutventilation defects. Venous thrombosis associated with canceror occurring postoperatively was classified as a secondary event.All other venous thromboses were classified as primary events.
According to the study's nested case–control design, eachphysician who provided an adequate sample of whole blood atbase line and had a confirmed myocardial infarction, stroke,deep venous thrombosis, or pulmonary embolism after randomizationwas matched to one control. The controls were participatingphysicians, each of whom had provided a base-line sample ofwhole blood and reported no cardiovascular disease at the timethe arterial or venous event occurred in the case patient. Thecontrols were selected at random from among participants whomet the matching criteria of age (within one year of the ageof the case patient), smoking habits (current smoker, formersmoker, or person who never smoked), and time since randomization(in six-month intervals).
For each case patient and each control, the whole blood collectedand stored at base line was thawed and underwent DNA extraction.A commercially available process was used that was based onthe absorption of DNA to a silica membrane after lysis witha proprietary agent (Diagen) and proteinase K in the presenceof a high salt concentration and 33 percent isopropanol. Genotypeassays using the polymerase-chain-reaction (PCR) technique wereperformed in a second laboratory, where the investigators andlaboratory personnel were unaware of each subject's status asa case patient or control. Extracted DNA samples from the casepatients and controls were analyzed in pairs, with the sequencevaried at random within the pairs to avoid systematic bias.
The samples in each pair were handled together and in an identicalmanner throughout the processing and analysis. In brief, theG1691A mutation in exon 10 (nucleotides 1487 to 1701) was detectedby the loss of a cleavage site for MnlI. A 267-base-pair (bp)fragment spanning the exon–intron junction was amplifiedfrom genomic DNA as described by Bertina et al.2; an additionalsequence from intron 10 was obtained by sequencing the productfrom 24 samples. Subsequently, an optimized 5' primer (5'ACCCACAGAAAATGATGCCCAG3',nucleotides 1566 to 1587) and a new 3' primer (5'TGCCCCATTATTTAGCCAGGAG3',nucleotides -66 to -87 of intron 10) were used to amplify a223-bp fragment from genomic DNA samples. The PCR conditionswere as follows: 75 to 150 ng of DNA in 15 µl of TRIS–EDTAbuffer (10 mM TRIS and 0.1 mM EDTA; pH 8.0) under 50 µlof mineral oil was heated in a Hybaid thermal cycler to 96°Cfor 60 seconds and 95°C for 180 seconds, and then held at80°C for 10 minutes while 35 µl of amplification solutionwas added that contained 5 µl of 20 mM solution of eachof the deoxynucleoside triphosphates (adenosine triphosphate,cytidine triphosphate, thymidine triphosphate, and guanosinetriphosphate), 200 ng of each primer, 0.1 µl of 1.0 Mmagnesium chloride, and 0.5 U of Taq polymerase (Promega). Thirtycycles of 93°C for 60 seconds, 50°C for 30 seconds,and 72°C for 90 seconds were followed by a final 10 minutesat 72°C. Aliquots (10 µl) were digested for 12 hoursat 37°C with 1 U MnlI (New England Biolabs) after the additionof 2.5 µl of 5x digest buffer (1x digest buffer is 50mmol sodium chloride, 10 mmol TRIS–hydrochloric acid,10 mmol magnesium chloride, and 1 mmol dithiothreitol; pH 7.9).The fragments (measuring 37, 82, and 104 bp for the 1691G allele,and 82 and 141 bp for 1691A) were then separated on 2 percentagarose gels and visualized with ethidium bromide. The presenceof the G1691A mutation was confirmed in each instance by a secondamplification and restriction-enzyme digestion.
In addition to providing blood samples before randomization,the participating physicians also reported their base-line cardiovascularrisk factors, which included the matching variables of age andsmoking status, as well as their height, weight, systolic anddiastolic blood pressure, history of any hypercholesterolemia,parental history of any myocardial infarction before the ageof 60, the presence of any diabetes mellitus, and the frequencyof vigorous exercise. The body-mass index was calculated asthe weight in kilograms divided by the square of the heightin meters.
Statistical Analysis
Means and proportions for base-line cardiovascular risk factorsand for the presence of the factor V mutation were computedfor the case patients and controls. The significance of anydifference in means was tested by the paired Student t-test,whereas the significance of any difference in proportions wastested by the chi-square statistic. Logistic-regression analyseswere performed to estimate relative risks and 95 percent confidenceintervals. Adjusted relative risks were calculated further bylogistic-regression models that controlled for the matchingvariables of age and smoking status as well as for the presenceof hypertension, diabetes, hypercholesterolemia, any familyhistory of myocardial infarction before the age of 60, body-massindex, and frequency of exercise. All regression analyses controlledfor the treatment assignments, and all P values are two-tailed.
Results
The base-line characteristics of men in whom myocardial infarction,stroke, or venous thrombosis developed during follow-up andthose who remained free of cardiovascular disease are shownin Table 1. As expected, the subjects who had myocardial infarctionor stroke during follow-up had a higher prevalence of conventionalatherosclerotic risk factors at base line than did the controlsubjects.
Table 1. Base-Line Clinical Characteristics of 1408 Apparently Healthy Men Participating in the Physicians' Health Study, According to the Development of Cardiovascular Disease during Follow-up.
Among the 704 men who remained free of cardiovascular diseaseduring follow-up, 662 (94.0 percent) were found to be homozygousfor the 1691G allele, whereas 42 (6.0 percent) were heterozygousfor both the 1691G and the 1691A alleles. No 1691A homozygoteswere observed. Thus, the observed frequency of the 1691G allelewas 97.0 percent (95 percent confidence interval, 96.0 to 97.8)and that of the 1691A allele 3.0 percent (95 percent confidenceinterval, 2.2 to 4.1). The observed distribution of genotypeswas consistent with that predicted by the Hardy–Weinbergequilibrium.
No statistically significant differences in the prevalence ofthe factor V mutation were found between the men who had myocardialinfarction (6.1 percent, P = 0.9) or stroke (4.3 percent, P= 0.4) during follow-up and the men who remained free of cardiovasculardisease (6.0 percent). In contrast, the mutation was significantlymore prevalent among men in whom deep venous thrombosis, pulmonaryembolism, or both developed during follow-up (11.6 percent,P = 0.02) (Figure 1).
Figure 1. Prevalence of Heterozygosity for the factor V Mutation among 1408 Apparently Healthy Men in the Physicians' Health Study.
Data shown are for cardiovascular disease occurring during follow-up. No subject was homozygous for the mutated 1691A allele. P values shown are for the comparison with the reference value (dashed line).
Table 2 shows the crude and adjusted relative risks of myocardialinfarction, stroke, and venous thrombosis that were associatedwith the presence of the factor V mutation. The adjusted relativerisk of myocardial infarction or stroke among heterozygous subjectswas 1.3 (95 percent confidence interval, 0.7 to 2.2; P = 0.4).Restricting this analysis to subjects with stroke of clear thromboembolicorigin did not materially alter the results. Specifically, theprevalence of the mutation among men with either myocardialinfarction or thromboembolic stroke was 5.4 percent (adjustedrelative risk, 1.0; 95 percent confidence interval, 0.6 to 1.7;P = 0.9). No association was found between the presence of thefactor V mutation and the risk of myocardial infarction or strokein analyses of subgroups restricted to men 60 years of age orless. Similarly, no association was found among nonsmokers,those with no family history of coronary disease, those withno evidence of hypercholesterolemia, those free of hypertension,or those with all these characteristics (Table 3).
Table 3. Relative Risk of Myocardial Infarction and Stroke Associated with the Presence of the Factor V Mutation among Subjects without the Usual Coronary Risk Factors.
The adjusted relative risk of deep venous thrombosis, pulmonaryembolism, or both among heterozygous subjects was 2.7 (95 percentconfidence interval, 1.3 to 5.6; P = 0.008) (Table 2). To explorefurther the relation between the factor V mutation and the riskof future venous thromboembolism, we repeated these analysesin the 63 subjects with primary venous thrombosis and in the58 subjects in whom the venous thrombosis was determined tobe secondary. In this analysis, the increase in the risk ofdeep venous thrombosis, pulmonary embolism, or both that wasassociated with the presence of the mutation appeared to bedue principally to primary venous thrombosis (adjusted relativerisk, 3.5; 95 percent confidence interval 1.5 to 8.4; P = 0.004)rather than secondary venous thrombosis (adjusted relative risk,1.7; 95 percent confidence interval, 0.6 to 5.3; P = 0.3) (Figure 2).These effects were most apparent among older men. As shownin Table 4, the prevalence of the factor V mutation among menover the age of 60 years in this cohort who subsequently hadany venous thrombosis was 17.9 percent (relative risk, 3.3;95 percent confidence interval, 1.5 to 7.5; P = 0.004). Amongmen over the age of 60 years who had primary venous thrombosis,the prevalence of the mutation was 25.8 percent (relative risk,5.3; 95 percent confidence interval, 2.1 to 13.3; P<0.001).In analyses of heterozygous men older than 60 that were adjustedfor smoking status, history of hypertension, hypercholesterolemia,body-mass index, diabetes, and family history of coronary disease,the relative risk of any venous thrombosis was 4.0 (95 percentconfidence interval, 1.6 to 9.7; P = 0.003) and that of primarydeep venous thrombosis was 7.0 (95 percent confidence interval,2.6 to 19.1; P<0.001).
Figure 2. Adjusted Relative Risk Associated with Primary and Secondary Deep venous Thrombosis or Pulmonary Embolism in Study Subjects with the Factor V Mutation.
Data shown are for cardiovascular disease occurring during follow-up. P values are for the comparison with the reference value (dashed line).
Table 4. Relative Risk of Venous Thrombosis or Pulmonary Embolism Associated with the Presence of the Factor V Mutation among Subjects over the Age of 60.
Discussion
Recent investigations into the protein C system have led tomajor new insights into the process of thrombus formation. In1993 Dahlback and colleagues5 described resistance to activatedprotein C, which appeared to be a characteristic of selectedpatients with venous thromboembolism, particularly those whohad positive family histories and were relatively young at presentation.2,3,4,5,6,7,8,9In rapid succession, studies directed by Bertina2,7 and Dahlback,5,6as well as the Leiden Thrombophilia Study,7 found that the cofactorresponsible for resistance to activated protein C was a previouslyunrecognized form of coagulation factor V that had normal procoagulantactivity but was resistant to degradation by activated proteinC. Almost immediately thereafter, these and other researchersreported that resistance to activated protein C is almost alwaysassociated with the substitution of a single base at nucleotide1691 of the gene coding for coagulation factor V, which leadsto the replacement of arginine by glutamine.2,3,4 The presenceof arginine in this position is essential for the proteolyticinactivation of factor V by activated protein C.
We have described a large-scale epidemiologic assessment ofthe factor V mutation in a healthy population of predominantlywhite men followed prospectively for the occurrence of cardiovasculardisease, in particular arterial and venous thrombosis. Withregard to arterial thrombosis, there appeared to be no associationbetween the presence of the factor V mutation and the risk ofmyocardial infarction, stroke from all causes, or thromboembolicstroke over a follow-up period of 8.6 years. Furthermore, therewas no association between the factor V mutation and myocardialinfarction among younger men or men without risk factors forcardiovascular disease. In contrast, the adjusted relative riskof deep venous thrombosis, pulmonary embolism, or both amongmen with the mutation was 2.7 times that among men without themutation (95 percent confidence interval, 1.3 to 5.6; P = 0.008).For events unrelated to recent surgery or cancer, the presenceof the mutant allele was associated with a threefold increasein risk (adjusted relative risk, 3.5; 95 percent confidenceinterval, 1.5 to 8.4; P = 0.004). Among older men in whom primaryvenous thrombosis developed, the prevalence of the mutationexceeded 25 percent, conferring an adjusted risk of primaryvenous thromboembolism that was 7.0 times higher than that ofmen homozygous for the wild-type allele (95 percent confidenceinterval, 2.6 to 19.1; P<0.001).
Unlike previous studies of resistance to activated protein C,which relied on limited kindreds, patients known to have recurrentidiopathic thromboembolism, or patients referred for the evaluationand treatment of venous thromboembolism,3,4,5,6,7,8,9 the currentstudy was based on a large cohort of apparently healthy menwho were prospectively followed for the development of cardiovasculardisease. Therefore, these findings are not subject to many typesof epidemiologic bias that can influence analyses based on casereports, case series, cross-sectional surveys, and retrospectivestudies of selected referral populations.23 Furthermore, thecurrent study assessed the factor V mutation directly by moleculargenetic analysis rather than by relying on functional assaysto determine the presence of resistance to activated proteinC. Thus, in addition to permitting a prospective evaluationof the relation between the factor V mutation and the risk ofvenous and arterial thrombosis, these data allowed the frequenciesof the wild-type and mutant alleles in a predominantly whiteNorth American male population to be estimated precisely. Onthe basis of the observed data, the allelic frequency of thefactor V mutation is 3.0 percent (95 percent confidence interval,2.2 to 4.1 percent), and the prevalence of the heterozygousstate in the population is 6.0 percent (95 percent confidenceinterval, 4.3 to 8.0 percent). These data provide strong evidencethat genetic resistance to activated protein C is the most commoninherited predisposition to thrombosis recognized to date.10,11
It is important that the factor V mutation is prevalent amongmen over the age of 60 who have a first episode of venous thrombosis,because most earlier studies have suggested that thrombosisassociated with inherited abnormalities of hemostasis typicallypresents at a young age (<40 years). Although the associationbetween inherited coagulation defects and thrombosis may bemodified by age, it is also possible that age-specific differencesbetween the subjects in our study and those in most previousstudies reflect the fact that the referral populations examinedin most earlier retrospective analyses did not include adequatenumbers of older patients. For example, the mean age of patientswith deep venous thrombosis in earlier reports of resistanceto activated protein C ranged from 34 to 46 years — farlower than the mean age of 65 reported in community-based surveysof patients presenting with first venous thromboemboli.24 Inour prospective study of apparently healthy men, the mean ageat the time of the first deep venous thrombosis, pulmonary embolism,or both was 63.2 years. Our finding that the mutation in thefactor V gene is an important risk factor for venous thrombosisin older subjects is consistent with observations from the LeidenThrombophilia Study7 about the prevalence of resistance to activatedprotein C among patients as old as 70.
From a clinical and public health perspective, these data haveimportant implications. It has been estimated that pulmonaryembolism is the primary cause of 50,000 to 100,000 deaths annuallyin the United States and that it is a contributing cause intens of thousands of other deaths.25,26,27 Among older personshospitalized with pulmonary embolism, 21 percent die duringthat hospitalization and another 39 percent die over the next12 months.24,28 Among older patients presenting with deep venousthrombosis, recurrence rates approach 30 percent and one-yearmortality exceeds 20 percent.28,29 Thus, the knowledge that6 percent of the U.S. male population is genetically at increasedrisk for venous thromboembolism raises the possibility thatthese people should be identified and treated differently frompeople without the factor V mutation. For example, it is notknown whether patients with the mutation should be treated withmore prolonged or more intense anticoagulation after a thromboticepisode or whether they require more aggressive prophylacticregimens in high-risk clinical situations, such as electivehip surgery. Thus, randomized trials to determine whether differentanticoagulant regimens are needed by patients with the factorV mutation should be considered seriously. Such studies shouldideally include enough women and members of minority groupsfor associations between the factor V mutation and thrombosisto be evaluated in these populations.
Supported by grants (HL-26490, HL-34595, HL-14147, CA-34944,CA-42182, and CA-40360) from the National Institutes of Health.Dr. Ridker is the recipient of a Clinician Scientist Award fromthe American Heart Association, Dallas. Dr. Lindpaintner isthe recipient of a Research Career Development Award from theNational Heart, Lung, and Blood Institute.
We are indebted to Kirsten Williams and Robert Cannon for theirtechnical assistance.
Source Information
From the Divisions of Preventive Medicine (P.M.R., C.H.H.) and Cardiovascular Disease (P.M.R., K.L.) and the Channing Laboratory (M.J.S.), Department of Medicine, Brigham and Women's Hospital, Harvard Medical School; the Department of Cardiology, Children's Hospital (K.L.); the Department of Ambulatory Care and Prevention, Harvard Medical School (C.H.H.); the Departments of Nutrition (M.J.S.) and Epidemiology (M.J.S., C.H.H.), Harvard School of Public Health — all in Boston; and the Cardiovascular (P.R.E.) and Laboratory Medicine (J.P.M.) Divisions, Washington University School of Medicine, St. Louis.
Address reprint requests to Dr. Ridker at 900 Commonwealth Ave. E., Boston, MA 02215-1204.
References
Dahlback B, Hildebrand B. Inherited resistance to activated protein C is corrected by anticoagulant cofactor activity found to be a property of factor V. Proc Natl Acad Sci U S A 1994;91:1396-1400. [Free Full Text]
Bertina RM, Koeleman BPC, Koster T, et al. Mutation in blood coagulation factor V associated with resistance to activated protein C. Nature 1994;369:64-67. [CrossRef][Medline]
Voorberg J, Roelse J, Koopman R, et al. Association of idiopathic venous thromboembolism with single point-mutation at Arg506 of factor V. Lancet 1994;343:1535-1536. [CrossRef][Medline]
Zoller B, Dahlback B. Linkage between inherited resistance to activated protein C and factor V gene mutation in venous thrombosis. Lancet 1994;343:1536-1538. [CrossRef][Medline]
Dahlback B, Carlsson M, Svensson PJ. Familial thrombophilia due to a previously unrecognized mechanism characterized by poor anticoagulant response to activated protein C: prediction of a cofactor to activated protein C. Proc Natl Acad Sci U S A 1993;90:1004-1008. [Free Full Text]
Svensson PJ, Dahlbäck B. Resistance to activated protein C as a basis for venous thrombosis. N Engl J Med 1994;330:517-522. [Free Full Text]
Koster T, Rosendaal FR, de Ronde H, Briet E, Vandenbroucke JP, Bertina RM. Venous thrombosis due to poor anticoagulant response to activated protein C: Leiden Thrombophilia Study. Lancet 1993;342:1503-1506. [CrossRef][Medline]
Griffin JH, Evatt B, Wideman C, Fernandez JA. Anticoagulant protein C pathway defective in majority of thrombophilic patients. Blood 1993;82:1989-1993. [Free Full Text]
Halbmayer WM, Haushofer A, Schon R, Fischer M. The prevalence of poor anticoagulant response to activated protein C (APC resistance) among patients suffering from stroke or venous thrombosis and among healthy subjects. Blood Coagul Fibrinolysis 1994;5:51-57. [Medline]
Miletich JP, Prescott SM, White R, Majerus PW, Bovill EG. Inherited predisposition to thrombosis. Cell 1993;72:477-480. [CrossRef][Medline]
Heijboer H, Brandjes DPM, Büller HR, Sturk A, ten Cate JW. Deficiencies of coagulation-inhibiting and fibrinolytic proteins in outpatients with deep-vein thrombosis. N Engl J Med 1990;323:1512-1516. [Abstract]
Wilhelmsen L, Svärdsudd K, Korsan-Bengtsen K, Larsson B, Welin L, Tibblin G. Fibrinogen as a risk factor for stroke and myocardial infarction. N Engl J Med 1984;311:501-505. [Abstract]
Meade TW, Mellows S, Brozovic M, et al. Haemostatic function and ischaemic heart disease: principal results of the Northwick Park Heart Study. Lancet 1986;2:533-537. [Medline]
Kannel WB, Wolf PA, Castelli WP, D'Agostino RB. Fibrinogen and risk of cardiovascular disease: the Framingham Study. JAMA 1987;258:1183-1186. [Free Full Text]
Fowkes FGR, Lowe GDO, Housley E, et al. Cross-linked fibrin degradation products, progression of peripheral arterial disease, and risk of coronary heart disease. Lancet 1993;342:84-86. [CrossRef][Medline]
Ridker PM, Hennekens CH, Cerskus A, Stampfer MJ. Plasma concentration of cross-linked fibrin degradation product (D-dimer) and the risk of future myocardial infarction among apparently healthy men. Circulation 1994;90:2236-2240. [Free Full Text]
Ridker PM, Vaughan DE, Stampfer MJ, Manson JE, Hennekens CH. Endogenous tissue-type plasminogen activator and risk of myocardial infarction. Lancet 1993;341:1165-1168. [CrossRef][Medline]
Ridker PM, Hennekens CH, Stampfer MJ, Manson JE, Vaughan DE. Prospective study of endogenous tissue plasminogen activator and risk of stroke. Lancet 1994;343:940-943. [CrossRef][Medline]
Hamsten A, Wiman B, de Faire U, Blombäck M. Increased plasma levels of a rapid inhibitor of tissue plasminogen activator in young survivors of myocardial infarction. N Engl J Med 1985;313:1557-1563. [Abstract]
Hamsten A, de Faire U, Walldius G, et al. Plasminogen activator inhibitor in plasma: risk factor for recurrent myocardial infarction. Lancet 1987;2:3-9. [CrossRef][Medline]
Steering Committee of the Physicians' Health Study Research Group. Final report of the aspirin component of the ongoing Physicians' Health Study. N Engl J Med 1989;321:129-135. [Abstract]
World Health Organization. Ischemic heart disease registers: report of the Fifth work Group, including a second revision of the operating protocol, Copenhagen, Denmark, April 26–29, 1971. Copenhagen, Denmark: World Health Organization, Regional Office for Europe, 1971.
Anderson FA Jr, Wheeler HB, Goldberg RJ, et al. A population-based perspective of the hospital incidence and case-fatality rates of deep vein thrombosis and pulmonary embolism: the Worcester DVT Study. Arch Intern Med 1991;151:933-938. [Free Full Text]
Hirsh J, Genton E, Hull R. Venous thromboembolism. New York: Grune & Stratton, 1981.
Dalen JE, Alpert JS. Natural history of pulmonary embolism. Prog Cardiovasc Dis 1975;17:257-270.
Goldhaber SZ, ed. Pulmonary embolism and deep venous thrombosis. Philadelphia: W.B. Saunders, 1985.
Kniffin WD Jr, Baron JA, Barrett J, Birkmeyer JD, Anderson FA Jr. The epidemiology of diagnosed pulmonary embolism and deep venous thrombosis in the elderly. Arch Intern Med 1994;154:861-866. [Free Full Text]
Prandoni P, lensing AWA, Büller HR, et al. Deep-vein thrombosis and the incidence of subsequent symptomatic cancer. N Engl J Med 1992;327:1128-1133. [Abstract]
Murad, S. D., Plessier, A., Hernandez-Guerra, M., Fabris, F., Eapen, C. E., Bahr, M. J., Trebicka, J., Morard, I., Lasser, L., Heller, J., Hadengue, A., Langlet, P., Miranda, H., Primignani, M., Elias, E., Leebeek, F. W., Rosendaal, F. R., Garcia-Pagan, J.-C., Valla, D. C., Janssen, H. L.A., for EN-Vie (European Network for Vascular Disorder,
(2009). Etiology, Management, and Outcome of the Budd-Chiari Syndrome. ANN INTERN MED
151: 167-175
[Abstract][Full Text]
Celiker, G., Can, U., Verdi, H., Yazici, A. C., Ozbek, N., Atac, F. B.
(2009). Prevalence of Thrombophilic Mutations and ACE I/D Polymorphism in Turkish Ischemic Stroke Patients. CLIN APPL THROMB HEMOST
15: 415-420
[Abstract]
Shaikh, S., Van Cott, E. M.
(2009). The Effect of Argatroban on Activated Protein C Resistance. Am J Clin Pathol
131: 828-833
[Abstract][Full Text]
Kuruvilla, A., Norris, G. M., Manjila, S., Xavier, A. R., Chaturvedi, S.
(2009). Factor V Leiden Mutation in Reocclusion After Intra-Arterial Thrombolysis. Stroke
40: 660-662
[Abstract][Full Text]
Attia, J., Ioannidis, J. P. A., Thakkinstian, A., McEvoy, M., Scott, R. J., Minelli, C., Thompson, J., Infante-Rivard, C., Guyatt, G.
(2009). How to Use an Article About Genetic Association: C: What Are the Results and Will They Help Me in Caring for My Patients?. JAMA
301: 304-308
[Abstract][Full Text]
Dahlback, B.
(2008). Advances in understanding pathogenic mechanisms of thrombophilic disorders. Blood
112: 19-27
[Abstract][Full Text]
Suntharalingam, J., Goldsmith, K., van Marion, V., Long, L., Treacy, C. M., Dudbridge, F., Toshner, M. R., Pepke-Zaba, J., Eikenboom, J. C. J., Morrell, N. W.
(2008). Fibrinogen A{alpha} Thr312Ala polymorphism is associated with chronic thromboembolic pulmonary hypertension. Eur Respir J
31: 736-741
[Abstract][Full Text]
KAMINSKI, M. A., TAN, C. D., ASKARI, A. T.
(2008). A young man with acute weakness of his right arm. Cleveland Clinic Journal of Medicine
75: 145-152
[Full Text]
Madani, M. M., Jamieson, S. W.
(2008). Pulmonary Embolism and Pulmonary Thromboendarterectomy. Card Surg Adult
3: 1309-1332
[Full Text]
Vandenbroucke, J. P., Elm, E. v., Altman, D. G., Gotzsche, P. C., Mulrow, C. D., Pocock, S. J., Poole, C., Schlesselman, J. J., Egger, M., for the STROBE initiative,
(2007). Strengthening the Reporting of Observational Studies in Epidemiology (STROBE): Explanation and Elaboration. ANN INTERN MED
147: W-163-W-194
[Abstract][Full Text]
Egger, M., Altman, D. G, Vandenbroucke, J. P, of the STROBE group,
(2007). Commentary: Strengthening the reporting of observational epidemiology the STROBE statement. Int J Epidemiol
0: dym199v1-dym199
[Full Text]
Goldstein, L. B., Adams, R., Alberts, M. J., Appel, L. J., Brass, L. M., Bushnell, C. D., Culebras, A., DeGraba, T. J., Gorelick, P. B., Guyton, J. R., Hart, R. G., Howard, G., Kelly-Hayes, M., Nixon, J.V., Sacco, R. L.
(2006). Primary Prevention of Ischemic Stroke: A Guideline From the American Heart Association/American Stroke Association Stroke Council: Cosponsored by the Atherosclerotic Peripheral Vascular Disease Interdisciplinary Working Group; Cardiovascular Nursing Council; Clinical Cardiology Council; Nutrition, Physical Activity, and Metabolism Council; and the Quality of Care and Outcomes Research Interdisciplinary Working Group: The American Academy of Neurology affirms the value of this guideline.. Circulation
113: e873-e923
[Abstract][Full Text]
Goldstein, L. B., Adams, R., Alberts, M. J., Appel, L. J., Brass, L. M., Bushnell, C. D., Culebras, A., DeGraba, T. J., Gorelick, P. B., Guyton, J. R., Hart, R. G., Howard, G., Kelly-Hayes, M., Nixon, J.V., Sacco, R. L.
(2006). Primary Prevention of Ischemic Stroke: A Guideline From the American Heart Association/American Stroke Association Stroke Council: Cosponsored by the Atherosclerotic Peripheral Vascular Disease Interdisciplinary Working Group; Cardiovascular Nursing Council; Clinical Cardiology Council; Nutrition, Physical Activity, and Metabolism Council; and the Quality of Care and Outcomes Research Interdisciplinary Working Group: The American Academy of Neurology affirms the value of this guideline.. Stroke
37: 1583-1633
[Abstract][Full Text]
Zee, R. Y.L., Cook, N. R., Cheng, S., Erlich, H. A., Lindpaintner, K., Ridker, P. M
(2006). Polymorphism in the {beta}2-Adrenergic Receptor and Lipoprotein Lipase Genes as Risk Determinants for Idiopathic Venous Thromboembolism: A Multilocus, Population-Based, Prospective Genetic Analysis. Circulation
113: 2193-2200
[Abstract][Full Text]
Sacco, R. L., Adams, R., Albers, G., Alberts, M. J., Benavente, O., Furie, K., Goldstein, L. B., Gorelick, P., Halperin, J., Harbaugh, R., Johnston, S. C., Katzan, I., Kelly-Hayes, M., Kenton, E. J., Marks, M., Schwamm, L. H., Tomsick, T.
(2006). Guidelines for Prevention of Stroke in Patients With Ischemic Stroke or Transient Ischemic Attack: A Statement for Healthcare Professionals From the American Heart Association/American Stroke Association Council on Stroke: Co-Sponsored by the Council on Cardiovascular Radiology and Intervention: The American Academy of Neurology affirms the value of this guideline.. Circulation
113: e409-e449
[Abstract][Full Text]
Kalkanli, S., Ayyildiz, O., Tiftik, N., Batun, S., Isikdogan, A., Ince, H., Tekes, S., Muftuoglu, E.
(2006). Factor V Leiden Mutation in Venous Thrombosis in Southeast Turkey. ANGIOLOGY
57: 193-196
[Abstract]
Sacco, R. L., Adams, R., Albers, G., Alberts, M. J., Benavente, O., Furie, K., Goldstein, L. B., Gorelick, P., Halperin, J., Harbaugh, R., Johnston, S. C., Katzan, I., Kelly-Hayes, M., Kenton, E. J., Marks, M., Schwamm, L. H., Tomsick, T.
(2006). Guidelines for Prevention of Stroke in Patients With Ischemic Stroke or Transient Ischemic Attack: A Statement for Healthcare Professionals From the American Heart Association/American Stroke Association Council on Stroke: Co-Sponsored by the Council on Cardiovascular Radiology and Intervention: The American Academy of Neurology affirms the value of this guideline.. Stroke
37: 577-617
[Abstract][Full Text]
Feinbloom, D., Bauer, K. A.
(2005). Assessment of Hemostatic Risk Factors in Predicting Arterial Thrombotic Events. Arterioscler. Thromb. Vasc. Bio.
25: 2043-2053
[Abstract][Full Text]
Buyru, N., Altinisik, J., Somay, G., Ulutin, T.
(2005). Factor V Leiden Mutation in Cerebrovascular Disease. CLIN APPL THROMB HEMOST
11: 339-342
[Abstract]
Hersh, C. P., DeMeo, D. L., Lange, C., Litonjua, A. A., Reilly, J. J., Kwiatkowski, D., Laird, N., Sylvia, J. S., Sparrow, D., Speizer, F. E., Weiss, S. T., Silverman, E. K.
(2005). Attempted Replication of Reported Chronic Obstructive Pulmonary Disease Candidate Gene Associations. Am. J. Respir. Cell Mol. Bio.
33: 71-78
[Abstract][Full Text]
Andreotti, F., Becker, R. C.
(2005). Atherothrombotic Disorders: New Insights From Hematology. Circulation
111: 1855-1863
[Full Text]
Eitzman, D. T., Westrick, R. J., Shen, Y., Bodary, P. F., Gu, S., Manning, S. L., Dobies, S. L., Ginsburg, D.
(2005). Homozygosity for Factor V Leiden Leads to Enhanced Thrombosis and Atherosclerosis in Mice. Circulation
111: 1822-1825
[Abstract][Full Text]
Duran, R., Biner, B., Demir, M., Celtik, C., Karasalihoglu, S.
(2005). Factor V Leiden Mutation and Other Thrombophilia Markers in Childhood Ischemic Stroke. CLIN APPL THROMB HEMOST
11: 83-88
[Abstract]
Ginsburg, D.
(2005). Genetic Risk Factors for Arterial Thrombosis and Inflammation. ASH Education Book
2005: 442-444
[Abstract][Full Text]
Donahue, B. S.
(2004). The Response to Activated Protein C After Cardiopulmonary Bypass: Impact of Factor V Leiden. Anesth. Analg.
99: 1598-1603
[Abstract][Full Text]
Casas, J. P., Hingorani, A. D., Bautista, L. E., Sharma, P.
(2004). Meta-analysis of Genetic Studies in Ischemic Stroke: Thirty-two Genes Involving Approximately 18 000 Cases and 58 000 Controls. Arch Neurol
61: 1652-1661
[Abstract][Full Text]
Gwinn-Hardy, K., Dawson, V.
(2004). Genomics-Proteomics and Stroke: Introduction. Stroke
35: 2731-2734
[Full Text]
Pullmann, R. Jr, Skerenova, M., Lukac, J., Hybenova, J., Melus, V., Kubisz, P., Rovensky, J., Pullmann, R.
(2004). Factor V Leiden and Prothrombin G20210A Mutations and the Risk of Atherothrombotic Events in Systemic Lupus Erythematosus. CLIN APPL THROMB HEMOST
10: 233-238
[Abstract]
Humphries, S. E., Ridker, P. M., Talmud, P. J.
(2004). Genetic Testing for Cardiovascular Disease Susceptibility: A Useful Clinical Management Tool or Possible Misinformation?. Arterioscler. Thromb. Vasc. Bio.
24: 628-636
[Abstract][Full Text]
Soucie, J. M., Cianfrini, C., Janco, R. L., Kulkarni, R., Hambleton, J., Evatt, B., Forsyth, A., Geraghty, S., Hoots, K., Abshire, T., Curtis, R., Forsberg, A., Huszti, H., Wagner, M., White, G. C. II
(2004). Joint range-of-motion limitations among young males with hemophilia: prevalence and risk factors. Blood
103: 2467-2473
[Abstract][Full Text]
Juul, K., Tybjaerg-Hansen, A., Schnohr, P., Nordestgaard, B. G.
(2004). Factor V Leiden and the Risk for Venous Thromboembolism in the Adult Danish Population. ANN INTERN MED
140: 330-337
[Abstract][Full Text]
van der Neut Kolfschoten, M., Dirven, R. J., Vos, H. L., Tans, G., Rosing, J., Bertina, R. M.
(2004). Factor Va Is Inactivated by Activated Protein C in the Absence of Cleavage Sites at Arg-306, Arg-506, and Arg-679. J. Biol. Chem.
279: 6567-6575
[Abstract][Full Text]
Zee, R. Y.L., Cook, N. R., Cheng, S., Reynolds, R., Erlich, H. A., Lindpaintner, K., Ridker, P. M.
(2004). Polymorphism in the P-selectin and interleukin-4 genes as determinants of stroke: a population-based, prospective genetic analysis. Hum Mol Genet
13: 389-396
[Abstract][Full Text]
McBane, R. D. II
(2003). Genetically Determined Procoagulant States and Heparin Use. SEMIN CARDIOTHORAC VASC ANESTH
7: 427-442
[Abstract]
Colussi, G., Hall, S. W., Nabel, E. G.
(2003). Cardiovascular Genomics. NEJM
349: 1387-1388
[Full Text]
Nabel, E. G.
(2003). Cardiovascular Disease. NEJM
349: 60-72
[Full Text]
Butt, C., Zheng, H., Randell, E., Robb, D., Parfrey, P., Xie, Y.-G.
(2003). Combined carrier status of prothrombin 20210A and factor XIII-A Leu34 alleles as a strong risk factor for myocardial infarction: evidence of a gene-gene interaction. Blood
101: 3037-3041
[Abstract][Full Text]
Ridker, P. M, Goldhaber, S. Z., Danielson, E., Rosenberg, Y., Eby, C. S., Deitcher, S. R., Cushman, M., Moll, S., Kessler, C. M., Elliott, C. G., Paulson, R., Wong, T., Bauer, K. A., Schwartz, B. A., Miletich, J. P., Bounameaux, H., Glynn, R. J., the PREVENT Investigators,
(2003). Long-Term, Low-Intensity Warfarin Therapy for the Prevention of Recurrent Venous Thromboembolism. NEJM
348: 1425-1434
[Abstract][Full Text]
Donahue, B. S., Gailani, D., Higgins, M. S., Drinkwater, D. C., George, A. L. Jr
(2003). Factor V Leiden Protects Against Blood Loss and Transfusion After Cardiac Surgery. Circulation
107: 1003-1008
[Abstract][Full Text]
Deitcher, S. R, Gomes, M. P.
(2003). Hypercoagulable state testing and malignancy screening following venous thromboembolic events. Vasc Med
8: 33-46
[Abstract]
Crowther, M. A., Kelton, J. G.
(2003). Congenital Thrombophilic States Associated with Venous Thrombosis: A Qualitative Overview and Proposed Classification System. ANN INTERN MED
138: 128-134
[Abstract][Full Text]
Dorweiler, B., Neufang, A., Kasper-Koenig, W., Schinzel, H., Schmiedt, W., Oelert, H.
(2003). Arterial Embolism to the Upper Extremity in a Patient with Factor V Leiden Mutation (APC Resistance): A Case Report and Review of the Literature. ANGIOLOGY
54: 125-130
[Abstract]
Madani, M. M., Jamieson, S. W.
(2003). Pulmonary Thromboendarterectomy. Card Surg Adult
2: 1205-1228
[Full Text]
Van Buren, S. F., Heit, J. A., Panneton, J. M., Donohue, J. H.
(2002). Iliac Arterial Thrombosis After Inguinal Hernia Repair. Mayo Clin Proc.
77: 1361-1363
[Abstract]
Austin, H., Chimowitz, M. I., Hill, H. A., Chaturvedi, S., Wechsler, L. R., Wityk, R. J., Walz, E., Wilterdink, J. L., Coull, B., Sila, C. A., Mitsias, P., Evatt, B., Hooper, W. C., Hegele, R. A.
(2002). Cryptogenic Stroke in Relation to Genetic Variation in Clotting Factors and Other Genetic Polymorphisms Among Young Men and Women * Editorial Comment. Stroke
33: 2762-2768
[Abstract][Full Text]
Ruberg, F. L, Loscalzo, J.
(2002). Prothrombotic determinants of coronary atherothrombosis. Vasc Med
7: 289-299
[Abstract]
Miller, K. D., Masur, H., Jones, E. C., Joe, G. O., Rick, M. E., Kelly, G. G., Mican, J. M., Liu, S., Gerber, L. H., Blackwelder, W. C., Falloon, J., Davey, R. T. Jr., Polis, M. A., Walker, R. E., Lane, H. C., Kovacs, J. A.
(2002). High Prevalence of Osteonecrosis of the Femoral Head in HIV-Infected Adults. ANN INTERN MED
137: 17-25
[Abstract][Full Text]
Juul, K., Tybjarg-Hansen, A., Steffensen, R., Kofoed, S., Jensen, G., Nordestgaard, B. G.
(2002). Factor V Leiden: The Copenhagen City Heart Study and 2 meta-analyses. Blood
100: 3-10
[Abstract][Full Text]
Huang, T. J., Liu, M., Knight, L. D., Grody, W. W., Miller, J. F., Ho, C.-M.
(2002). An electrochemical detection scheme for identification of single nucleotide polymorphisms using hairpin-forming probes. Nucleic Acids Res
30: e55-e55
[Abstract][Full Text]
Herrington, D. M., Vittinghoff, E., Howard, T. D., Major, D. A., Owen, J., Reboussin, D. M., Bowden, D., Bittner, V., Simon, J. A., Grady, D., Hulley, S. B.
(2002). Factor V Leiden, Hormone Replacement Therapy, and Risk of Venous Thromboembolic Events in Women With Coronary Disease. Arterioscler. Thromb. Vasc. Bio.
22: 1012-1017
[Abstract][Full Text]
Joffe, H. V, Goldhaber, S. Z
(2002). Laboratory thrombophilias and venous thromboembolism. Vasc Med
7: 93-102
[Abstract]
Folsom, A. R., Cushman, M., Tsai, M. Y., Aleksic, N., Heckbert, S. R., Boland, L. L., Tsai, A. W., Yanez, N. D., Rosamond, W. D.
(2002). A prospective study of venous thromboembolism in relation to factor V Leiden and related factors. Blood
99: 2720-2725
[Abstract][Full Text]
Zee, R. Y.L., Bates, D., Ridker, P. M.
(2002). A Prospective Evaluation of the CD14 and CD18 Gene Polymorphisms and Risk of Stroke. Stroke
33: 892-895
[Abstract][Full Text]
Simioni, P., Tormene, D., Prandoni, P., Zerbinati, P., Gavasso, S., Cefalo, P., Girolami, A.
(2002). Incidence of venous thromboembolism in asymptomatic family members who are carriers of factor V Leiden: a prospective cohort study. Blood
99: 1938-1942
[Abstract][Full Text]
Braunstein, J. B., Kershner, D. W., Bray, P., Gerstenblith, G., Schulman, S. P., Post, W. S., Blumenthal, R. S.
(2002). Interaction of Hemostatic Genetics With Hormone Therapy : New Insights To Explain Arterial Thrombosis in Postmenopausal Women. Chest
121: 906-920
[Abstract][Full Text]
Rossouw, J. E
(2002). Hormones, genetic factors, and gender differences in cardiovascular disease. Cardiovasc Res
53: 550-557
[Full Text]
Boekholdt, S. M., Bijsterveld, N. R., Moons, A. H.M., Levi, M., Buller, H. R., Peters, R. J.G.
(2001). Genetic Variation in Coagulation and Fibrinolytic Proteins and Their Relation With Acute Myocardial Infarction: A Systematic Review. Circulation
104: 3063-3068
[Abstract][Full Text]
Blake, G.J., Schmitz, C., Lindpaintner, K., Ridker, P.M.
(2001). Mutation in the promoter region of the {beta}-fibrinogen gene and the risk of future myocardial infarction, stroke and venous thrombosis. Eur Heart J
22: 2262-2266
[Abstract]
Streifler, J.Y., Rosenberg, N., Chetrit, A., Eskaraev, R., Sela, B.A., Dardik, R., Zivelin, A., Ravid, B., Davidson, J., Seligsohn, U., Inbal, A.
(2001). Cerebrovascular Events in Patients With Significant Stenosis of the Carotid Artery Are Associated With Hyperhomocysteinemia and Platelet Antigen-1 (Leu33Pro) Polymorphism. Stroke
32: 2753-2758
[Abstract][Full Text]
Thomas, R. H.
(2001). Hypercoagulability Syndromes. Arch Intern Med
161: 2433-2439
[Abstract][Full Text]
Lopaciuk, S., Bykowska, K., Kwiecinski, H., Mickielewicz, A., Czlcankawska, A., Mendel, T., Kuczynska-Zardzewialy, A., Szelagowska, D., Windyga, J., Schroder, W., Herrmann, F. H., Jedrzejowska, H.
(2001). Factor V Leiden, Prothrombin Gene G20210A Variant, and Methylenetetrahydrofolate Reductase C677T Genotype in Young Adults With Ischemic Stroke. CLIN APPL THROMB HEMOST
7: 346-350
[Abstract]
Middeldorp, S., Meinardi, J. R., Koopman, M. M.W., van Pampus, E. C.M., Hamulyak, K., van der Meer, J., Prins, M. H., Buller, H. R.
(2001). A Prospective Study of Asymptomatic Carriers of the Factor V Leiden Mutation To Determine the Incidence of Venous Thromboembolism. ANN INTERN MED
135: 322-327
[Abstract][Full Text]
Bauer, K. A.
(2001). The Thrombophilias: Well-Defined Risk Factors with Uncertain Therapeutic Implications. ANN INTERN MED
135: 367-373
[Abstract][Full Text]
Tripodi, A., Mannucci, P. M.
(2001). Laboratory Investigation of Thrombophilia. Clin. Chem.
47: 1597-1606
[Abstract][Full Text]
Catto, A. J.
(2001). Genetic aspects of the hemostatic system in cerebrovascular disease. Neurology
57: S24-30
[Abstract][Full Text]
Cherney, D. Z. I., Zaltzman, J. S.
(2001). Mycophenolate mofetil causing deep venous thrombosis in a renal transplant patient with factor V Leiden. Nephrol Dial Transplant
16: 1702-1704
[Full Text]
Hankey, G. J., Eikelboom, J. W., van Bockxmeer, F. M., Lofthouse, E., Staples, N., Baker, R. I.
(2001). Inherited Thrombophilia in Ischemic Stroke and Its Pathogenic Subtypes. Stroke
32: 1793-1799
[Abstract][Full Text]
Mira, Y., Todoli, J., Alonso, R., Mico, M. L., Vaya, A., Ferrando, F., Estelles, A., Villa, P., Aznar, J.
(2001). Factor V Leiden and Prothrombin G20210A in Relation to Arterial and/or Vein Rethrombosis: Two Cases. CLIN APPL THROMB HEMOST
7: 234-237
[Abstract]
Eldridge, J., Dilley, A., Austin, H., EL-Jamil, M., Wolstein, L., Doris, J., Hooper, W. C., Meehan, P. L., Evatt, B.
(2001). The Role of Protein C, Protein S, and Resistance to Activated Protein C in Legg-Perthes Disease. Pediatrics
107: 1329-1334
[Abstract][Full Text]
Mercuri, E., Cowan, F., Gupte, G., Manning, R., Laffan, M., Rutherford, M., Edwards, A. D., Dubowitz, L., Roberts, I.
(2001). Prothrombotic Disorders and Abnormal Neurodevelopmental Outcome in Infants With Neonatal Cerebral Infarction. Pediatrics
107: 1400-1404
[Abstract][Full Text]
Spooner, P. M., Albert, C., Benjamin, E. J., Boineau, R., Elston, R. C., George, A. L. Jr, Jouven, X., Kuller, L. H., MacCluer, J. W., Marban, E., Muller, J. E., Schwartz, P. J., Siscovick, D. S., Tracy, R. P., Zareba, W., Zipes, D. P.
(2001). Sudden Cardiac Death, Genes, and Arrhythmogenesis : Consideration of New Population and Mechanistic Approaches From a National Heart, Lung, and Blood Institute Workshop, Part II. Circulation
103: 2447-2452
[Abstract][Full Text]
Williams, M. S., Bray, P. F.
(2001). Genetics of Arterial Prothrombotic Risk States. Exp. Biol. Med.
226: 409-419
[Abstract][Full Text]
Kamphuisen, P. W., Eikenboom, J. C. J., Bertina, R. M.
(2001). Elevated Factor VIII Levels and the Risk of Thrombosis. Arterioscler. Thromb. Vasc. Bio.
21: 731-738
[Full Text]
Hademenos, G.J., Alberts, M.J., Awad, I., Mayberg, M., Shephard, T., Jagoda, A., Latchaw, R.E., Todd, H.W., Viste, K., Starke, R., St. John Girgus, M., Walker, M., Marler, J., Emr, M., Hart, N.
(2001). Advances in the genetics of cerebrovascular disease and stroke. Neurology
56: 997-1008
[Abstract][Full Text]
Federman, D. G., Kirsner, R. S.
(2001). An Update on Hypercoagulable Disorders. Arch Intern Med
161: 1051-1056
[Abstract][Full Text]
Ghosh, K., Shetty, S., Madkaikar, M., Pawar, A., Nair, S., Khare, A., Pathare, A., Jijina, F., Mohanty, D.
(2001). Venous Thromboembolism in Young Patients From Western India: A Study. CLIN APPL THROMB HEMOST
7: 158-165
[Abstract]
Isermann, B, Hendrickson, S., Hutley, K, Wing, M, Weiler, H
(2001). Tissue-restricted expression of thrombomodulin in the placenta rescues thrombomodulin-deficient mice from early lethality and reveals a secondary developmental block. Development
128: 827-838
[Abstract]
Goldstein, L. B., Adams, R., Becker, K., Furberg, C. D., Gorelick, P. B., Hademenos, G., Hill, M., Howard, G., Howard, V. J., Jacobs, B., Levine, S. R., Mosca, L., Sacco, R. L., Sherman, D. G., Wolf, P. A., del Zoppo, G. J., Members,
(2001). Primary Prevention of Ischemic Stroke : A Statement for Healthcare Professionals From the Stroke Council of the American Heart Association. Circulation
103: 163-182
[Full Text]
Miles, J. S., Miletich, J. P., Goldhaber, S. Z., Hennekens, C. H., Ridker, P. M.
(2001). G20210A mutation in the prothrombin gene and the risk of recurrent venous thromboembolism. J Am Coll Cardiol
37: 215-218
[Abstract][Full Text]
Reyes, A. A., Ugozzoli, L. A., Lowery, J. D., Breneman, J. W. III, Hixson, C. S., Press, R. D., Wallace, R. B.
(2001). Linked Linear Amplification: A New Method for the Amplification of DNA. Clin. Chem.
47: 31-40
[Abstract][Full Text]
Goldstein, L. B., Adams, R., Becker, K., Furberg, C. D., Gorelick, P. B., Hademenos, G., Hill, M., Howard, G., Howard, V. J., Jacobs, B., Levine, S. R., Mosca, L., Sacco, R. L., Sherman, D. G., Wolf, P. A., del Zoppo, G. J.
(2001). Primary Prevention of Ischemic Stroke : A Statement for Healthcare Professionals From the Stroke Council of the American Heart Association. Stroke
32: 280-299
[Full Text]
Bushnell, C. D., Goldstein, L. B.
(2000). Diagnostic Testing for Coagulopathies in Patients With Ischemic Stroke. Stroke
31: 3067-3078
[Abstract][Full Text]
Van de Water, N. S., French, J. K., Lund, M., Hyde, T. A., White, H. D., Browett, P. J.
(2000). Prevalence of factor v leiden and prothrombin variant g20210a in patients age <50 years with no significant stenoses at angiography three to four weeks after myocardial infarction. J Am Coll Cardiol
36: 717-722
[Abstract][Full Text]
Hassan, A., Markus, H. S.
(2000). Genetics and ischaemic stroke. Brain
123: 1784-1812
[Abstract][Full Text]
Kowalski, A., Radu, D., Gold, B.
(2000). Colorimetric Microwell Plate Detection of the Factor V Leiden Mutation. Clin. Chem.
46: 1195-1198
[Full Text]
Walker, I. D
(2000). Thrombophilia in pregnancy. J. Clin. Pathol.
53: 573-580
[Abstract][Full Text]
Kenet, G., Sadetzki, S., Murad, H., Martinowitz, U., Rosenberg, N., Gitel, S., Rechavi, G., Inbal, A.
(2000). Factor V Leiden and Antiphospholipid Antibodies Are Significant Risk Factors for Ischemic Stroke in Children. Stroke
31: 1283-1288
[Abstract][Full Text]
Kupferminc, M. J., Yair, D., Bornstein, N. M., Lessing, J. B., Eldor, A.
(2000). Transient Focal Neurological Deficits During Pregnancy in Carriers of Inherited Thrombophilia. Stroke
31: 892-895
[Abstract][Full Text]
Cooper, B. A
(2000). Review: high levels of homocysteine are associated with an increased risk for cardiovascular disease. Evid. Based Med.
5: 63-63
[Full Text]
Lane, D. A., Grant, P. J.
(2000). Role of hemostatic gene polymorphisms in venous and arterial thrombotic disease. Blood
95: 1517-1532
[Full Text]
Gerhardt, A., Scharf, R. E., Beckmann, M. W., Struve, S., Bender, H. G., Pillny, M., Sandmann, W., Zotz, R. B.
(2000). Prothrombin and Factor V Mutations in Women with a History of Thrombosis during Pregnancy and the Puerperium. NEJM
342: 374-380
[Abstract][Full Text]
Regeczy, N., Lakos, G., Balogh, I., Ajzner, E., Kiss, E., Szegedi, G.
(2000). State-of-the-Art-Review : The Leiden Mutation of Coagulation Factor V in Hungarian SLE Patients. CLIN APPL THROMB HEMOST
6: 41-45
[Abstract]
Irani-Hakime, N., Tamim, H., Elias, G., Finan, R. R., Daccache, J. L., Almawi, W. Y.
(2000). High Prevalence of Factor V Mutation (Leiden) in the Eastern Mediterranean. Clin. Chem.
46: 134-136
[Full Text]
Feinberg, W. M., Pearce, L. A., Hart, R. G., Cushman, M., Cornell, E. S., Lip, G. Y.H., Bovill, E. G.
(1999). Markers of Thrombin and Platelet Activity in Patients With Atrial Fibrillation : Correlation With Stroke Among 1531 Participants in the Stroke Prevention in Atrial Fibrillation III Study. Stroke
30: 2547-2553
[Abstract][Full Text]
Orum, H., Jakobsen, M. H., Koch, T., Vuust, J., Borre, M. B.
(1999). Detection of the Factor V Leiden Mutation by Direct Allele-specific Hybridization of PCR Amplicons to Photoimmobilized Locked Nucleic Acids. Clin. Chem.
45: 1898-1905
[Abstract][Full Text]
Irish, A.
(1999). Renal allograft thrombosis: can thrombophilia explain the inexplicable?. Nephrol Dial Transplant
14: 2297-2303
[Full Text]
Cheng, S., Grow, M. A., Pallaud, C., Klitz, W., Erlich, H. A., Visvikis, S., Chen, J. J., Pullinger, C. R., Malloy, M. J., Siest, G., Kane, J. P.
(1999). A Multilocus Genotyping Assay for Candidate Markers of Cardiovascular Disease Risk. Genome Res
9: 936-949
[Abstract][Full Text]
Sayinalp, N., Ozcebe, O. I., Kirazli, S., Dogan, R., Dundar, S. V., Gurgey, A.
(1999). Paget-Schroetter Syndrome Associated with FV:Q506 and Prothrombin 20210A: A Case Report. ANGIOLOGY
50: 689-692
[Abstract]
Bonduel, M., Sciuccati, G., Hepner, M., Torres, A. F., Pieroni, G., Frontroth, J. P.
(1999). Prethrombotic Disorders in Children With Arterial Ischemic Stroke and Sinovenous Thrombosis. Arch Neurol
56: 967-971
[Abstract][Full Text]
Previous
