Background Herpesvirus-like DNA sequences have recently beenfound in lesions from patients with Kaposi's sarcoma and theacquired immunodeficiency syndrome (AIDS). It is not known whetherthese sequences are also present in classic Kaposi's sarcomaor in the Kaposi's sarcoma that occurs in homosexual men whoare seronegative for the human immunodeficiency virus (HIV).
Methods We analyzed DNA in tissue samples from patients withAIDS-associated Kaposi's sarcoma, patients with classic Kaposi'ssarcoma, and HIV-seronegative homosexual men with Kaposi's sarcoma.We also analyzed DNA in samples of uninvolved tissue from thesepatients and in control tissue from healthy subjects. All sampleswere tested blindly by polymerase chain reaction (PCR) withspecific primers to amplify KS330233, a herpesvirus-like DNAsequence.
Results The KS330233 PCR product was found in 20 of 21 tissuesamples (95 percent) from the patients with Kaposi's sarcoma,including 10 of the 11 samples from the patients with AIDS-associatedKaposi's sarcoma, all 6 samples from the patients with classicKaposi's sarcoma, and all 4 samples from the HIV-negative homosexualmen with Kaposi's sarcoma. Only 1 of the 21 control samples(5 percent) was positive (odds ratio, 400; 95 percent confidenceinterval, 19 to 17,300). Of the 14 samples of uninvolved skinfrom the patients with Kaposi's sarcoma, 3 were positive forKS330233. Representative PCR-product sequences were more than98 percent identical for the three types of Kaposi's sarcoma,suggesting that all three are caused by the same agent.
Conclusions The same herpesvirus-like DNA sequences are presentin AIDS-associated Kaposi's sarcoma, classic Kaposi's sarcoma,and the Kaposi's sarcoma that occurs in HIV-negative homosexualmen. Therefore, this presumably new human herpesvirus is notsolely an opportunistic infection in patients with AIDS, andthe three forms of Kaposi's sarcoma may be caused by the sameinfectious agent.
Kaposi's sarcoma is the most common neoplasm in patients withthe acquired immunodeficiency syndrome (AIDS),1 and in somecohorts of homosexual men with AIDS, the lifetime risk of Kaposi'ssarcoma approaches 50 percent.2 Epidemiologic evidence suggestsan infectious cause of AIDS-associated Kaposi's sarcoma.3 Surveillancedata indicate that Kaposi's sarcoma is roughly 20 times morelikely to develop in patients with AIDS who are homosexual orbisexual than in those who have hemophilia.1,4 Among homosexualmen with AIDS, the risk of Kaposi's sarcoma is associated withspecific sexual practices5 and geographic locations.4,6
Histopathologically similar forms of Kaposi's sarcoma also occurin people who are seronegative for the human immunodeficiencyvirus (HIV). The classic form is an indolent sarcoma that usuallyoccurs on the lower extremities,7 most often in elderly menof Mediterranean, Middle Eastern, or Eastern European ethnicorigin.8 Evidence that classic Kaposi's sarcoma may have aninfectious cause comes from studies in Sweden indicating anupsurge in cases of classic Kaposi's sarcoma in the 1970s, beforethe AIDS epidemic.9 Serologic studies suggest that this formof Kaposi's sarcoma may be associated with cytomegalovirus infection.10,11
The frequency of Kaposi's sarcoma in HIV-negative homosexualmen is higher than expected, supporting the hypothesis thatthe etiologic agent can be sexually transmitted and is distinctfrom HIV type 1.12 In HIV-seronegative homosexual men with Kaposi'ssarcoma, there is no detectable immunodeficiency and the tumorresembles classic Kaposi's sarcoma in its presentation and clinicalcourse (unpublished data). Endemic Kaposi's sarcoma in Africa13,14and post-transplantation Kaposi's sarcoma15 are additional formsthat occur in immunocompetent and immunocompromised persons,respectively.
Chang et al.16 used representational difference analysis17 toidentify unique DNA sequences associated with Kaposi's sarcomain patients with AIDS. These DNA sequences were shown to beof nonhuman origin and closely homologous to minor capsid andtegument protein genes of the gammaherpesviruses, Epstein–Barrvirus, and herpesvirus saimiri. A polymerase-chain-reaction(PCR) primer set amplifying a sequence of 233 base pairs (bp),designated KS330233, identified these herpesvirus-like sequencesin all 25 tissue specimens from patients with AIDS-associatedKaposi's sarcoma that were both amplifiable and histologicallyconfirmed. In addition, these sequences have been found in specimensof involved tissue from patients with AIDS and body-cavity–basedlymphomas16,18 but not in most samples of uninvolved tissuefrom these patients and not in tissue from patients withoutAIDS.
Although these findings suggest that a new human herpesvirusis the cause of AIDS-associated Kaposi's sarcoma, it is possiblethat this agent preferentially colonizes preexisting Kaposi'ssarcoma in immunosuppressed patients and does not have an etiologicrole.16 To determine whether these herpesvirus-like DNA sequencesare also present in lesions from immunocompetent persons withKaposi's sarcoma, we performed a randomized, blind evaluationto determine the presence of the sequences in tissue samplesfrom patients with AIDS-associated Kaposi's sarcoma, patientswith classic Kaposi's sarcoma, and HIV-seronegative homosexualmen with Kaposi's sarcoma.
Methods
Patient Enrollment
Patients with AIDS-associated Kaposi's sarcoma, patients withclassic Kaposi's sarcoma, and HIV-seronegative homosexual menwith Kaposi's sarcoma seen in a private practice in New YorkCity were enrolled in the study. All patients provided informedconsent to participate in the study and were tested to determinetheir HIV serologic status. Tissue specimens were collectedduring routine clinical examinations. Data on demographic characteristicsand risk factors were collected at the time of enrollment. Thediagnosis of Kaposi's sarcoma was confirmed by histopathologicalexamination. The serologic status of the HIV-seronegative homosexualpatients was confirmed by repeated enzyme-linked immunoassaysand Western blot tests at the time of the diagnosis of Kaposi'ssarcoma.
Tissue Collection, Storage, and Preparation
Tissue specimens were obtained from lesions and from uninvolvedskin at the time of the biopsy. Control skin samples were obtainedfrom patients with neither Kaposi's sarcoma nor AIDS who wereundergoing elective plastic surgery. Control samples of peripheral-bloodmononuclear cells were obtained from healthy, HIV-seronegativedonors.
The tissue specimens were fresh-frozen immediately after removaland stored at -70°C. tissue was generally obtained by punchbiopsy, which limited the amount of DNA available for analysis.
DNA was extracted with chloroform phenol, resuspended in deionizeddistilled water at a concentration of 0.1 µg per microliter,and stored at 4°C.19 Control DNA specimens were extractedfrom peripheral-blood mononuclear cells and excess skin tissueobtained from patients without Kaposi's sarcoma who had undergonecosmetic surgery. All identifying information on control sampleswas removed to maintain confidentiality. To ensure blinding,DNA specimens from Kaposi's sarcoma lesions and from controltissues were extracted and coded in a separate laboratory bypersons uninvolved in PCR testing. Control specimens were randomlydistributed among the batches of samples to be tested. Eachbatch of samples tested included negative controls (those withoutDNA) and positive controls (those containing DNA with the KS330233sequence).
PCR Amplification for KS330233
All DNA samples were confirmed to be amplifiable with PCR primersspecific for a conserved region of a human interferon gene.19PCR primers were synthesized (Operon, Alameda, Calif.) to amplifythe 233-bp KS330233 region of the sequence associated with Kaposi'ssarcoma and AIDS. This sequence is homologous to portions ofthe minor capsid genes ORF26 and BDLF1 of herpesvirus saimiriand the Epstein–Barr virus, respectively.16
Each PCR reaction used approximately 0.2 µg of genomicDNA, 100 pmol of each primer (5'TCCGTGTTGTCTACGTCCAG3' and 5'AGCCGAAAGGATTCCACCAT3'),2 units of Taq polymerase, 100 µM of each deoxynucleotidetriphosphate, 1.5 mm magnesium chloride, 50 mm potassium chloride,10 mm TRIS–hydrochloride (pH 9.0), and 0.1 percent TritonX-100 in a final volume of 50 µl. PCR amplification wascarried out at 94°C for 2 minutes (1 cycle); 94°C for1 minute, 58°C for 1 minute, and 72°c for 1.5 minutes(35 to 40 cycles); and 72°C for 5 minutes (1 cycle). Amplificationswere performed in a Perkin–Elmer 480 Thermocycler (Perkin–ElmerCetus, Norwalk, Conn.) with ramp times of 1 second between steps.Amplification products were visualized on 2 percent agarosegel containing ethidium bromide and were scored for the presenceor absence of the 233-bp fragment. PCR products with a bandin the expected 233-bp region were transferred to nitrocellulosepaper and subjected to Southern blot hybridization with a 25-bpinternal oligomer end-labeled with [-33P]deoxycytidine triphosphate.16PCR reactions were considered positive only if the PCR productsspecifically hybridized in the expected 233-bp region. Significancetesting, with exact confidence intervals, was performed withEpi-Info (USD, Stone Mountain, Ga.).
Representative amplification products from each form of Kaposi'ssarcoma were purified on gel and cloned into pCRII vector withthe TA cloning system (Invitrogen, San Diego, Calif.). Bothsense and antisense strands of the cloned KS330233 product weresequenced by standard methods.16
Results
Demographic Data
Sarcoma tissue was available from 11 patients with AIDS-associatedKaposi's sarcoma, 6 patients with classic Kaposi's sarcoma,and 4 HIV-seronegative homosexual men with Kaposi's sarcoma(Table 1).
Table 1. Demographic and Clinical Characteristics of 21 Patients with Kaposi's Sarcoma.
Among the patients with AIDS-associated Kaposi's sarcoma, themedian age at the time of the diagnosis was 34 years (range,26 to 52). All the patients with AIDS-associated Kaposi's sarcomawere homosexual or bisexual men, except for Patient 1, who reportedno history of sexual relations with men, intravenous drug use,or receipt of blood products and was assumed to have been infectedwith HIV through heterosexual activities. Of the six patientswith classic Kaposi's sarcoma, five were men and one was a woman;their median age was 65 years (range, 54 to 82). None of thefive men reported a history of sexual relations with men orintravenous drug use, and all were HIV-seronegative at the timeof the biopsy. The HIV-seronegative homosexual men had a medianage of 41 years (range, 39 to 58) and were also HIV-seronegativeat the time of the biopsy. The patients with AIDS-associatedKaposi's sarcoma had depressed CD4+ T-cell counts (median count,87 cells per cubic millimeter; range, 14 to 201), whereas theHIV-seronegative homosexual men with Kaposi's sarcoma and thepatients with classic Kaposi's sarcoma had normal counts.
One of the patients with classic Kaposi's sarcoma was of Arabicancestry and had been born in Lebanon (Patient 17), two wereof Russian Jewish ancestry (Patients 12 and 13), and two wereof Italian ancestry (Patients 14 and 15). Among the homosexualmen with Kaposi's sarcoma, only one (Patient 19) was of Italianancestry. All the other patients were of Northern European orHispanic ancestry.
PCR Analysis of KS330233
Tissue samples from the three groups of patients with Kaposi'ssarcoma and control samples were randomly distributed and blindlytested in three batches (Figure 1). Of the 11 samples from thepatients with AIDS-associated Kaposi's sarcoma, 9 were initiallypositive for KS330233 and 1 (the sample from Patient 6) waspositive on repeated blind testing (Table 1); only 1 sample(from patient 3) was negative for KS330233 with PCR performedblindly on two separate DNA samples. Tissue samples from allsix patients with classic Kaposi's sarcoma and all four HIV-seronegativehomosexual men with Kaposi's sarcoma were positive for KS330233.KS330233 was found in samples of uninvolved skin from 3 of 14patients with Kaposi's sarcoma (Table 1). In comparison, 13of these 14 patients had lesions that were positive for KS330233(unmatched odds ratio, 48; 95 percent confidence interval, 3.6to 2201).
Figure 1. Example of KS330233 PCR Amplifications from the First Batch of Tissue Samples from Patients with Kaposi's Sarcoma and Controls.
Amplification products are detectable in DNA samples from an HIV-seronegative homosexual man with Kaposi's sarcoma (lane 1, Patient 18), a patient with classic Kaposi's sarcoma (lane 6, Patient 12), and a patient with AIDS-associated Kaposi's sarcoma (lane 9, Patient 4). One sample from a patient with AIDS-associated Kaposi's sarcoma (lane 4, Patient 3) failed to generate a PCR product detectable by Southern hybridization in repeated blind evaluations. The PCR product was amplifiable in all the remaining 17 samples from the patients with Kaposi's sarcoma (not shown). Samples in lanes 2, 5, and 8 (DNA from uninvolved tissue from patients with Kaposi's sarcoma) and lanes 3 and 7 (control DNA samples from patients without Kaposi's sarcoma) are negative. Lane 10 contains a negative control (no DNA), lane 11 contains a positive control (DNA from a patient with AIDS-associated Kaposi's sarcoma) previously shown to contain Kaposi's sarcoma–associated herpesvirus sequences,16 and lane m is a molecular-weight marker.
Control specimens included 10 samples of peripheral-blood mononuclearcells from healthy HIV-seronegative donors and 11 skin samplesfrom patients without Kaposi's sarcoma (Table 2). Only 1 ofthe 21 control specimens, a skin sample, was positive for KS330233,as compared with 20 of the 21 sarcoma specimens (odds ratio,400; 95 percent confidence interval, 19 to 17,300). After unblinding,repeated PCR examination of the single positive control samplewas negative, suggesting the possibility of a false positiveresult initially.
Table 2. PCR Analysis of KS330233 in DNA Samples from Patients with Kaposi's Sarcoma and Controls.
DNA Sequencing Studies
PCR products from representative samples of the three formsof Kaposi's sarcoma (tissue specimens obtained from Patients1, 2, 4, 12, 13, 16, and 19) were cloned and sequenced (Figure 2).Five KS330233 products (in samples from Patients 1, 4, 13,16, and 19), representing all three forms of Kaposi's sarcoma,differed from the prototypic sequence originally derived froma genomic library made from a Kaposi's sarcoma lesion16 at asingle base-pair position (47) coding for a proline-to-leucinesubstitution. PCR products from lesions in one patient withAIDS-associated Kaposi's sarcoma (Patient 2) and one with classicKaposi's sarcoma (Patient 12) had a second genotype with fivebase-pair substitutions (at positions 46, 47, 69, 146, and 153).Base-pair substitutions at positions 46 and 47 code for a proline-to-isoleucinesubstitution and a base-pair substitution at position 146 codesfor an aspartate-to-glycine substitution, as compared with theprototypic sequence. The remaining base-pair substitutions donot involve amino acid substitutions. The high degree of sequenceconservation among PCR products suggests that the same herpesvirus-likeagent is present in all three forms of Kaposi's sarcoma.
Figure 2. DNA Sequences for KS330233 PCR Products Amplified from Tissue Samples Obtained from Seven Patients withKaposi's Sarcoma.
The sequences are almost identical, suggesting that all three forms of Kaposi's sarcoma are caused by the same agent. Two genotypes were found that differed from the prototypic sequence for Kaposi's sarcoma–associated herpesvirus (KSHV), derived from a genomic library.16 Products from lesions in Patients 1, 4, 13, 16, and 19 had a single base-pair substitution, and products from lesions in Patients 2 and 12 had five base-pair substitutions (substitutions are bold and underlined). No genetic divergence according to the type of Kaposi's sarcoma was detected at this locus for these North American forms of the disease. Patients 1, 2, and 4 had AIDS-associated Kaposi's sarcoma; Patients 12, 13, and 16 had classic kaposi's sarcoma; and Patient 19, a homosexual man, had kaposi's sarcoma without HIV infection.
Discussion
Epidemiologic evidence strongly suggests that both the AIDS-associatedand non–AIDS-associated forms of Kaposi's sarcoma haveinfectious courses.3 Chang et al. derived unique DNA sequencesfrom a lesion in a patient with AIDS-associated Kaposi's sarcoma;these sequences are homologous to but distinct from portionsof three gammaherpesvirus genes found in two separate locations.16Subsequent sequencing studies of a 21-kilobase insert derivedfrom a genomic library of a lesion in a patient with Kaposi'ssarcoma have confirmed its colinearity with members of the gammaherpesvirussubfamily (unpublished data). These sequences thus appear tomark a new human herpesvirus, although isolation and identificationof the virus are pending. This agent has been given the descriptivename Kaposi's sarcoma–associated herpesvirus (KSHV); aformal designation has not yet been made.16
In our blinded evaluation, the KS330233 sequence was specificallyassociated with Kaposi's sarcoma lesions from both patientswith HIV infection and those without infection. This PCR productis a highly sensitive and highly specific marker for the presenceof KSHV sequences in DNA from patients with AIDS-associatedKaposi's sarcoma. DNA from patients with other common humanherpesviruses, such as Epstein–Barr virus and cytomegalovirus,does not amplify KS330233.16 Detection of these sequences inpatients with AIDS-associated Kaposi's sarcoma, patients withclassic Kaposi's sarcoma, and HIV-seronegative homosexual menwith Kaposi's sarcoma suggests that these three forms of Kaposi'ssarcoma are not distinct and that KSHV is an etiologic agentin Kaposi's sarcoma. Although an interaction between endogenousgrowth factors and HIV Tat protein has been hypothesized toplay a part in the pathogenesis of Kaposi's sarcoma,20,21 ourfindings indicate that coincident HIV infection is not necessaryfor the development of the Kaposi's sarcoma phenotype.
Sequence analysis of KS330233 PCR products demonstrates thatthe genome in all three forms of Kaposi's sarcoma is the same,within expected limits of strain variation. Random errors ofTaq polymerase incorporation are unlikely to result in theseconserved genotype patterns. No relation was seen between thedifferent types of Kaposi's sarcoma and these divergent genotypesat this locus. The KS330233 PCR product was not detected initiallyin two samples of lesions from patients with AIDS-associatedKaposi's sarcoma but was detected in one of these samples onrepeated blind examination. The inability to detect the amplifiableproduct in the other sample may have been due to either sequencepolymorphism at the PCR priming site or the absence of infectionwith KSHV.
The variable detection of KS330233 in samples of normal skinfrom patients with Kaposi's sarcoma confirms previous studies16indicating that KS330233 is not a portion of the human genomeand is also consistent with an exogenous infectious process.These findings indicate that the agent may disseminate to tissuethat is phenotypically normal, in both patients with AIDS andthose without AIDS. It is possible that the agent is latentin this tissue, given the high sensitivity of PCR in detectingherpesvirus DNA.22
Despite the detection of KS330233 in association with all threeforms of Kaposi's sarcoma, our study has several important methodologiclimitations. The tissue specimens were obtained from punch biopsies,which limited the amount of DNA available for testing. We weretherefore unable to perform confirmatory Southern hybridizationdirectly on the DNA samples. Although Southern hybridizationis a less sensitive test for specific DNA sequences, it is alsoless likely to have false positive results. Of the 21 controlsamples tested, 1 was initially positive for KS330233 by PCRbut negative on repeated examination. As a conservative assumption,this sample was considered to be positive, but it was probablyfalsely positive. Alternatively, the positive result may reflectthe prevalence of skin infection with KSHV in persons at lowrisk for Kaposi's sarcoma. the variability of sequenced PCRproducts from Kaposi's sarcoma DNA, however, indicates thatour results are not due to carryover PCR contamination or contaminatingDNA sequences. Recent reports have confirmed our findings inHIV-seronegative persons with classic Kaposi's sarcoma.23,24,25
The presence of KSHV sequences in both patients with AIDS-associatedKaposi's sarcoma and HIV-seronegative homosexual men with Kaposi'ssarcoma is consistent with epidemiologic data suggesting thatthe etiologic agent is sexually transmitted.1 These sequencesare also found in lesions from women and heterosexual men withKaposi's sarcoma, however, so male homosexual activity is notthe exclusive mode of transmission. Although additional studiesare needed to determine the modes of transmission, our studyprovides evidence that this herpesvirus-like agent has an etiologicrole in the development of Kaposi's sarcoma in both people withHIV infection and those without infection.
Supported by a grant (U64CCU210852-01) from the Centers forDisease Control and Prevention (to Dr. Moore) and by a PilotStudy Award from the Columbia–Presbyterian Medical CenterOffice of Clinical Trials (to Dr. Chang). Drs. Moore and Changhave applied for a patent for the DNA sequences and their potentialapplications.
We are indebted to Dawn Stelter and Daniela Peruzzi for technicalassistance, to Drs. Michael Shelanksi and Zena Stein for adviceon the experimental design, and to Jan Garbarek for assistancein the preparation of the manuscript.
Source Information
From the Division of Epidemiology, School of Public Health (P.S.M.), and the Department of Pathology, College of Physicians and Surgeons (Y.C.), Columbia University, New York. Tissue DNA specimens were prepared and provided by Dr. Yao-Qi Huang, Dr. Jian J. Li, and Dr. Alvin Friedman-Kien of the Departments of Microbiology and Dermatology, New York University School of Medicine, New York.
Address reprint requests to Dr. Moore at the Division of Epidemiology, PH18, Columbia University, 630 W. 168th St., New York, NY 10032.
References
Beral V, Peterman TA, Berkelman RL, Jaffe HW. Kaposi's sarcoma among persons with AIDS: a sexually transmitted infection? Lancet 1990;335:123-128. [CrossRef][Medline]
Katz MH, Hessol NA, Buchbinder SP, Hirozawa A, O'Malley P, Holmberg SD. Temporal trends of opportunistic infections and malignancies in homosexual men with AIDS. J Infect Dis 1994;170:198-202. [Medline]
Peterman TA, Jaffe HW, Friedman-Kien AE, Weiss RA. The aetiology of Kaposi's sarcoma. Cancer Surv 1991;10:23-37. [Medline]
Archibald CP, Schechter MT, Le TN, Craib KJP, Montaner JSG, O'Shaughnessy MV. Evidence for a sexually transmitted cofactor for AIDS-related Kaposi's sarcoma in a cohort of homosexual men. Epidemiology 1992;3:203-209. [Medline]
Beral V, Bull D, Darby S, et al. Risk of Kaposi's sarcoma and sexual practices associated with faecal contact in homosexual or bisexual men with AIDS. Lancet 1992;339:632-635. [CrossRef][Medline]
Beral V, Bull D, Jaffe H, et al. Is risk of Kaposi's sarcoma in AIDS patients in Britain increased if sexual partners came from United States or Africa? BMJ 1991;302:624-625. [Erratum, BMJ 1991;302:752.]
Friedman-Kien AE, Saltzman BR. Clinical manifestations of classical, endemic African, and epidemic AIDS-associated Kaposi's sarcoma. J Am Acad Dermatol 1990;22:1237-1250. [Medline]
DiGiovanna JJ, Safai B. Kaposi's sarcoma: retrospective study of 90 cases with particular emphasis on the familial occurrence, ethnic background and prevalence of other diseases. Am J Med 1981;71:779-783. [CrossRef][Medline]
Bendsöe N, Dictor M, Blomberg J, Ågren S, Merk K. Increased incidence of Kaposi sarcoma in Sweden before the AIDS epidemic. Eur J Cancer 1990;26:699-702.
Giraldo G, Beth E, Henle W, et al. Antibody patterns to herpesviruses in Kaposi's sarcoma. II. Serological association of American Kaposi's sarcoma with cytomegalovirus. Int J Cancer 1978;22:126-131. [Medline]
Giraldo G, Beth E, Kourilsky FM, et al. Antibody patterns to herpesviruses in Kaposi's sarcoma: serological association of European Kaposi's sarcoma with cytomegalovirus. Int J Cancer 1975;15:839-848. [Medline]
Friedman-Kien AE, Saltzman BR, Cao YZ, et al. Kaposi's sarcoma in HIV-negative homosexual men. Lancet 1990;335:168-169. [Medline]
Ambinder RF, Newman C, Hayward GS, et al. Lack of association of cytomegalovirus with endemic African Kaposi's sarcoma. J Infect Dis 1985;156:193-197.
Kestens L, Melbye M, Biggar RJ, et al. Endemic African Kaposi's sarcoma is not associated with immunodeficiency. Int J Cancer 1985;36:49-54. [Medline]
Penn I. Kaposi's sarcoma in organ transplant recipients: report of 20 cases. Transplantation 1979;27:8-11. [Medline]
Chang Y, Cesarman E, Pessin MS, et al. Identification of herpesvirus-like DNA sequences in AIDS-associated Kaposi's sarcoma. Science 1994;266:1865-1869. [Free Full Text]
Lisitsyn N, Lisitsyn N, Wigler M. Cloning the differences between two complex genomes. Science 1993;259:946-951. [Abstract]
Cesarman E, Chang Y, Moore PS, Said JW, Knowles DM. Kaposi's sarcoma-associated herpesvirus-like DNA sequences in AIDS-related body-cavity-based lymphomas. N Engl J Med 1995;332:1186-1191. [Free Full Text]
Nicolaides A, Huang Y-Q, Li JJ, Zhang WG, Friedman-Kien AE. Gene amplification and multiple mutations of the K-ras oncogene in Kaposi's sarcoma. Anticancer Res 1994;14:921-926. [Medline]
Ensoli B, Gendelman R, Markham P, et al. Synergy between basic fibroblast growth factor and HIV-1 Tat protein in induction of Kaposi's sarcoma. Nature 1994;371:674-680. [CrossRef][Medline]
Huang Y-Q, Li JJ, Moscatelli D, et al. Expression of Int-2 oncogene in Kaposi's sarcoma lesions. J Clin Invest 1993;91:1191-1197.
Gan YJ, Sullivan JL, Sixbey JW. Detection of cell-free Epstein-Barr virus DNA in serum during acute infectious mononucleosis. J Infect Dis 1994;170:436-439. [Medline]
Su I-J, Hsu Y-S, Chang Y-C, Wang I-W. Herpesvirus-like DNA sequence in Kaposi's sarcoma from AIDS and non-AIDS patients in Taiwan. Lancet 1995;345:722-723. [CrossRef][Medline]
Huang Y-Q, Li JJ, Kaplan MH, et al. Human herpesvirus-like nucleic acid in various forms of Kaposi's sarcoma. Lancet 1995;345:759-761. [CrossRef][Medline]
Dupin N, Grandadam M, Calvez V, et al. Herpesvirus-like DNA sequences in patients with Mediterranean Kaposi's sarcoma. Lancet 1995;345:761-762. [CrossRef][Medline]
Ye, F.-C., Zhou, F.-C., Xie, J.-P., Kang, T., Greene, W., Kuhne, K., Lei, X.-F., Li, Q.-H., Gao, S.-J.
(2008). Kaposi's Sarcoma-Associated Herpesvirus Latent Gene vFLIP Inhibits Viral Lytic Replication through NF-{kappa}B-Mediated Suppression of the AP-1 Pathway: a Novel Mechanism of Virus Control of Latency. J. Virol.
82: 4235-4249
[Abstract][Full Text]
Sander, G., Konrad, A., Thurau, M., Wies, E., Leubert, R., Kremmer, E., Dinkel, H., Schulz, T., Neipel, F., Sturzl, M.
(2008). Intracellular Localization Map of Human Herpesvirus 8 Proteins. J. Virol.
82: 1908-1922
[Abstract][Full Text]
Burns, J., Shaknovich, R., Lau, J., Haramati, L. B.
(2007). Oncogenic Viruses in AIDS: Mechanisms of Disease and Intrathoracic Manifestations. Am. J. Roentgenol.
189: 1082-1087
[Abstract][Full Text]
Davis, D. A., Singer, K. E., Reynolds, I. P., Haque, M., Yarchoan, R.
(2007). Hypoxia Enhances the Phosphorylation and Cytotoxicity of Ganciclovir and Zidovudine in Kaposi's Sarcoma-Associated Herpesvirus Infected Cells. Cancer Res.
67: 7003-7010
[Abstract][Full Text]
Brinkmann, M. M., Pietrek, M., Dittrich-Breiholz, O., Kracht, M., Schulz, T. F.
(2007). Modulation of Host Gene Expression by the K15 Protein of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
81: 42-58
[Abstract][Full Text]
Iregbu, K. C., Elegba, O. Y.
(2006). Prevalence of Kaposi's Sarcoma Among Adult HIV-Seropositive Patients Seen in a Designated HIV Treatment and Care Center in Abuja, Nigeria.. J Int Assoc Physicians AIDS Care (Chic Ill)
5: 115-118
[Abstract]
You, J., Srinivasan, V., Denis, G. V., Harrington, W. J. Jr., Ballestas, M. E., Kaye, K. M., Howley, P. M.
(2006). Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen Interacts with Bromodomain Protein Brd4 on Host Mitotic Chromosomes.. J. Virol.
80: 8909-8919
[Abstract][Full Text]
Little, R. F., Pluda, J. M., Wyvill, K. M., Rodriguez-Chavez, I. R., Tosato, G., Catanzaro, A. T., Steinberg, S. M., Yarchoan, R.
(2006). Activity of subcutaneous interleukin-12 in AIDS-related Kaposi sarcoma. Blood
107: 4650-4657
[Abstract][Full Text]
Wang, L., Dittmer, D. P., Tomlinson, C. C., Fakhari, F. D., Damania, B.
(2006). Immortalization of Primary Endothelial Cells by the K1 Protein of Kaposi's Sarcoma-Associated Herpesvirus.. Cancer Res.
66: 3658-3666
[Abstract][Full Text]
Gonzalez, C. M., Wong, E. L., Bowser, B. S., Hong, G. K., Kenney, S., Damania, B.
(2006). Identification and Characterization of the Orf49 Protein of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
80: 3062-3070
[Abstract][Full Text]
Kanne, J. P., Rohrmann, C. A. Jr, Lichtenstein, J. E.
(2006). Eponyms in radiology of the digestive tract: historical perspectives and imaging appearances: part 2. Liver, biliary system, pancreas, peritoneum, and systemic disease.. RadioGraphics
26: 465-480
[Abstract][Full Text]
Barbera, A. J., Chodaparambil, J. V., Kelley-Clarke, B., Joukov, V., Walter, J. C., Luger, K., Kaye, K. M.
(2006). The Nucleosomal Surface as a Docking Station for Kaposi's Sarcoma Herpesvirus LANA. Science
311: 856-861
[Abstract][Full Text]
Zhu, W., Burnette, A., Dorjsuren, D., Roberts, P. E., Huleihel, M., Shoemaker, R. H., Marquez, V. E., Agbaria, R., Sei, S.
(2005). Potent Antiviral Activity of North-Methanocarbathymidine against Kaposi's Sarcoma-Associated Herpesvirus. Antimicrob. Agents Chemother.
49: 4965-4973
[Abstract][Full Text]
Chen, L., Lagunoff, M.
(2005). Establishment and Maintenance of Kaposi's Sarcoma-Associated Herpesvirus Latency in B Cells. J. Virol.
79: 14383-14391
[Abstract][Full Text]
Marchioni, E., Ravaglia, S., Piccolo, G., Furione, M., Zardini, E., Franciotta, D., Alfonsi, E., Minoli, L., Romani, A., Todeschini, A., Uggetti, C., Tavazzi, E., Ceroni, M.
(2005). Postinfectious inflammatory disorders: Subgroups based on prospective follow-up. Neurology
65: 1057-1065
[Abstract][Full Text]
Trento, E., Castilletti, C., Ferraro, C., Lesnoni La Parola, I., Mussi, A., Muscardin, L., Bordignon, V., D'Agosto, G., Amantea, A., Mastroianni, A., Ameglio, F., Fluhr, J., Cordiali-Fei, P.
(2005). Human Herpesvirus 8 Infection in Patients With Cutaneous Lymphoproliferative Diseases. Arch Dermatol
141: 1235-1242
[Abstract][Full Text]
Dagna, L., Broccolo, F., Paties, C. T., Ferrarini, M., Sarmati, L., Praderio, L., Sabbadini, M. G., Lusso, P., Malnati, M. S.
(2005). A Relapsing Inflammatory Syndrome and Active Human Herpesvirus 8 Infection. NEJM
353: 156-163
[Abstract][Full Text]
Cai, X., Lu, S., Zhang, Z., Gonzalez, C. M., Damania, B., Cullen, B. R.
(2005). Kaposi's sarcoma-associated herpesvirus expresses an array of viral microRNAs in latently infected cells. Proc. Natl. Acad. Sci. USA
102: 5570-5575
[Abstract][Full Text]
Gambassi, G., Semeraro, R., Suma, V., Sebastio, A., Antonelli Incalzi, R.
(2005). Aggressive Behavior of Classical Kaposi's Sarcoma and Coexistence With Angiosarcoma. J. Gerontol. A Biol. Sci. Med. Sci.
60: 520-523
[Abstract][Full Text]
Sugaya, M., Watanabe, T., Yang, A., Starost, M. F., Kobayashi, H., Atkins, A. M., Borris, D. L., Hanan, E. A., Schimel, D., Bryant, M. A., Roberts, N., Skobe, M., Staskus, K. A., Kaldis, P., Blauvelt, A.
(2005). Lymphatic dysfunction in transgenic mice expressing KSHV k-cyclin under the control of the VEGFR-3 promoter. Blood
105: 2356-2363
[Abstract][Full Text]
Rickabaugh, T. M., Brown, H. J., Wu, T.-T., Song, M. J., Hwang, S., Deng, H., Mitsouras, K., Sun, R.
(2005). Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8 RTA Reactivates Murine Gammaherpesvirus 68 from Latency. J. Virol.
79: 3217-3222
[Abstract][Full Text]
Lu, C., Zeng, Y., Huang, Z., Huang, L., Qian, C., Tang, G., Qin, D.
(2005). Human Herpesvirus 6 Activates Lytic Cycle Replication of Kaposi's Sarcoma-Associated Herpesvirus. Am. J. Pathol.
166: 173-183
[Abstract][Full Text]
Lu, M., Suen, J., Frias, C., Pfeiffer, R., Tsai, M.-H., Chuang, E., Zeichner, S. L.
(2004). Dissection of the Kaposi's Sarcoma-Associated Herpesvirus Gene Expression Program by Using the Viral DNA Replication Inhibitor Cidofovir. J. Virol.
78: 13637-13652
[Abstract][Full Text]
Srinivasan, V., Komatsu, T., Ballestas, M. E., Kaye, K. M.
(2004). Definition of Sequence Requirements for Latency-Associated Nuclear Antigen 1 Binding to Kaposi's Sarcoma-Associated Herpesvirus DNA. J. Virol.
78: 14033-14038
[Abstract][Full Text]
Verma, S. C., Borah, S., Robertson, E. S.
(2004). Latency-Associated Nuclear Antigen of Kaposi's Sarcoma-Associated Herpesvirus Up-Regulates Transcription of Human Telomerase Reverse Transcriptase Promoter through Interaction with Transcription Factor Sp1. J. Virol.
78: 10348-10359
[Abstract][Full Text]
Chen, X., Lin, K., Ricciardi, R. P.
(2004). Human Kaposi's Sarcoma Herpesvirus Processivity Factor-8 Functions as a Dimer in DNA Synthesis. J. Biol. Chem.
279: 28375-28386
[Abstract][Full Text]
Liang, Y., Ganem, D.
(2004). RBP-J (CSL) Is Essential for Activation of the K14/vGPCR Promoter of Kaposi's Sarcoma-Associated Herpesvirus by the Lytic Switch Protein RTA. J. Virol.
78: 6818-6826
[Abstract][Full Text]
Lim, C., Choi, C., Choe, J.
(2004). Mitotic Chromosome-Binding Activity of Latency-Associated Nuclear Antigen 1 Is Required for DNA Replication from Terminal Repeat Sequence of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
78: 7248-7256
[Abstract][Full Text]
Lan, K., Kuppers, D. A., Verma, S. C., Robertson, E. S.
(2004). Kaposi's Sarcoma-Associated Herpesvirus-Encoded Latency-Associated Nuclear Antigen Inhibits Lytic Replication by Targeting Rta: a Potential Mechanism for Virus-Mediated Control of Latency. J. Virol.
78: 6585-6594
[Abstract][Full Text]
Wang, L., Wakisaka, N., Tomlinson, C. C, DeWire, S. M, Krall, S., Pagano, J. S, Damania, B.
(2004). The Kaposi's Sarcoma-Associated Herpesvirus (KSHV/HHV-8) K1 Protein Induces Expression of Angiogenic and Invasion Factors. Cancer Res.
64: 2774-2781
[Abstract][Full Text]
Barbera, A. J., Ballestas, M. E., Kaye, K. M.
(2004). The Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen 1 N Terminus Is Essential for Chromosome Association, DNA Replication, and Episome Persistence. J. Virol.
78: 294-301
[Abstract][Full Text]
An, J., Sun, Y., Rettig, M. B.
(2004). Transcriptional coactivation of c-Jun by the KSHV-encoded LANA. Blood
103: 222-228
[Abstract][Full Text]
Verma, S. C., Robertson, E. S.
(2003). ORF73 of Herpesvirus Saimiri Strain C488 Tethers the Viral Genome to Metaphase Chromosomes and Binds to cis-Acting DNA Sequences in the Terminal Repeats. J. Virol.
77: 12494-12506
[Abstract][Full Text]
Yao, L., Salvucci, O., Cardones, A. R., Hwang, S. T., Aoki, Y., De La Luz Sierra, M., Sajewicz, A., Pittaluga, S., Yarchoan, R., Tosato, G.
(2003). Selective expression of stromal-derived factor-1 in the capillary vascular endothelium plays a role in Kaposi sarcoma pathogenesis. Blood
102: 3900-3905
[Abstract][Full Text]
Cool, C. D., Rai, P. R., Yeager, M. E., Hernandez-Saavedra, D., Serls, A. E., Bull, T. M., Geraci, M. W., Brown, K. K., Routes, J. M., Tuder, R. M., Voelkel, N. F.
(2003). Expression of Human Herpesvirus 8 in Primary Pulmonary Hypertension. NEJM
349: 1113-1122
[Abstract][Full Text]
Song, M. J., Deng, H., Sun, R.
(2003). Comparative Study of Regulation of RTA-Responsive Genes in Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8. J. Virol.
77: 9451-9462
[Abstract][Full Text]
Izumiya, Y., Lin, S.-F., Ellison, T. J., Levy, A. M., Mayeur, G. L., Izumiya, C., Kung, H.-J.
(2003). Cell Cycle Regulation by Kaposi's Sarcoma-Associated Herpesvirus K-bZIP: Direct Interaction with Cyclin-CDK2 and Induction of G1 Growth Arrest. J. Virol.
77: 9652-9661
[Abstract][Full Text]
Tomescu, C., Law, W. K., Kedes, D. H.
(2003). Surface Downregulation of Major Histocompatibility Complex Class I, PE-CAM, and ICAM-1 following De Novo Infection of Endothelial Cells with Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
77: 9669-9684
[Abstract][Full Text]
Fujimuro, M., Hayward, S. D.
(2003). The Latency-Associated Nuclear Antigen of Kaposi's Sarcoma-Associated Herpesvirus Manipulates the Activity of Glycogen Synthase Kinase-3{beta}. J. Virol.
77: 8019-8030
[Abstract][Full Text]
Tang, Y.-W., Johnson, J. E., Browning, P. J., Cruz-Gervis, R. A., Davis, A., Graham, B. S., Brigham, K. L., Oates, J. A. Jr., Loyd, J. E., Stecenko, A. A.
(2003). Herpesvirus DNA Is Consistently Detected in Lungs of Patients with Idiopathic Pulmonary Fibrosis. J. Clin. Microbiol.
41: 2633-2640
[Abstract][Full Text]
Dourmishev, L. A., Dourmishev, A. L., Palmeri, D., Schwartz, R. A., Lukac, D. M.
(2003). Molecular Genetics of Kaposi's Sarcoma-Associated Herpesvirus (Human Herpesvirus 8) Epidemiology and Pathogenesis. Microbiol. Mol. Biol. Rev.
67: 175-212
[Abstract][Full Text]
Watanabe, T., Sugaya, M., Atkins, A. M., Aquilino, E. A., Yang, A., Borris, D. L., Brady, J., Blauvelt, A.
(2003). Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen Prolongs the Life Span of Primary Human Umbilical Vein Endothelial Cells. J. Virol.
77: 6188-6196
[Abstract][Full Text]
Nakamura, H., Lu, M., Gwack, Y., Souvlis, J., Zeichner, S. L., Jung, J. U.
(2003). Global Changes in Kaposi's Sarcoma-Associated Virus Gene Expression Patterns following Expression of a Tetracycline-Inducible Rta Transactivator. J. Virol.
77: 4205-4220
[Abstract][Full Text]
Guo, H.-G., Sadowska, M., Reid, W., Tschachler, E., Hayward, G., Reitz, M.
(2003). Kaposi's Sarcoma-Like Tumors in a Human Herpesvirus 8 ORF74 Transgenic Mouse. J. Virol.
77: 2631-2639
[Abstract][Full Text]
Wang, X.-P., Gao, S.-J.
(2003). Auto-activation of the transforming viral interferon regulatory factor encoded by Kaposi's sarcoma-associated herpesvirus (human herpesvirus-8). J. Gen. Virol.
84: 329-336
[Abstract][Full Text]
Izumiya, Y., Lin, S.-F., Ellison, T., Chen, L.-Y., Izumiya, C., Luciw, P., Kung, H.-J.
(2002). Kaposi's Sarcoma-Associated Herpesvirus K-bZIP Is a Coregulator of K-Rta: Physical Association and Promoter-Dependent Transcriptional Repression. J. Virol.
77: 1441-1451
[Abstract][Full Text]
Bowser, B. S., DeWire, S. M., Damania, B.
(2002). Transcriptional Regulation of the K1 Gene Product of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
76: 12574-12583
[Abstract][Full Text]
Shinohara, H., Fukushi, M., Higuchi, M., Oie, M., Hoshi, O., Ushiki, T., Hayashi, J.-I., Fujii, M.
(2002). Chromosome Binding Site of Latency-Associated Nuclear Antigen of Kaposi's Sarcoma-Associated Herpesvirus Is Essential for Persistent Episome Maintenance and Is Functionally Replaced by Histone H1. J. Virol.
76: 12917-12924
[Abstract][Full Text]
Li, H., Komatsu, T., Dezube, B. J., Kaye, K. M.
(2002). The Kaposi's Sarcoma-Associated Herpesvirus K12 Transcript from a Primary Effusion Lymphoma Contains Complex Repeat Elements, Is Spliced, and Initiates from a Novel Promoter. J. Virol.
76: 11880-11888
[Abstract][Full Text]
Lim, C., Sohn, H., Lee, D., Gwack, Y., Choe, J.
(2002). Functional Dissection of Latency-Associated Nuclear Antigen 1 of Kaposi's Sarcoma-Associated Herpesvirus Involved in Latent DNA Replication and Transcription of Terminal Repeats of the Viral Genome. J. Virol.
76: 10320-10331
[Abstract][Full Text]
DeWire, S. M., McVoy, M. A., Damania, B.
(2002). Kinetics of Expression of Rhesus Monkey Rhadinovirus (RRV) and Identification and Characterization of a Polycistronic Transcript Encoding the RRV Orf50/Rta, RRV R8, and R8.1 Genes. J. Virol.
76: 9819-9831
[Abstract][Full Text]
Samaniego, F., Young, D., Grimes, C., Prospero, V., Christofidou-Solomidou, M., DeLisser, H. M., Prakash, O., Sahin, A. A., Wang, S.
(2002). Vascular Endothelial Growth Factor and Kaposi's Sarcoma Cells in Human Skin Grafts. Cell Growth Differ.
13: 387-395
[Abstract][Full Text]
Ryan, P, Aarons, S, Murray, D, Markham, T, O'Sullivan, S, Lyons, F, Lee, G, Fitzgibbon, J
(2002). Human herpesvirus 8 (HHV-8) detected in two patients with Kaposi's sarcoma-like pyogenic granuloma. J. Clin. Pathol.
55: 619-622
[Abstract][Full Text]
Otieno, M. W., Banura, C., Katongole-Mbidde, E., Johnson, J. L., Ghannoum, M., Dowlati, A., Renne, R., Arts, E., Whalen, C., Lederman, M. M., Remick, S. C.
(2002). Therapeutic Challenges of AIDS-Related Non-Hodgkin's Lymphoma in the United States and East Africa. JNCI J Natl Cancer Inst
94: 718-732
[Abstract][Full Text]
Webster-Cyriaque, J.
(2002). Development of Kaposi's Sarcoma in a Surgical Wound. NEJM
346: 1207-1210
[Full Text]
Song, M. J., Li, X., Brown, H. J., Sun, R.
(2002). Characterization of Interactions between RTA and the Promoter of Polyadenylated Nuclear RNA in Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8. J. Virol.
76: 5000-5013
[Abstract][Full Text]
Zhu, F. X., King, S. M., Smith, E. J., Levy, D. E., Yuan, Y.
(2002). A Kaposi's sarcoma-associated herpesviral protein inhibits virus-mediated induction of type I interferon by blocking IRF-7 phosphorylation and nuclear accumulation. Proc. Natl. Acad. Sci. USA
99: 5573-5578
[Abstract][Full Text]
Barillari, G., Ensoli, B.
(2002). Angiogenic Effects of Extracellular Human Immunodeficiency Virus Type 1 Tat Protein and Its Role in the Pathogenesis of AIDS-Associated Kaposi's Sarcoma. Clin. Microbiol. Rev.
15: 310-326
[Abstract][Full Text]
Wang, X.-P., Zhang, Y.-J., Deng, J.-H., Pan, H.-Y., Zhou, F.-C., Gao, S.-J.
(2002). Transcriptional Regulation of Kaposi's Sarcoma-associated Herpesvirus-encoded Oncogene Viral Interferon Regulatory Factor by a Novel Transcriptional Silencer, Tis. J. Biol. Chem.
277: 12023-12031
[Abstract][Full Text]
Lam, L. L., Pau, C.-P., Dollard, S. C., Pellett, P. E., Spira, T. J.
(2002). Highly Sensitive Assay for Human Herpesvirus 8 Antibodies That Uses a Multiple Antigenic Peptide Derived from Open Reading Frame K8.1. J. Clin. Microbiol.
40: 325-329
[Abstract][Full Text]
An, J., Lichtenstein, A. K., Brent, G., Rettig, M. B.
(2002). The Kaposi sarcoma-associated herpesvirus (KSHV) induces cellular interleukin 6 expression: role of the KSHV latency-associated nuclear antigen and the AP1 response element. Blood
99: 649-654
[Abstract][Full Text]
AuCoin, D. P., Pari, G. S.
(2002). The human herpesvirus-8 (Kaposi's sarcoma-associated herpesvirus) ORF 40/41 region encodes two distinct transcripts. J. Gen. Virol.
83: 189-193
[Abstract][Full Text]
Wang, S., Liu, S., Wu, M.-H., Geng, Y., Wood, C.
(2001). Identification of a Cellular Protein That Interacts and Synergizes with the RTA (ORF50) Protein of Kaposi's Sarcoma-Associated Herpesvirus in Transcriptional Activation. J. Virol.
75: 11961-11973
[Abstract][Full Text]
Toschi, E., Barillari, G., Sgadari, C., Bacigalupo, I., Cereseto, A., Carlei, D., Palladino, C., Zietz, C., Leone, P., Sturzl, M., Butto, S., Cafaro, A., Monini, P., Ensoli, B.
(2001). Activation of Matrix-Metalloproteinase-2 and Membrane-Type-1-Matrix-Metalloproteinase in Endothelial Cells and Induction of Vascular Permeability In Vivo by Human Immunodeficiency Virus-1 Tat Protein and Basic Fibroblast Growth Factor. Mol. Biol. Cell
12: 2934-2946
[Abstract][Full Text]
Landau, H. J., Poiesz, B. J., Dube, S., Bogart, J. A., Weiner, L. B., Souid, A.-K.
(2001). Classic Kaposi's Sarcoma Associated with Human Herpesvirus 8 Infection in a 13-Year-Old Male: A Case Report. Clin. Cancer Res.
7: 2263-2268
[Abstract][Full Text]
Tarp, B., Jensen-Fangel, S., Dahl, R., Obel, N.
(2001). Herpesvirus type 1-8 in BAL fluid from HIV-1-infected patients with suspected pneumonia and from healthy individuals. Eur Respir J
18: 146-150
[Abstract][Full Text]
Sepkowitz, K. A.
(2001). AIDS -- The First 20 Years. NEJM
344: 1764-1772
[Full Text]
Davis, D. A., Rinderknecht, A. S., Zoeteweij, J. P., Aoki, Y., Read-Connole, E. L., Tosato, G., Blauvelt, A., Yarchoan, R.
(2001). Hypoxia induces lytic replication of Kaposi sarcoma-associated herpesvirus. Blood
97: 3244-3250
[Abstract][Full Text]
Piolot, T., Tramier, M., Coppey, M., Nicolas, J.-C., Marechal, V.
(2001). Close but Distinct Regions of Human Herpesvirus 8 Latency-Associated Nuclear Antigen 1 Are Responsible for Nuclear Targeting and Binding to Human Mitotic Chromosomes. J. Virol.
75: 3948-3959
[Abstract][Full Text]
Wang, Q. J., Jenkins, F. J., Jacobson, L. P., Kingsley, L. A., Day, R. D., Zhang, Z.-W., Meng, Y.-X., Pellet, P. E., Kousoulas, K. G., Baghian, A., Rinaldo, C. R. Jr
(2001). Primary human herpesvirus 8 infection generates a broadly specific CD8+ T-cell response to viral lytic cycle proteins. Blood
97: 2366-2373
[Abstract][Full Text]
Zoeteweij, J. P., Moses, A. V., Rinderknecht, A. S., Davis, D. A., Overwijk, W. W., Yarchoan, R., Orenstein, J. M., Blauvelt, A.
(2001). Targeted inhibition of calcineurin signaling blocks calcium-dependent reactivation of Kaposi sarcoma-associated herpesvirus. Blood
97: 2374-2380
[Abstract][Full Text]
Song, M. J., Brown, H. J., Wu, T.-T., Sun, R.
(2001). Transcription Activation of Polyadenylated Nuclear RNA by Rta in Human Herpesvirus 8/Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
75: 3129-3140
[Abstract][Full Text]
Ballestas, M. E., Kaye, K. M.
(2001). Kaposi's Sarcoma-Associated Herpesvirus Latency-Associated Nuclear Antigen 1 Mediates Episome Persistence through cis-Acting Terminal Repeat (TR) Sequence and Specifically Binds TR DNA. J. Virol.
75: 3250-3258
[Abstract][Full Text]
O'Donovan, M, Silva, I, Uhlmann, V, Bermingham, N, Luttich, K, Martin, C, Sheils, O, Killalea, A, Kenny, C, Pileri, S, O'Leary, J J
(2001). Expression profile of human herpesvirus 8 (HHV-8) in pyothorax associated lymphoma and in effusion lymphoma. Mol. Pathol.
54: 80-85
[Abstract][Full Text]
Cerimele, F., Curreli, F., Ely, S., Friedman-Kien, A. E., Cesarman, E., Flore, O.
(2001). Kaposi's Sarcoma-Associated Herpesvirus Can Productively Infect Primary Human Keratinocytes and Alter Their Growth Properties. J. Virol.
75: 2435-2443
[Abstract][Full Text]
Park, J., Seo, T., Hwang, S., Lee, D., Gwack, Y., Choe, J.
(2000). The K-bZIP Protein from Kaposi's Sarcoma-Associated Herpesvirus Interacts with p53 and Represses Its Transcriptional Activity. J. Virol.
74: 11977-11982
[Abstract][Full Text]
Chan, S. R., Chandran, B.
(2000). Characterization of Human Herpesvirus 8 ORF59 Protein (PF-8) and Mapping of the Processivity and Viral DNA Polymerase-Interacting Domains. J. Virol.
74: 10920-10929
[Abstract][Full Text]
Samaniego, F., Pati, S., Karp, J. E., Prakash, O., Bose, D.
(2000). Human Herpesvirus 8 K1-Associated Nuclear Factor-kappa B-Dependent Promoter Activity: Role in Kaposi's Sarcoma Inflammation?. J Natl Cancer Inst Monogr
2000: 15-23
[Abstract][Full Text]
Duvic, M., Friedman-Kien, A. E., Looney, D. J., Miles, S. A., Myskowski, P. L., Scadden, D. T., Von Roenn, J., Galpin, J. E., Groopman, J., Loewen, G., Stevens, V., Truglia, J. A., Yocum, R. C.
(2000). Topical Treatment of Cutaneous Lesions of Acquired Immunodeficiency Syndrome-Related Kaposi Sarcoma Using Alitretinoin Gel: Results of Phase 1 and 2 Trials. Arch Dermatol
136: 1461-1469
[Abstract][Full Text]
Lim, C., Sohn, H., Gwack, Y., Choe, J.
(2000). Latency-associated nuclear antigen of Kaposi's sarcoma-associated herpesvirus (human herpesvirus-8) binds ATF4/CREB2 and inhibits its transcriptional activation activity. J. Gen. Virol.
81: 2645-2652
[Abstract][Full Text]
Krithivas, A., Young, D. B., Liao, G., Greene, D., Hayward, S. D.
(2000). Human Herpesvirus 8 LANA Interacts with Proteins of the mSin3 Corepressor Complex and Negatively Regulates Epstein-Barr Virus Gene Expression in Dually Infected PEL Cells. J. Virol.
74: 9637-9645
[Abstract][Full Text]
Wu, L., Lo, P., Yu, X., Stoops, J. K., Forghani, B., Zhou, Z. H.
(2000). Three-Dimensional Structure of the Human Herpesvirus 8 Capsid. J. Virol.
74: 9646-9654
[Abstract][Full Text]
Chang, J., Ganem, D.
(2000). On the control of late gene expression in Kaposi's sarcoma-associated herpesvirus (human herpesvirus-8). J. Gen. Virol.
81: 2039-2047
[Abstract][Full Text]
Zhang, Y.-J., Deng, J.-H., Rabkin, C., Gao, S.-J.
(2000). Hot-spot variations of Kaposi's sarcoma-associated herpesvirus latent nuclear antigen and application in genotyping by PCR-RFLP. J. Gen. Virol.
81: 2049-2058
[Abstract][Full Text]
Little, R. F., Wyvill, K. M., Pluda, J. M., Welles, L., Marshall, V., Figg, W. D., Newcomb, F. M., Tosato, G., Feigal, E., Steinberg, S. M., Whitby, D., Goedert, J. J., Yarchoan, R.
(2000). Activity of Thalidomide in AIDS-Related Kaposi's Sarcoma. JCO
18: 2593-2602
[Abstract][Full Text]
Sgadari, C., Toschi, E., Palladino, C., Barillari, G., Carlei, D., Cereseto, A., Ciccolella, C., Yarchoan, R., Monini, P., Sturzl, M., Ensoli, B.
(2000). Mechanism of Paclitaxel Activity in Kaposi's Sarcoma. J. Immunol.
165: 509-517
[Abstract][Full Text]
Spira, T. J., Lam, L., Dollard, S. C., Meng, Y.-X., Pau, C. P., Black, J. B., Burns, D., Cooper, B., Hamid, M., Huong, J., Kite-Powell, K., Pellett, P. E.
(2000). Comparison of Serologic Assays and PCR for Diagnosis of Human Herpesvirus 8 Infection. J. Clin. Microbiol.
38: 2174-2180
[Abstract][Full Text]
Mercader, M., Taddeo, B., Panella, J. R., Chandran, B., Nickoloff, B. J., Foreman, K. E.
(2000). Induction of HHV-8 Lytic Cycle Replication by Inflammatory Cytokines Produced by HIV-1-Infected T Cells. Am. J. Pathol.
156: 1961-1971
[Abstract][Full Text]
Husain, S. R., Puri, R. K.
(2000). Interleukin-13 fusion cytotoxin as a potent targeted agent for AIDS-Kaposi's sarcoma xenograft. Blood
95: 3506-3513
[Abstract][Full Text]
Pica, F., Volpi, A., Serafino, A., Fraschetti, M., Franzese, O., Garaci, E.
(2000). Autocrine nerve growth factor is essential for cell survival and viral maturation in HHV-8-infected primary effusion lymphoma cells. Blood
95: 2905-2912
[Abstract][Full Text]
Katano, H., Iwasaki, T., Baba, N., Terai, M., Mori, S., Iwamoto, A., Kurata, T., Sata, T.
(2000). Identification of Antigenic Proteins Encoded by Human Herpesvirus 8 and Seroprevalence in the General Population and among Patients with and without Kaposi's Sarcoma. J. Virol.
74: 3478-3485
[Abstract][Full Text]
Alexander, L., Denekamp, L., Knapp, A., Auerbach, M. R., Damania, B., Desrosiers, R. C.
(2000). The Primary Sequence of Rhesus Monkey Rhadinovirus Isolate 26-95: Sequence Similarities to Kaposi's Sarcoma-Associated Herpesvirus and Rhesus Monkey Rhadinovirus Isolate 17577. J. Virol.
74: 3388-3398
[Abstract][Full Text]
Aboulafia, D. M.
(2000). The Epidemiologic, Pathologic, and Clinical Features of AIDS-Associated Pulmonary Kaposi’s Sarcoma. Chest
117: 1128-1145
[Abstract][Full Text]
Damania, B., Choi, J.-K., Jung, J. U.
(2000). Signaling Activities of Gammaherpesvirus Membrane Proteins. J. Virol.
74: 1593-1601
[Full Text]
Perna, A. M., Bonura, F., Vitale, F., Viviano, E., Di Benedetto, M. A., Ajello, F., Villafrate, M. R., Prestileo, T., Mancuso, S., Goedert, J. J, Romano, N.
(2000). Antibodies to human herpes virus type 8 (HHV8) in general population and in individuals at risk for sexually transmitted diseases in Western Sicily. Int J Epidemiol
29: 175-179
[Abstract][Full Text]
Gustafson, E. A., Schinazi, R. F., Fingeroth, J. D.
(2000). Human Herpesvirus 8 Open Reading Frame 21 Is a Thymidine and Thymidylate Kinase of Narrow Substrate Specificity That Efficiently Phosphorylates Zidovudine but Not Ganciclovir. J. Virol.
74: 684-692
[Abstract][Full Text]
Dittmer, D., Stoddart, C., Renne, R., Linquist-Stepps, V., Moreno, M.E., Bare, C., McCune, J.M., Ganem, D.
(1999). Experimental Transmission of Kaposi's Sarcoma-associated Herpesvirus (KSHV/HHV-8) to SCID-hu Thy/Liv Mice. J. Exp. Med.
190: 1857-1868
[Abstract][Full Text]
Mansfield, K. G., Westmoreland, S. V., DeBakker, C. D., Czajak, S., Lackner, A. A., Desrosiers, R. C.
(1999). Experimental Infection of Rhesus and Pig-Tailed Macaques with Macaque Rhadinoviruses. J. Virol.
73: 10320-10328
[Abstract][Full Text]
Varthakavi, V., Browning, P. J., Spearman, P.
(1999). Human Immunodeficiency Virus Replication in a Primary Effusion Lymphoma Cell Line Stimulates Lytic-Phase Replication of Kaposi's Sarcoma-Associated Herpesvirus. J. Virol.
73: 10329-10338
[Abstract][Full Text]
-33P]deoxycytidine triphosphate.16 PCR reactions were considered positive only if the PCR products specifically hybridized in the expected 233-bp region. Significance testing, with exact confidence intervals, was performed with Epi-Info (USD, Stone Mountain, Ga.). 
