Mutation of the Androgen-Receptor Gene in Metastatic Androgen-Independent Prostate Cancer
Mary-Ellen Taplin, M.D., Glenn J. Bubley, M.D., Todd D. Shuster, M.D., Martha E. Frantz, Amy E. Spooner, George K. Ogata, Harold N. Keer, M.D., Ph.D., and Steven P. Balk, M.D.
Background Metastatic prostate cancer is a leading cause ofcancer-related death in men. The rate of response to androgenablation is high, but most patients relapse as a result of theoutgrowth of androgen-independent tumor cells. The androgenreceptor, which binds testosterone and stimulates the transcriptionof androgen-responsive genes, regulates the growth of prostatecells. We analyzed the androgen-receptor genes from samplesof metastatic androgen-independent prostate cancers to determinewhether mutations in the gene have a role in androgen independence.
Methods Complementary DNA was synthesized from metastatic prostatecancers in 10 patients with androgen-independent prostate cancer,and the expression of the androgen-receptor gene was estimatedby amplification with the polymerase chain reaction. Exons Bthrough H of the gene were cloned, and mutations were identifiedby DNA sequencing. The functional effects of the mutations wereassessed in cells transfected with mutant genes.
Results All androgen-independent tumors expressed high levelsof androgen-receptor gene transcripts, relative to the levelsexpressed by an androgen-independent prostate-cancer cell line(LnCap). Point mutations in the androgen-receptor gene wereidentified in metastatic cells from 5 of the 10 patients examined.One mutation was in the same codon as the mutation found previouslyin the androgen-independent prostate-cancer cell line. The mutationswere not detected in the primary tumors from two of the patients.Functional studies of two of the mutant androgen receptors demonstratedthat they could be activated by progesterone and estrogen.
Conclusions Most metastatic androgen-independent prostate cancersexpress high levels of androgen-receptor gene transcripts. Mutationsin androgen-receptor genes are not uncommon and may providea selective growth advantage after androgen ablation.
Prostate cancer is the most commonly diagnosed malignant conditionand the second leading cause of cancer-related death in Americanmen.1 In its early stage the disease is sometimes curable byradical prostatectomy or radiation therapy. However, metastasesare common at presentation and they ultimately afflict manypatients who were treated with curative intent when they hadearly-stage disease. The only effective treatment for metastaticprostate cancer is reduction of testosterone and 5-dihydrotestosteroneconcentrations (androgen ablation), by either orchiectomy orthe administration of an agonist of luteinizing hormonereleasinghormone (LHRH). The rate of response to androgen ablation canbe as high as 80 percent, but the duration of response is only12 to 18 months.2 The effect of androgen ablation may be augmentedby flutamide, an androgen antagonist that acts on the androgenreceptor to block the effects of androgens derived from theadrenal gland.3
The mechanisms by which tumor cells escape androgen ablationand become independent of the need for androgen are not understood.Salvage therapy with cytotoxic chemotherapy has generally notbeen effective in patients with androgen-independent prostatecancer.4 Secondary hormonal treatments with estrogens, progesterones,or glucocorticoids can induce short-term partial responses ina minority of patients.4 Interestingly, a rate of improvementof 30 to 40 percent after flutamide withdrawal has been reportedin patients with androgen-independent prostate cancer who receivedboth flutamide and testicular androgen ablation.5
Androgens are required for the development of both the normalprostate and prostate cancer.6 Androgens act through the androgenreceptor, which belongs to the steroid-receptor superfamilyof ligand-dependent transcription factors.7,8 This superfamilyincludes receptors for thyroid hormone, retinoic acid, estrogen,progesterone, glucocorticoids, and other steroid hormones. Thestructure of the androgen receptor is prototypical, with anN-terminal transactivating domain (exon A) and a C-terminalhormone-binding domain (exons D through H) (Figure 1). Betweenthese areas lies the DNA-binding domain (exons B and C), withits two zinc fingers that bind to specific DNA sequences, termedandrogen-responsive elements. Once bound to androgen, the androgenreceptor regulates the expression of androgen-responsive genesby binding to their androgen-responsive elements and by interactingwith other transcription factors. A notable gene regulated byandrogen in prostate cells encodes the prostate-specific antigen.9
Figure 1. Structure of the androgen receptor and Primers Used for PCR Amplification.
Exons A through H and the locations of the transactivating, DNA-binding, and hormone-binding domains are shown. The positions and orientations of the primers used are also shown. The sequences of the primers are as follows: 1, CTACGGCTACACTCGGCCCCCTCA; 2, CGACTTCACCGCACCTGATGTGT; 3, GCATGGTGAGCAGAGTGCCCTATC; 4, AAACATGGTCCCTGGCAGTCTCCA; 5, TCCCAGAGTCATCCCTGCTTCAT; 6, TAACAGGCAGAAGACATCTGAAAG; and 7, ACAGACTGTACATCAATAGAGGAAATTC. UT denotes untranslated.
Androgen ablation causes dramatic regression of prostate cancerand normal prostate tissue in most patients and in animal modelsof prostate cancer.10 At the cellular level, androgen ablationinduces programmed cell death, or apoptosis,11 which appearsto be mediated directly or indirectly by unligated androgenreceptors. It seems, therefore, that androgen-independent prostate-cancercells can escape the apoptosis induced by androgen ablation.A mechanism for this escape could be by mutations in the androgen-receptorgene that allow the receptors to stimulate the growth of prostatecells in the absence of androgen. Mutations in the androgen-receptorgene have been shown to cause the androgen-insensitivity syndrome12,13,14and the spinal and bulbar muscular atrophy syndrome,15 but theyhave been detected only rarely in prostate cancer. In a largenumber of primary prostate cancers analyzed by several groups,only a single mutant androgen-receptor gene was identified.16,17,18,19,20
The androgen-receptor genes of metastatic androgen-independentprostate cancers have not been examined extensively, owing partlyto difficulty in obtaining the appropriate tissue. Nevertheless,recent reports suggest that mutations in the androgen-receptorgene can occur in androgen-independent prostate cancer.18,19,21In this report we show that in 5 of 10 patients with metastaticandrogen-independent prostate cancer, the androgen-receptorgenes had point mutations, all in the hormone-binding domain.One mutation was in the same codon as the previously describedmutation in the prostate-cancer cell line (LNCaP).22 Functionalstudies showed that two of the mutant androgen receptors couldbe activated by progesterone and estrogen. These results suggestthat mutant androgen-receptor genes are a selective advantagein metastatic androgen-independent prostate cancer, perhapsbecause they remain active after androgen ablation.
Methods
Tissue Procurement and Synthesis of Complementary DNA
Prostate-tumor tissue was obtained from patients with metastaticprostate cancer in relapse after androgen ablation by eitherorchiectomy or the administration of an LHRH agonist. When possible,bone marrow biopsies of posterior iliac-crest metastases weredone at sites that correlated with abnormalities identifiedon bone scans. Other bone marrow samples were obtained at sitesof pathologic fractures or from other metastatic sites. Allsamples were snap-frozen in liquid nitrogen and stored at -80°Cuntil analysis. RNA was extracted from 4 to 10 frozen sectionsmeasuring 10 µm, and complementary DNA (cDNA) was synthesizedaccording to standard methods, as described previously.23 Additionalfrozen sections were analyzed microscopically to confirm thepresence of prostate cancer in the samples.
Quantitation of cDNA and Expression of Androgen Receptors
To estimate the amount of cDNA in each sample, amplificationswith the polymerase chain reaction (PCR) were carried out withprimers for the ubiquitously expressed protein beta2-microglobulin.24Serial dilutions of cDNA were amplified by PCR with a beta2-microglobulinsense primer spanning exons 1 and 2 (atccagcgtactccaaagattcag)and an antisense primer in exon 4 (aaattgaaagttaacttatgcacgc).Each 20-µl reaction mixture contained cDNA, 50 ng of eachprimer, 100 µg of bovine serum albumin per milliliter,0.2 mM deoxynucleoside triphosphates, 1.5 mM magnesium chloride,50 mM potassium chloride, 10 mM TRIS (pH 9.0 at 25°C), and1 U of Taq DNA polymerase. PCR amplifications were done for25 to 30 cycles at 94°C for 20 seconds, 55°C for 30seconds, and 72°C for 60 seconds, followed by a 7-minuteextension at 72°C. The PCR products were separated on agarosegels, underwent Southern blotting with a beta2-microglobulinprobe (cacgtcatccagcaga, the sense primer in exon 2), and werequantitated with a phosphorimager (Molecular Dynamics, Sunnyvale,Calif.).
Approximately equal amounts of cDNA, on the basis of the expressionof beta2-microglobulin, were then amplified by PCR with androgen-receptorprimers 3 and 5, located in exons A and C, respectively (Figure 1),and primers for beta2-microglobulin. The PCR reactions werecarried out for 24 cycles exactly as described above, exceptfor the inclusion of 50 ng of each androgen-receptor primer.This number of cycles was determined in preliminary experimentsto precede the plateau phase of the reaction. The products wereanalyzed on agarose gels and then hybridized with internal oligonucleotideprobes specific for beta2-microglobulin (see above) and androgenreceptor (primer 4).
PCR Amplification, Cloning, and Sequencing of the Androgen Receptor
The androgen-receptor gene was amplified by PCR with primers1 and 7, located at the 3' end of exon A and in the 3' untranslatedregion, respectively (Figure 1). A seminested PCR was then carriedout with an internal primer in exon A (primer 2). The PCR productswere then digested with KpnI and PstI (which cut the samplejust 3' of primer 2 in exon A and 5' of primer 7 in exon H)and cloned into the PstI and KpnI sites of pBluescript. Bacterialcolonies containing the androgen receptor were identified byhybridization, and multiple isolates from each patient wereselected. Plasmids were purified and subjected to double-strandedsequencing with Sequenase and a series of internal sequencingprimers, as described by the manufacturer (United States Biochemicals,Cleveland). Between 10 and 14 plasmids from each patient weresequenced. Additional sequencing of plasmids and direct sequencingof PCR products were carried out on a DNA sequencer (model 373A,Applied Biosystems, Foster City, Calif.) with Taq DNA polymeraseand fluorescent dideoxynucleotides (Applied Biosystems). Basechanges were determined to be mutations, rather than Taq polymeraseerrors, on the basis of their identification in multiple plasmidsand their isolation after a second independent PCR amplificationand analysis.
Functional Analysis of Mutant Androgen Receptors
Mutations in the androgen-receptor genes were cloned into theandrogen-receptor expression vector pSV.ARo (kindly providedby Dr. Albert Brinkmann, Erasmus University, Rotterdam, theNetherlands).25 The reporter plasmid MMTVpA3LUC was derivedfrom pHHLUC26 and contained the luciferase gene under the controlof an androgen-responsive element in the mouse-mammary-tumor-viruslong terminal repeat (kindly provided by Dr. Richard Pestell,Northwestern University Medical School, Chicago). All experimentsalso included a pSV--galactosidase plasmid to control for theefficiency of transfection (Promega, Madison, Wis.). Transienttransfections into CV-1 cells were carried out in triplicatewith calcium phosphate (Mammalian Cell Transfection Kit, SpecialtyMedia, Lavallette, N.J.) as described by the manufacturer. Approximately12 hours after the transfections were initiated, the cells werewashed and placed in medium containing steroid hormonefreefetal-calf serum for 4 hours. Hormones were then added, andthe cells were incubated for another 24 hours. The cells werethen lysed, and luciferase and -galactosidase activity weremeasured.
Results
Expression of Androgen Receptors in Bone Marrow Metastases from Patients with Androgen-Independent Prostate Cancer
Patients with advanced androgen-independent prostate cancergenerally have widespread metastatic disease in the bone marrow.Previous studies showed that the level of expression of androgenreceptors by normal lymphoid and myeloid cells was quite lowor absent.27 We therefore used a semiquantitative reverse-transcriptasePCR method to measure androgen-receptor transcripts in bonemarrow in the presence or absence of prostate cancer.
Figure 2 shows that bone marrow samples from four patients withandrogen-independent prostate cancer who were treated by androgenablation had readily detectable levels of androgen-receptorgene transcripts (lanes 1, 3, 4, and 5). The levels in thesemarrow samples were similar to the level expressed by LNCaP(lane 7). In contrast, expression of the androgen-receptor genewas not detectable in samples from patients who were in completeremission after androgen ablation (Figure 2, lane 2, and datanot shown). Since none of these samples contained pure populationsof tumor cells (Figure 2), the average level of androgen-receptortranscripts in the tumor cells was high relative to that inLNCaP. Figure 2 also shows the level of androgen-receptor genetranscripts in a biopsy specimen obtained during a channel transurethralprostatectomy in a patient with androgen-independent prostatecancer (lane 6). This sample contained a large proportion oftumor cells and showed a correspondingly high level of androgen-receptorgene transcripts.
Figure 2. Results of Semiquantitative Reverse-Transcriptase PCR Amplification of the Androgen Receptor.
Samples were amplified simultaneously to measure the amount of beta2-microglobulin and androgen-receptor cDNA, subjected to Southern blotting, and hybridized with internal oligonucleotide probes for beta2-microglobulin and androgen receptor. Lanes 1, 3, 4, and 5 show bone marrow specimens from patients with advanced androgen-independent prostate cancer (the sample in lane 5 was completely replaced by tumor, whereas the other biopsy specimens had scattered foci of tumor); lane 2, a bone marrow specimen from a patient with prostate cancer in complete remission after androgen ablation; lane 6, cells obtained during a channel transurethral prostatectomy in a patient with androgen-independent prostate cancer; and lane 7, LNCaP cells.
These results confirmed that metastatic androgen-independentprostate cancers contain high levels of androgen-receptor genetranscripts, whereas cells in normal bone marrow have relativelylittle. On the basis of these observations, we proceeded toanalyze the androgen-receptor genes expressed in bone marrowand other metastatic sites in 10 patients with androgen-independentprostate cancer.
Identification of Androgen-Receptor Mutations
Tumor cells from 10 patients with metastatic androgen-independentprostate cancer (Table 1) were obtained from bone marrow (Patients1, 2, 3, 4, 6, 8, 9, and 10), pleural fluid (Patient 5), ora skin nodule (Patient 7). The DNA-binding and hormone-bindingdomains of the androgen-receptor gene were amplified by PCRand cloned. Multiple isolates (10 to 14 from each patient) weresequenced. Androgen-receptor gene mutations were identifiedin 5 of the 10 patients (Table 2). Each of these mutations wasconfirmed by independent PCR amplifications.
Table 2. Mutations in the Androgen-Receptor Gene Identified in Five Patients with Androgen-Independent Prostate Cancer.
Four of the bone marrow samples (Patients 1, 2, 3, and 4) containedandrogen-receptor genes with single point mutations in the hormone-bindingdomain. The mutation in Patient 1 was in the same codon as themutation reported previously in LNCaP, but resulted in a differentamino acid change (threonine to serine, rather than threonineto alanine).22 Both mutant and wild-type androgen-receptor geneswere identified in Patients 1, 3, and 4. The wild-type genescould have been derived from normal cells in the biopsy specimensor from tumor cells with wild-type androgen-receptor genes.In contrast, every androgen-receptor gene isolated from Patient2 had a mutation in codon 874, raising the possibility thatthis variation was a polymorphism and not a somatic mutationrelated to the malignant cell itself. To distinguish betweenthese two possibilities, genomic DNA was isolated from peripheral-bloodmononuclear cells and amplified with exon Hspecific primers.The germ-line androgen-receptor gene in this material was wildtype. Thus, the codon 874 variant in Patient 2 was a somaticmutation (data not shown).
Paraffin blocks containing primary-tumor specimens obtainedduring a prostatectomy (Patient 3) and a core biopsy of theprostate (Patient 4) were available. Areas containing tumorwere microdissected, and the DNA was extracted and amplifiedby PCR with exon-specific primers. The androgen-receptor genesin both cases were wild type, whereas these genes were mutatedin the metastatic tumors.
The cells from Patient 5, which were derived from a malignantpleural effusion, had an androgen-receptor gene with four mutationslocated in exons D, E, and H (Table 2). Every isolate from twoseparate PCR amplifications contained these four mutations,which were also evident when the amplified PCR products weresequenced directly (data not shown). This patient's prostatecancer was unusual clinically in that it presented in an inguinallymph node and the subsequent malignant pleural effusion, whichcontained cells weakly positive for prostate-specific antigen,resolved with flutamide treatment. Analysis of DNA from peripheral-bloodmononuclear cells with primers specific for exons E and H demonstratedthat the mutations in these exons were not polymorphisms (datanot shown).
Functional Analysis of Mutant Androgen Receptors
The mutant androgen-receptor genes from Patients 1 and 2, whichcontained single point mutations and appeared to be expressedby the majority of tumor cells, were studied functionally. Thecloned genes from these two tumors were transfected into CV-1cells, and their ability to respond to progesterone and estradiolwas assessed. The wild-type and mutant androgen receptors wereinactive in the absence of androgen but could be stimulatedby androgen (Figure 3). As has been shown previously,22 thewild-type androgen receptor was specific for androgens and wasonly weakly stimulated by estrogen or progesterone (Figure 3).In contrast, the mutant androgen receptors from both patientswere stimulated by estrogen and progesterone (Figure 3).
Figure 3. Functional Analysis of Androgen-Receptor Mutations.
Wild-type or mutant androgen receptors were transiently expressed in CV-1 cells with a luciferase reporter gene and various concentrations of estradiol or progesterone. The luciferase activity (expressed in relative light units [RLU]) was normalized for -galactosidase activity to yield a standardized RLU. The maximal responses to androgen (5-dihydrotestosterone) for each androgen receptor averaged approximately 2,200,000 RLU for the wild-type androgen receptor, 1,500,000 RLU for the codon 874 androgen receptor, and 800,000 RLU for the codon 877 androgen receptor in three experiments. All determinations were done in triplicate, and the mean (±SE) results of a representative experiment are shown.
Discussion
We showed that semiquantitative amplification with reverse transcriptionPCR can detect transcripts of the androgen-receptor gene inmetastatic androgen-independent prostate-cancer cells. The levelof androgen-receptor gene expression in these samples was atleast comparable to the amount expressed by LNCaP. This findingis consistent with results of immunohistochemical analysis ofthe expression of androgen-receptor genes in patients with advancedandrogen-independent prostate cancer.20,29 They indicate thatdown-regulation of the gene cannot be a frequent mechanism ofescape from programmed cell death triggered by androgen ablation.Instead, they suggest that tumor-cell growth after androgenablation requires the expression of a functional androgen-receptorgene.
Sequence analyses revealed point mutations in the hormone-bindingdomain of the androgen-receptor gene in 5 of 10 patients withandrogen-independent prostate cancer. Mutations in the androgen-receptorgene were not found in the two archival specimens of primarytumor examined, a result consistent with previous studies showingthat these mutations are extremely rare in primary prostatecancer.16,17,18,19,20 This finding indicates that androgen ablationselects for tumor cells with certain mutations of the androgen-receptorgene, presumably because these mutant androgen receptors donot require the usual levels of androgen to stimulate cell growth.Functional studies showing that these mutations alter the hormonespecificity of the androgen receptor further support this conclusion.
The mutations in codons 874 and 877 studied in this report bothgenerated androgen receptors that could be stimulated by estrogenand progesterone. The LNCaP mutation described previously incodon 877 (threonine to alanine) generated an androgen receptorthat could also be activated by estrogen, progesterone, andflutamide.22 A mutant androgen receptor recently isolated froma patient with androgen-independent prostate cancer (with asubstitution of methionine for valine at codon 715) could similarlybe stimulated by progesterone.18 These observations, togetherwith previous mutagenesis studies of codon 877,30 indicate thata number of mutations in the hormone-binding domain can alterthe specificity of the androgen receptor. In vitro studies indicatethat the androgen receptor can also be constitutively activatedby deletions in the hormone-binding domain,31 although suchdeletions have not yet been identified in vivo. Point mutationsand deletions in the estrogen receptor have been found in breastcancer.32,33
Clinical data indicate that many androgen-independent prostatecancers are sensitive to secondary hormonal treatments, includingflutamide withdrawal.4,5 These observations also suggest thatfunctionally altered androgen receptors may be present in asubstantial proportion of patients with androgen-independentprostate cancer. Nonetheless, there are other possible mechanismsof androgen independence,34,35 the importance of which remainsto be established. It is most likely that androgen-independentprostate cancers are heterogeneous, even in individual patients.The relatively short-lived response to androgen ablation indicatesthat a large number of cells must be androgen-independent beforeandrogen ablation as a result of independent mutations in theandrogen-receptor gene and alterations in other proteins. Ourresults suggest that mutant androgen-receptor genes in androgen-independentprostate cancer could be useful targets of new drugs for thetreatment of prostate cancer.
Supported by a Hematology Career Training Program grant (HL07516)(to Drs. Taplin and Shuster), by a Junior Faculty Research Awardfrom the American Cancer Society (to Dr. Balk), and by a NationalCancer Institute award (R-29 CA51438) (to Dr. Bubley).
We are indebted to Drs. Albert Brinkmann (Erasmus University)and Richard Pestell (Northwestern University Medical School)for providing plasmids; to Dr. William DeWolf (Urology Division,Beth Israel Hospital), Dr. Michael Constantine (HematologyOncologyDivision, Beth Israel Hospital), Dr. Phillip Kantoff (DanaFarberCancer Institute), and other members of the Beth Israel HospitalHematologyOncology Division for their cooperation andhelp in obtaining biopsy specimens; to Janet R. Butmare (Departmentof Pathology, Beth Israel Hospital) for cutting frozen sections;and to Pushpa Srivastava for automated sequencing.
Source Information
From the Oncology Division, Department of Medicine, University of Massachusetts Medical Center, Worcester (M.-E.T.), and the HematologyOncology Division, Department of Medicine, Beth Israel Hospital and Harvard Medical School, Boston (G.J.B., T.D.S., M.E.F., A.E.S., G.K.O., H.N.K., S.P.B.).
Address reprint requests to Dr. Balk at the HematologyOncology Division, Beth Israel Hospital, 330 Brookline Ave., Boston, MA 02215.
References
Boring CC, Squires TS, Tong T. Cancer statistics, 1992. CA Cancer J Clin 1992;42:19-38. [Erratum, CA Cancer J Clin 1992;42:127-8.] [Medline]
Crawford ED. Challenges in the management of prostate cancer. Br J Urol 1992;70:Suppl 1:33-38.
van Tinteren H, Dalesio O. Systematic overview (metaanalysis) of all randomized trials of treatment of prostate cancer. Cancer 1993;72:Suppl:3847-3850. [CrossRef][Medline]
Scher HI, Kelly WK. Flutamide withdrawal syndrome: its impact on clinical trials in hormone-refractory prostate cancer. J Clin Oncol 1993;11:1566-1572. [Free Full Text]
Cunha GR, Donjacour AA, Cooke PS, et al. The endocrinology and developmental biology of the prostate. Endocr Rev 1987;8:338-362. [Free Full Text]
Evans RM. The steroid and thyroid hormone receptor superfamily. Science 1988;240:889-895. [Free Full Text]
Beato M. Gene regulation by steroid hormones. Cell 1989;56:335-344. [CrossRef][Medline]
Riegman PHJ, Vlietstra RJ, van der Korput JAGM, Brinkmann AO, Trapman J. The promoter of the prostate-specific antigen gene contains a functional androgen responsive element. Mol Endocrinol 1991;5:1921-1930. [Free Full Text]
Huggins C, Stevens RE Jr, Hodges CV. Studies on prostate cancer. II. The effects of castration on advanced carcinoma of the prostate gland. Arch Surg 1941;43:209-223. [Free Full Text]
Colombel M, Olsson CA, Ng PY, Buttyan R. Hormone-regulated apoptosis results from reentry of differentiated prostate cells onto a defective cell cycle. Cancer Res 1992;52:4313-4319. [Free Full Text]
Marcelli M, Tilley WD, Wilson CM, Griffin JE, Wilson JD, McPhaul MJ. Definition of the human androgen receptor gene structure permits the identification of mutations that cause androgen resistance: premature termination of the receptor protein at amino acid residue 588 causes complete androgen resistance. Mol Endocrinol 1990;4:1105-1116. [Free Full Text]
Lubahn DB, Brown TR, Simental JA, et al. Sequence of the intron/exon junctions of the coding region of the human androgen receptor gene and identification of a point mutation in a family with complete androgen insensitivity. Proc Natl Acad Sci U S A 1989;86:9534-9538. [Erratum, Proc Natl Acad Sci U S A 1990;87:4411.] [Free Full Text]
De Bellis A, Quigley CA, Cariello NF, et al. Single base mutations in the human androgen receptor gene causing complete androgen insensitivity: rapid detection by a modified denaturing gradient gel electrophoresis technique. Mol Endocrinol 1992;6:1909-1920. [Free Full Text]
Caskey CT, Pizzuti A, Fu Y-H, Fenwick RG Jr, Nelson DL. Triplet repeat mutations in human disease. Science 1992;256:784-789. [Free Full Text]
Newmark JR, Hardy DO, Tonb DC, et al. Androgen receptor gene mutations in human prostate cancer. Proc Natl Acad Sci U S A 1992;89:6319-6323. [Free Full Text]
Culig Z, Klocker H, Eberle J, et al. DNA sequence of the androgen receptor in prostatic tumor cell lines and tissue specimens assessed by means of the polymerase chain reaction. Prostate 1993;22:11-22. [Medline]
Culig Z, Hobisch A, Cronauer MV, et al. Mutant androgen receptor detected in an advanced-stage prostatic carcinoma is activated by adrenal androgens and progesterone. Mol Endocrinol 1993;7:1541-1550. [Free Full Text]
Suzuki H, Sato N, Watabe Y, Masai M, Seino S, Shimazaki J. Androgen receptor gene mutations in human prostate cancer. J Steroid Biochem Mol Biol 1993;46:759-765. [CrossRef][Medline]
Ruizeveld de Winter JA, Janssen PJA, Sleddens HMEB, et al. Androgen receptor status in localized and locally progressive hormone refractory human prostate cancer. Am J Pathol 1994;144:735-746. [Abstract]
Gaddipati JP, McLeod DG, Heidenberg HB, et al. Frequent detection of codon 877 mutation in the androgen receptor gene in advanced prostate cancers. Cancer Res 1994;54:2861-2864. [Free Full Text]
Veldscholte J, Ris-Stalpers C, Kuiper GGJM, et al. A mutation in the ligand binding domain of the androgen receptor of human LNCaP cells affects steroid binding characteristics and response to anti-androgens. Biochem Biophys Res Commun 1990;173:534-540. [CrossRef][Medline]
Porcelli S, Yockey CE, Brenner MB, Balk SP. Analysis of T cell antigen receptor (TCR) expression by human peripheral blood CD4-8- / T cells demonstrates preferential use of several V genes and an invariant TCR chain. J Exp Med 1993;178:1-16. [Free Full Text]
Gussow D, Rein R, Ginjaar I, et al. The human 2-microglobulin gene: primary structure and definition of the transcriptional unit. J Immunol 1987;139:3132-3138. [Abstract]
Brinkmann AO, Faber PW, van Rooij HCJ, et al. The human androgen receptor: domain structure, genomic organization and regulation of expression. J Steroid Biochem 1989;34:307-310. [CrossRef][Medline]
Nordeen SK. Luciferase reporter gene vectors for analysis of promoters and enhancers. Biotechniques 1988;6:454-458. [Medline]
Quarmby VE, Yarbrough WG, Lubahn DB, French FS, Wilson EM. Autologous down-regulation of androgen receptor messenger ribonucleic acid. Mol Endocrinol 1990;4:22-28. [Free Full Text]
Lubahn DB, Joseph DR, Sar M, et al. The human androgen receptor: complementary deoxyribonucleic acid cloning, sequence analysis and gene expression in prostate. Mol Endocrinol 1988;2:1265-1275. [Free Full Text]
van der Kwast TH, Schalken J, Ruizeveld de Winter JA, et al. Androgen receptors in endocrine-therapy-resistant human prostate cancer. Int J Cancer 1991;48:189-193. [Medline]
Ris-Staplers C, Verleun-Mooijman MCT, Trapman J, Brinkmann AO. Threonine on amino acid position 868 in the human androgen receptor is essential for androgen binding specificity and functional activity. Biochem Biophys Res Commun 1993;196:173-180. [CrossRef][Medline]
Jenster G, van der Korput HAGM, van Vroonhoven C, van der Kwast TH, Trapman J, Brinkmann AO. Domains of the human androgen receptor involved in steroid binding, transcriptional activation, and subcellular localization. Mol Endocrinol 1991;5:1396-1404. [Free Full Text]
Fuqua SA, Chamness GC, McGuire WL. Estrogen receptor mutations in breast cancer. J Cell Biochem 1993;51:135-139. [CrossRef][Medline]
Karnik PS, Kulkarni S, Liu XP, Budd GT, Bukowski RM. Estrogen receptor mutations in tamoxifen-resistant breast cancer. Cancer Res 1994;54:349-353. [Free Full Text]
McDonnell TJ, Troncoso P, Brisbay SM, et al. Expression of the protooncogene bcl-2 in the prostate and its association with emergence of androgen-independent prostate cancer. Cancer Res 1992;52:6940-6944. [Free Full Text]
Bookstein R, MacGrogan D, Hilsenbeck SG, Sharkey F, Allred DC. p53 Is mutated in a subset of advanced-stage prostate cancers. Cancer Res 1993;53:3369-3373. [Free Full Text]
Cai, C., Portnoy, D. C., Wang, H., Jiang, X., Chen, S., Balk, S. P.
(2009). Androgen Receptor Expression in Prostate Cancer Cells Is Suppressed by Activation of Epidermal Growth Factor Receptor and ErbB2. Cancer Res.
69: 5202-5209
[Abstract][Full Text]
Li, Y., Wang, L., Zhang, M., Melamed, J., Liu, X., Reiter, R., Wei, J., Peng, Y., Zou, X., Pellicer, A., Garabedian, M. J., Ferrari, A., Lee, P.
(2009). LEF1 in Androgen-Independent Prostate Cancer: Regulation of Androgen Receptor Expression, Prostate Cancer Growth, and Invasion. Cancer Res.
69: 3332-3338
[Abstract][Full Text]
Wu, K., Katiyar, S., Witkiewicz, A., Li, A., McCue, P., Song, L.-N., Tian, L., Jin, M., Pestell, R. G.
(2009). The Cell Fate Determination Factor Dachshund Inhibits Androgen Receptor Signaling and Prostate Cancer Cellular Growth. Cancer Res.
69: 3347-3355
[Abstract][Full Text]
O'Mahony, O. A., Steinkamp, M. P., Albertelli, M. A., Brogley, M., Rehman, H., Robins, D. M.
(2008). Profiling Human Androgen Receptor Mutations Reveals Treatment Effects in a Mouse Model of Prostate Cancer. Mol Cancer Res
6: 1691-1701
[Abstract][Full Text]
Zhang, Y., Linn, D., Liu, Z., Melamed, J., Tavora, F., Young, C. Y., Burger, A. M., Hamburger, A. W.
(2008). EBP1, an ErbB3-binding protein, is decreased in prostate cancer and implicated in hormone resistance. Molecular Cancer Therapeutics
7: 3176-3186
[Abstract][Full Text]
Risek, B., Bilski, P., Rice, A. B., Schrader, W. T.
(2008). Androgen Receptor-Mediated Apoptosis Is Regulated by Photoactivatable Androgen Receptor Ligands. Mol. Endocrinol.
22: 2099-2115
[Abstract][Full Text]
Shah, S., Hess-Wilson, J. K., Webb, S., Daly, H., Godoy-Tundidor, S., Kim, J., Boldison, J., Daaka, Y., Knudsen, K. E.
(2008). 2,2-Bis(4-Chlorophenyl)-1,1-Dichloroethylene Stimulates Androgen Independence in Prostate Cancer Cells through Combinatorial Activation of Mutant Androgen Receptor and Mitogen-Activated Protein Kinase Pathways. Mol Cancer Res
6: 1507-1520
[Abstract][Full Text]
Liu, Y., Mo, J. Q., Hu, Q., Boivin, G., Levin, L., Lu, S., Yang, D., Dong, Z., Lu, S.
(2008). Targeted Overexpression of Vav3 Oncogene in Prostatic Epithelium Induces Nonbacterial Prostatitis and Prostate Cancer. Cancer Res.
68: 6396-6406
[Abstract][Full Text]
Vasaitis, T., Belosay, A., Schayowitz, A., Khandelwal, A., Chopra, P., Gediya, L. K., Guo, Z., Fang, H.-B., Njar, V. C.O., Brodie, A. M.H.
(2008). Androgen receptor inactivation contributes to antitumor efficacy of 17{alpha}-hydroxylase/17,20-lyase inhibitor 3{beta}-hydroxy-17-(1H-benzimidazole-1-yl)androsta-5,16-diene in prostate cancer. Molecular Cancer Therapeutics
7: 2348-2357
[Abstract][Full Text]
Schayowitz, A., Sabnis, G., Njar, V. C.O., Brodie, A. M.H.
(2008). Synergistic effect of a novel antiandrogen, VN/124-1, and signal transduction inhibitors in prostate cancer progression to hormone independence in vitro. Molecular Cancer Therapeutics
7: 121-132
[Abstract][Full Text]
Kurahashi, N., Sasazuki, S., Iwasaki, M., Inoue, M., Shoichiro Tsugane for the JPHC Study Group,
(2008). Green Tea Consumption and Prostate Cancer Risk in Japanese Men: A Prospective Study. Am J Epidemiol
167: 71-77
[Abstract][Full Text]
Hodgson, M. C., Astapova, I., Hollenberg, A. N., Balk, S. P.
(2007). Activity of Androgen Receptor Antagonist Bicalutamide in Prostate Cancer Cells Is Independent of NCoR and SMRT Corepressors. Cancer Res.
67: 8388-8395
[Abstract][Full Text]
Askew, E. B., Gampe, R. T. Jr., Stanley, T. B., Faggart, J. L., Wilson, E. M.
(2007). Modulation of Androgen Receptor Activation Function 2 by Testosterone and Dihydrotestosterone. J. Biol. Chem.
282: 25801-25816
[Abstract][Full Text]
Nakauchi, H., Matsuda, K.-i., Ochiai, I., Kawauchi, A., Mizutani, Y., Miki, T., Kawata, M.
(2007). A Differential Ligand-mediated Response of Green Fluorescent Protein-tagged Androgen Receptor in Living Prostate Cancer and Non-prostate Cancer Cell Lines. J. Histochem. Cytochem.
55: 535-544
[Abstract][Full Text]
Haelens, A., Tanner, T., Denayer, S., Callewaert, L., Claessens, F.
(2007). The Hinge Region Regulates DNA Binding, Nuclear Translocation, and Transactivation of the Androgen Receptor. Cancer Res.
67: 4514-4523
[Abstract][Full Text]
Li, T.-H., Zhao, H., Peng, Y., Beliakoff, J., Brooks, J. D., Sun, Z.
(2007). A promoting role of androgen receptor in androgen-sensitive and -insensitive prostate cancer cells. Nucleic Acids Res
0: gkm198v1-10
[Abstract][Full Text]
Yang, Z., Chang, Y.-J., Miyamoto, H., Yeh, S., Yao, J. L., di Sant'Agnese, P. A., Tsai, M.-Y., Chang, C.
(2007). Suppression of Androgen Receptor Transactivation and Prostate Cancer Cell Growth by Heterogeneous Nuclear Ribonucleoprotein A1 via Interaction with Androgen Receptor Coregulator ARA54. Endocrinology
148: 1340-1349
[Abstract][Full Text]
Yang, Z., Chang, Y.-J., Miyamoto, H., Ni, J., Niu, Y., Chen, Z., Chen, Y.-L., Yao, J. L., di Sant'Agnese, P. A., Chang, C.
(2007). Transgelin Functions as a Suppressor via Inhibition of ARA54-Enhanced Androgen Receptor Transactivation and Prostate Cancer Cell Growth. Mol. Endocrinol.
21: 343-358
[Abstract][Full Text]
Inoue, T., Yoshida, T., Shimizu, Y., Kobayashi, T., Yamasaki, T., Toda, Y., Segawa, T., Kamoto, T., Nakamura, E., Ogawa, O.
(2006). Requirement of Androgen-Dependent Activation of Protein Kinase C{zeta} for Androgen-Dependent Cell Proliferation in LNCaP Cells and Its Roles in Transition to Androgen-Independent Cells. Mol. Endocrinol.
20: 3053-3069
[Abstract][Full Text]
Wetherill, Y. B., Hess-Wilson, J. K., Comstock, C. E.S., Shah, S. A., Buncher, C. R., Sallans, L., Limbach, P. A., Schwemberger, S., Babcock, G. F., Knudsen, K. E.
(2006). Bisphenol A facilitates bypass of androgen ablation therapy in prostate cancer. Molecular Cancer Therapeutics
5: 3181-3190
[Abstract][Full Text]
Chen, S., Xu, Y., Yuan, X., Bubley, G. J., Balk, S. P.
(2006). Androgen receptor phosphorylation and stabilization in prostate cancer by cyclin-dependent kinase 1. Proc. Natl. Acad. Sci. USA
103: 15969-15974
[Abstract][Full Text]
Bhuiyan, M. M.R., Li, Y., Banerjee, S., Ahmed, F., Wang, Z., Ali, S., Sarkar, F. H.
(2006). Down-regulation of Androgen Receptor by 3,3'-Diindolylmethane Contributes to Inhibition of Cell Proliferation and Induction of Apoptosis in Both Hormone-Sensitive LNCaP and Insensitive C4-2B Prostate Cancer Cells.. Cancer Res.
66: 10064-10072
[Abstract][Full Text]
Dong, Z., Liu, Y., Lu, S., Wang, A., Lee, K., Wang, L.-H., Revelo, M., Lu, S.
(2006). Vav3 Oncogene Is Overexpressed and Regulates Cell Growth and Androgen Receptor Activity in Human Prostate Cancer. Mol. Endocrinol.
20: 2315-2325
[Abstract][Full Text]
Yuan, X., Li, T., Wang, H., Zhang, T., Barua, M., Borgesi, R. A., Bubley, G. J., Lu, M. L., Balk, S. P.
(2006). Androgen Receptor Remains Critical for Cell-Cycle Progression in Androgen-Independent CWR22 Prostate Cancer Cells. Am. J. Pathol.
169: 682-696
[Abstract][Full Text]
Park, S.-Y., Kim, Y.-J., Gao, A. C., Mohler, J. L., Onate, S. A., Hidalgo, A. A., Ip, C., Park, E.-M., Yoon, S. Y., Park, Y.-M.
(2006). Hypoxia increases androgen receptor activity in prostate cancer cells.. Cancer Res.
66: 5121-5129
[Abstract][Full Text]
Pienta, K. J., Bradley, D.
(2006). Mechanisms underlying the development of androgen-independent prostate cancer.. Clin. Cancer Res.
12: 1665-1671
[Full Text]
He, B., Gampe, R. T. Jr., Hnat, A. T., Faggart, J. L., Minges, J. T., French, F. S., Wilson, E. M.
(2006). Probing the Functional Link between Androgen Receptor Coactivator and Ligand-binding Sites in Prostate Cancer and Androgen Insensitivity. J. Biol. Chem.
281: 6648-6663
[Abstract][Full Text]
Stanbrough, M., Bubley, G. J., Ross, K., Golub, T. R., Rubin, M. A., Penning, T. M., Febbo, P. G., Balk, S. P.
(2006). Increased expression of genes converting adrenal androgens to testosterone in androgen-independent prostate cancer.. Cancer Res.
66: 2815-2825
[Abstract][Full Text]
Zheng, Z., Cai, C., Omwancha, J., Chen, S.-Y., Baslan, T., Shemshedini, L.
(2006). SUMO-3 Enhances Androgen Receptor Transcriptional Activity through a Sumoylation-independent Mechanism in Prostate Cancer Cells. J. Biol. Chem.
281: 4002-4012
[Abstract][Full Text]
Duff, J., McEwan, I. J.
(2005). Mutation of Histidine 874 in the Androgen Receptor Ligand-Binding Domain Leads to Promiscuous Ligand Activation and Altered p160 Coactivator Interactions. Mol. Endocrinol.
19: 2943-2954
[Abstract][Full Text]
Song, L.-N., Gelmann, E. P.
(2005). Interaction of {beta}-Catenin and TIF2/GRIP1 in Transcriptional Activation by the Androgen Receptor. J. Biol. Chem.
280: 37853-37867
[Abstract][Full Text]
Talcott, J. A.
(2005). Rebalancing Ratios and Improving Impressions: Later Thoughts From the Prostate Cancer Prevention Trial Investigators. JCO
23: 7388-7390
[Full Text]
Rau, K-M, Kang, H-Y, Cha, T-L, Miller, S A, Hung, M-C
(2005). The mechanisms and managements of hormone-therapy resistance in breast and prostate cancers. Endocr Relat Cancer
12: 511-532
[Abstract][Full Text]
Schaufele, F., Carbonell, X., Guerbadot, M., Borngraeber, S., Chapman, M. S., Ma, A. A. K., Miner, J. N., Diamond, M. I.
(2005). The structural basis of androgen receptor activation: Intramolecular and intermolecular amino-carboxy interactions. Proc. Natl. Acad. Sci. USA
102: 9802-9807
[Abstract][Full Text]
Zhang, Y., Wang, X.-W., Jelovac, D., Nakanishi, T., Yu, M.-h., Akinmade, D., Goloubeva, O., Ross, D. D., Brodie, A., Hamburger, A. W.
(2005). The ErbB3-binding protein Ebp1 suppresses androgen receptor-mediated gene transcription and tumorigenesis of prostate cancer cells. Proc. Natl. Acad. Sci. USA
102: 9890-9895
[Abstract][Full Text]
Hughes, C, Murphy, A, Martin, C, Sheils, O, O'Leary, J
(2005). Molecular pathology of prostate cancer. J. Clin. Pathol.
58: 673-684
[Abstract][Full Text]
d'Ancona, F.C.H., Debruyne, F.M.J.
(2005). Endocrine approaches in the therapy of prostate carcinoma. Hum Reprod Update
11: 309-317
[Abstract][Full Text]
Lim, J. T. E., Mansukhani, M., Weinstein, I. B.
(2005). Cyclin-dependent kinase 6 associates with the androgen receptor and enhances its transcriptional activity in prostate cancer cells. Proc. Natl. Acad. Sci. USA
102: 5156-5161
[Abstract][Full Text]
Arnold, J. T., Le, H., McFann, K. K., Blackman, M. R.
(2005). Comparative effects of DHEA vs. testosterone, dihydrotestosterone, and estradiol on proliferation and gene expression in human LNCaP prostate cancer cells. Am. J. Physiol. Endocrinol. Metab.
288: E573-E584
[Abstract][Full Text]
Hodgson, M. C., Astapova, I., Cheng, S., Lee, L. J., Verhoeven, M. C., Choi, E., Balk, S. P., Hollenberg, A. N.
(2005). The Androgen Receptor Recruits Nuclear Receptor CoRepressor (N-CoR) in the Presence of Mifepristone via Its N and C Termini Revealing a Novel Molecular Mechanism for Androgen Receptor Antagonists. J. Biol. Chem.
280: 6511-6519
[Abstract][Full Text]
Wetherill, Y. B., Fisher, N. L., Staubach, A., Danielsen, M., de Vere White, R. W., Knudsen, K. E.
(2005). Xenoestrogen Action in Prostate Cancer: Pleiotropic Effects Dependent on Androgen Receptor Status. Cancer Res.
65: 54-65
[Abstract][Full Text]
Umar, A., Berrevoets, C. A., Van, N. M., van Leeuwen, M., Verbiest, M., Kleijer, W. J., Dooijes, D., Grootegoed, J. A., Drop, S. L. S., Brinkmann, A. O.
(2005). Functional Analysis of a Novel Androgen Receptor Mutation, Q902K, in an Individual with Partial Androgen Insensitivity. J. Clin. Endocrinol. Metab.
90: 507-515
[Abstract][Full Text]
Verras, M., Brown, J., Li, X., Nusse, R., Sun, Z.
(2004). Wnt3a Growth Factor Induces Androgen Receptor-Mediated Transcription and Enhances Cell Growth in Human Prostate Cancer Cells. Cancer Res.
64: 8860-8866
[Abstract][Full Text]
Masiello, D., Chen, S.-Y., Xu, Y., Verhoeven, M. C., Choi, E., Hollenberg, A. N., Balk, S. P.
(2004). Recruitment of {beta}-Catenin by Wild-Type or Mutant Androgen Receptors Correlates with Ligand-Stimulated Growth of Prostate Cancer Cells. Mol. Endocrinol.
18: 2388-2401
[Abstract][Full Text]
Papandreou, C. N., Logothetis, C. J.
(2004). Bortezomib as a Potential Treatment for Prostate Cancer. Cancer Res.
64: 5036-5043
[Abstract][Full Text]
Nakashiro, K.-i., Hara, S., Shinohara, Y., Oyasu, M., Kawamata, H., Shintani, S., Hamakawa, H., Oyasu, R.
(2004). Phenotypic Switch from Paracrine to Autocrine Role of Hepatocyte Growth Factor in an Androgen-Independent Human Prostatic Carcinoma Cell Line, CWR22R. Am. J. Pathol.
165: 533-540
[Abstract][Full Text]
Li, H., Ahonen, T. J., Alanen, K., Xie, J., LeBaron, M. J., Pretlow, T. G., Ealley, E. L., Zhang, Y., Nurmi, M., Singh, B., Martikainen, P. M., Nevalainen, M. T.
(2004). Activation of Signal Transducer and Activator of Transcription 5 in Human Prostate Cancer Is Associated with High Histological Grade. Cancer Res.
64: 4774-4782
[Abstract][Full Text]
Ellem, S. J., Schmitt, J. F., Pedersen, J. S., Frydenberg, M., Risbridger, G. P.
(2004). Local Aromatase Expression in Human Prostate Is Altered in Malignancy. J. Clin. Endocrinol. Metab.
89: 2434-2441
[Abstract][Full Text]
Heinlein, C. A., Chang, C.
(2004). Androgen Receptor in Prostate Cancer. Endocr. Rev.
25: 276-308
[Abstract][Full Text]
Ling, M.-T., Wang, X., Lee, D. T., Tam, P.C., Tsao, S.-W., Wong, Y.-C.
(2004). Id-1 expression induces androgen-independent prostate cancer cell growth through activation of epidermal growth factor receptor (EGF-R). Carcinogenesis
25: 517-525
[Abstract][Full Text]
Rahman, M., Miyamoto, H., Chang, C.
(2004). Androgen Receptor Coregulators in Prostate Cancer: Mechanisms and Clinical Implications. Clin. Cancer Res.
10: 2208-2219
[Full Text]
Small, E. J., Halabi, S., Dawson, N. A., Stadler, W. M., Rini, B. I., Picus, J., Gable, P., Torti, F. M., Kaplan, E., Vogelzang, N. J.
(2004). Antiandrogen Withdrawal Alone or in Combination With Ketoconazole in Androgen-Independent Prostate Cancer Patients: A Phase III Trial (CALGB 9583). JCO
22: 1025-1033
[Abstract][Full Text]
Scholz, I. V., Cengic, N., Goke, B., Morris, J. C., Spitzweg, C.
(2004). Dexamethasone Enhances the Cytotoxic Effect of Radioiodine Therapy in Prostate Cancer Cells Expressing the Sodium Iodide Symporter. J. Clin. Endocrinol. Metab.
89: 1108-1116
[Abstract][Full Text]
Linja, M. J., Porkka, K. P., Kang, Z., Savinainen, K. J., Janne, O. A., Tammela, T. L. J., Vessella, R. L., Palvimo, J. J., Visakorpi, T.
(2004). Expression of Androgen Receptor Coregulators in Prostate Cancer. Clin. Cancer Res.
10: 1032-1040
[Abstract][Full Text]
Mohler, J. L., Gregory, C. W., Ford, O. H. III, Kim, D., Weaver, C. M., Petrusz, P., Wilson, E. M., French, F. S.
(2004). The Androgen Axis in Recurrent Prostate Cancer. Clin. Cancer Res.
10: 440-448
[Abstract][Full Text]
Ochiai, I., Matsuda, K.-i., Nishi, M., Ozawa, H., Kawata, M.
(2004). Imaging Analysis of Subcellular Correlation of Androgen Receptor and Estrogen Receptor {alpha} in Single Living Cells Using Green Fluorescent Protein Color Variants. Mol. Endocrinol.
18: 26-42
[Abstract][Full Text]
Song, L.-N., Coghlan, M., Gelmann, E. P.
(2004). Antiandrogen Effects of Mifepristone on Coactivator and Corepressor Interactions with the Androgen Receptor. Mol. Endocrinol.
18: 70-85
[Abstract][Full Text]
Fu, M., Rao, M., Wang, C., Sakamaki, T., Wang, J., Di Vizio, D., Zhang, X., Albanese, C., Balk, S., Chang, C., Fan, S., Rosen, E., Palvimo, J. J., Janne, O. A., Muratoglu, S., Avantaggiati, M. L., Pestell, R. G.
(2003). Acetylation of Androgen Receptor Enhances Coactivator Binding and Promotes Prostate Cancer Cell Growth. Mol. Cell. Biol.
23: 8563-8575
[Abstract][Full Text]
Yang, S.-Z., Abdulkadir, S. A.
(2003). Early Growth Response Gene 1 Modulates Androgen Receptor Signaling in Prostate Carcinoma Cells. J. Biol. Chem.
278: 39906-39911
[Abstract][Full Text]
Lee, D. K., Chang, C.
(2003). Expression and Degradation of Androgen Receptor: Mechanism and Clinical Implication. J. Clin. Endocrinol. Metab.
88: 4043-4054
[Abstract][Full Text]
Nishimura, K., Ting, H.-J., Harada, Y., Tokizane, T., Nonomura, N., Kang, H.-Y., Chang, H.-C., Yeh, S., Miyamoto, H., Shin, M., Aozasa, K., Okuyama, A., Chang, C.
(2003). Modulation of Androgen Receptor Transactivation by Gelsolin: A Newly Identified Androgen Receptor Coregulator. Cancer Res.
63: 4888-4894
[Abstract][Full Text]
Pan, Y., Zhang, J.-S., Gazi, M. H., Young, C. Y. F.
(2003). The Cyclooxygenase 2-specific Nonsteroidal Anti-inflammatory Drugs Celecoxib and Nimesulide Inhibit Androgen Receptor Activity via Induction of c-Jun in Prostate Cancer Cells. Cancer Epidemiol. Biomarkers Prev.
12: 769-774
[Abstract][Full Text]
Goetz, M. P., Toft, D. O., Ames, M. M., Erlichman, C.
(2003). The Hsp90 chaperone complex as a novel target for cancer therapy. Ann Oncol
14: 1169-1176
[Abstract][Full Text]
Nelson, W. G., De Marzo, A. M., Isaacs, W. B.
(2003). Prostate Cancer. NEJM
349: 366-381
[Full Text]
Taplin, M.-E., Rajeshkumar, B., Halabi, S., Werner, C. P., Woda, B. A., Picus, J., Stadler, W., Hayes, D. F., Kantoff, P. W., Vogelzang, N. J., Small, E. J.
(2003). Androgen Receptor Mutations in Androgen-Independent Prostate Cancer: Cancer and Leukemia Group B Study 9663. JCO
21: 2673-2678
[Abstract][Full Text]
Rahman, M. M., Miyamoto, H., Takatera, H., Yeh, S., Altuwaijri, S., Chang, C.
(2003). Reducing the Agonist Activity of Antiandrogens by a Dominant-negative Androgen Receptor Coregulator ARA70 in Prostate Cancer Cells. J. Biol. Chem.
278: 19619-19626
[Abstract][Full Text]
de la Taille, A., Rubin, M. A., Chen, M.-W., Vacherot, F., de Medina, S. G.-D., Burchardt, M., Buttyan, R., Chopin, D.
(2003). {beta}-Catenin-related Anomalies in Apoptosis-resistant and Hormone-refractory Prostate Cancer Cells. Clin. Cancer Res.
9: 1801-1807
[Abstract][Full Text]
Rahman, M. M., Miyamoto, H., Lardy, H., Chang, C.
(2003). Inactivation of androgen receptor coregulator ARA55 inhibits androgen receptor activity and agonist effect of antiandrogens in prostate cancer cells. Proc. Natl. Acad. Sci. USA
100: 5124-5129
[Abstract][Full Text]
Bakin, R. E., Gioeli, D., Bissonette, E. A., Weber, M. J.
(2003). Attenuation of Ras Signaling Restores Androgen Sensitivity to Hormone-refractory C4-2 Prostate Cancer Cells. Cancer Res.
63: 1975-1980
[Abstract][Full Text]
Song, L.-N., Herrell, R., Byers, S., Shah, S., Wilson, E. M., Gelmann, E. P.
(2003). {beta}-Catenin Binds to the Activation Function 2 Region of the Androgen Receptor and Modulates the Effects of the N-Terminal Domain and TIF2 on Ligand-Dependent Transcription. Mol. Cell. Biol.
23: 1674-1687
[Abstract][Full Text]
Lamb, D. J., Puxeddu, E., Malik, N., Stenoien, D. L., Nigam, R., Saleh, G. Y., Mancini, M., Weigel, N. L., Marcelli, M.
(2003). Molecular Analysis of the Androgen Receptor in Ten Prostate Cancer Specimens Obtained Before and After Androgen Ablation. J Androl
24: 215-225
[Abstract][Full Text]
Santamaria, A., Fernandez, P. L., Farre, X., Benedit, P., Reventos, J., Morote, J., Paciucci, R., Thomson, T. M.
(2003). PTOV-1, a Novel Protein Overexpressed in Prostate Cancer, Shuttles between the Cytoplasm and the Nucleus and Promotes Entry into the S Phase of the Cell Division Cycle. Am. J. Pathol.
162: 897-905
[Abstract][Full Text]
Thin, T. H., Wang, L., Kim, E., Collins, L. L., Basavappa, R., Chang, C.
(2003). Isolation and Characterization of Androgen Receptor Mutant, AR(M749L), with Hypersensitivity to 17-beta Estradiol Treatment. J. Biol. Chem.
278: 7699-7708
[Abstract][Full Text]
Balk, S. P., Ko, Y.-J., Bubley, G. J.
(2003). Biology of Prostate-Specific Antigen. JCO
21: 383-391
[Abstract][Full Text]
Hara, T., Miyazaki, J.-i., Araki, H., Yamaoka, M., Kanzaki, N., Kusaka, M., Miyamoto, M.
(2003). Novel Mutations of Androgen Receptor: A Possible Mechanism of Bicalutamide Withdrawal Syndrome. Cancer Res.
63: 149-153
[Abstract][Full Text]
Comuzzi, B., Lambrinidis, L., Rogatsch, H., Godoy-Tundidor, S., Knezevic, N., Krhen, I., Marekovic, Z., Bartsch, G., Klocker, H., Hobisch, A., Culig, Z.
(2003). The Transcriptional Co-Activator cAMP Response Element-Binding Protein-Binding Protein Is Expressed in Prostate Cancer and Enhances Androgen- and Anti-Androgen-Induced Androgen Receptor Function. Am. J. Pathol.
162: 233-241
[Abstract][Full Text]
Lee, Y.-F., Lin, W.-J., Huang, J., Messing, E. M., Chan, F. L., Wilding, G., Chang, C.
(2002). Activation of Mitogen-activated Protein Kinase Pathway by the Antiandrogen Hydroxyflutamide in Androgen Receptor-negative Prostate Cancer Cells. Cancer Res.
62: 6039-6044
[Abstract][Full Text]
Masiello, D., Cheng, S., Bubley, G. J., Lu, M. L., Balk, S. P.
(2002). Bicalutamide Functions as an Androgen Receptor Antagonist by Assembly of a Transcriptionally Inactive Receptor. J. Biol. Chem.
277: 26321-26326
[Abstract][Full Text]
Gelmann, E. P.
(2002). Molecular Biology of the Androgen Receptor. JCO
20: 3001-3015
[Abstract][Full Text]
Dai, J., Shen, R., Sumitomo, M., Stahl, R., Navarro, D., Gershengorn, M. C., Nanus, D. M.
(2002). Synergistic Activation of the Androgen Receptor by Bombesin and Low-Dose Androgen. Clin. Cancer Res.
8: 2399-2405
[Abstract][Full Text]
Nelson, K. A., Witte, J. S.
(2002). Androgen Receptor CAG Repeats and Prostate Cancer. Am J Epidemiol
155: 883-890
[Abstract][Full Text]
Krishnan, A. V., Zhao, X.-Y., Swami, S., Brive, L., Peehl, D. M., Ely, K. R., Feldman, D.
(2002). A Glucocorticoid-Responsive Mutant Androgen Receptor Exhibits Unique Ligand Specificity: Therapeutic Implications for Androgen-Independent Prostate Cancer. Endocrinology
143: 1889-1900
[Abstract][Full Text]
Wetherill, Y. B., Petre, C. E., Monk, K. R., Puga, A., Knudsen, K. E.
(2002). The Xenoestrogen Bisphenol A Induces Inappropriate Androgen Receptor Activation and Mitogenesis in Prostatic Adenocarcinoma Cells. Molecular Cancer Therapeutics
1: 515-524
[Abstract][Full Text]
Chang, C.-Y., McDonnell, D. P.
(2002). Evaluation of Ligand-Dependent Changes in AR Structure Using Peptide Probes. Mol. Endocrinol.
16: 647-660
[Abstract][Full Text]
Sasaki, M., Tanaka, Y., Perinchery, G., Dharia, A., Kotcherguina, I., Fujimoto, S. i., Dahiya, R.
(2002). Methylation and Inactivation of Estrogen, Progesterone, and Androgen Receptors in Prostate Cancer. JNCI J Natl Cancer Inst
94: 384-390
[Abstract][Full Text]
Shi, X.-B., Ma, A.-H., Xia, L., Kung, H.-J., de Vere White, R. W.
(2002). Functional Analysis of 44 Mutant Androgen Receptors from Human Prostate Cancer. Cancer Res.
62: 1496-1502
[Abstract][Full Text]
Miyamoto, H., Rahman, M., Takatera, H., Kang, H.-Y., Yeh, S., Chang, H.-C., Nishimura, K., Fujimoto, N., Chang, C.
(2002). A Dominant-negative Mutant of Androgen Receptor Coregulator ARA54 Inhibits Androgen Receptor-mediated Prostate Cancer Growth. J. Biol. Chem.
277: 4609-4617
[Abstract][Full Text]
Lee, S. R., Ramos, S. M., Ko, A., Masiello, D., Swanson, K. D., Lu, M. L., Balk, S. P.
(2002). AR and ER Interaction with a p21-Activated Kinase (PAK6). Mol. Endocrinol.
16: 85-99
[Abstract][Full Text]
Chang, C.-Y., Walther, P. J., McDonnell, D. P.
(2001). Glucocorticoids Manifest Androgenic Activity in a Cell Line Derived from a Metastatic Prostate Cancer. Cancer Res.
61: 8712-8717
[Abstract][Full Text]
Grossmann, M. E., Huang, H., Tindall, D. J.
(2001). Androgen Receptor Signaling in Androgen-Refractory Prostate Cancer. JNCI J Natl Cancer Inst
93: 1687-1697
[Abstract][Full Text]
Stanbrough, M., Leav, I., Kwan, P. W. L., Bubley, G. J., Balk, S. P.
(2001). Prostatic intraepithelial neoplasia in mice expressing an androgen receptor transgene in prostate epithelium. Proc. Natl. Acad. Sci. USA
10.1073/pnas.191235898v1
[Abstract][Full Text]
Taplin, M. E., Ho, S.-M.
(2001). The Endocrinology of Prostate Cancer. J. Clin. Endocrinol. Metab.
86: 3467-3477
[Full Text]
Matsubara, S., Wada, Y., Gardner, T. A., Egawa, M., Park, M.-S., Hsieh, C.-L., Zhau, H. E., Kao, C., Kamidono, S., Gillenwater, J. Y., Chung, L. W. K.
(2001). A Conditional Replication-competent Adenoviral Vector, Ad-OC-E1a, to Cotarget Prostate Cancer and Bone Stroma in an Experimental Model of Androgen-independent Prostate Cancer Bone Metastasis. Cancer Res.
61: 6012-6019
[Abstract][Full Text]
Reutens, A. T., Fu, M., Wang, C., Albanese, C., McPhaul, M. J., Sun, Z., Balk, S. P., Jänne, O. A., Palvimo, J. J., Pestell, R. G.
(2001). Cyclin D1 Binds the Androgen Receptor and Regulates Hormone-Dependent Signaling in a p300/CBP-Associated Factor (P/CAF)-Dependent Manner. Mol. Endocrinol.
15: 797-811
[Abstract][Full Text]
Linja, M. J., Savinainen, K. J., Saramäki, O. R., Tammela, T. L. J., Vessella, R. L., Visakorpi, T.
(2001). Amplification and Overexpression of Androgen Receptor Gene in Hormone-Refractory Prostate Cancer. Cancer Res.
61: 3550-3555
[Abstract][Full Text]
Buchanan, G., Greenberg, N. M., Scher, H. I., Harris, J. M., Marshall, V. R., Tilley, W. D.
(2001). Collocation of Androgen Receptor Gene Mutations in Prostate Cancer. Clin. Cancer Res.
7: 1273-1281
[Abstract][Full Text]
Sack, J. S., Kish, K. F., Wang, C., Attar, R. M., Kiefer, S. E., An, Y., Wu, G. Y., Scheffler, J. E., Salvati, M. E., Krystek, S. R. Jr., Weinmann, R., Einspahr, H. M.
(2001). Crystallographic structures of the ligand-binding domains of the androgen receptor and its T877A mutant complexed with the natural agonist dihydrotestosterone. Proc. Natl. Acad. Sci. USA
98: 4904-4909
[Abstract][Full Text]