FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Volume 332:1393-1398 May 25, 1995 Number 21 Next

Abstract PDF Letters Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

ABSTRACT

Background Metastatic prostate cancer is a leading cause of cancer-related death in men. The rate of response to androgen ablation is high, but most patients relapse as a result of the outgrowth of androgen-independent tumor cells. The androgen receptor, which binds testosterone and stimulates the transcription of androgen-responsive genes, regulates the growth of prostate cells. We analyzed the androgen-receptor genes from samples of metastatic androgen-independent prostate cancers to determine whether mutations in the gene have a role in androgen independence.

Methods Complementary DNA was synthesized from metastatic prostate cancers in 10 patients with androgen-independent prostate cancer, and the expression of the androgen-receptor gene was estimated by amplification with the polymerase chain reaction. Exons B through H of the gene were cloned, and mutations were identified by DNA sequencing. The functional effects of the mutations were assessed in cells transfected with mutant genes.

Results All androgen-independent tumors expressed high levels of androgen-receptor gene transcripts, relative to the levels expressed by an androgen-independent prostate-cancer cell line (LnCap). Point mutations in the androgen-receptor gene were identified in metastatic cells from 5 of the 10 patients examined. One mutation was in the same codon as the mutation found previously in the androgen-independent prostate-cancer cell line. The mutations were not detected in the primary tumors from two of the patients. Functional studies of two of the mutant androgen receptors demonstrated that they could be activated by progesterone and estrogen.

Conclusions Most metastatic androgen-independent prostate cancers express high levels of androgen-receptor gene transcripts. Mutations in androgen-receptor genes are not uncommon and may provide a selective growth advantage after androgen ablation.

The mechanisms by which tumor cells escape androgen ablation and become independent of the need for androgen are not understood. Salvage therapy with cytotoxic chemotherapy has generally not been effective in patients with androgen-independent prostate cancer.⁴ Secondary hormonal treatments with estrogens, progesterones, or glucocorticoids can induce short-term partial responses in a minority of patients.⁴ Interestingly, a rate of improvement of 30 to 40 percent after flutamide withdrawal has been reported in patients with androgen-independent prostate cancer who received both flutamide and testicular androgen ablation.⁵

Androgens are required for the development of both the normal prostate and prostate cancer.⁶ Androgens act through the androgen receptor, which belongs to the steroid-receptor superfamily of ligand-dependent transcription factors.^7,8 This superfamily includes receptors for thyroid hormone, retinoic acid, estrogen, progesterone, glucocorticoids, and other steroid hormones. The structure of the androgen receptor is prototypical, with an N-terminal transactivating domain (exon A) and a C-terminal hormone-binding domain (exons D through H) (Figure 1). Between these areas lies the DNA-binding domain (exons B and C), with its two zinc fingers that bind to specific DNA sequences, termed androgen-responsive elements. Once bound to androgen, the androgen receptor regulates the expression of androgen-responsive genes by binding to their androgen-responsive elements and by interacting with other transcription factors. A notable gene regulated by androgen in prostate cells encodes the prostate-specific antigen.⁹

View larger version (1K): [in this window] [in a new window]   Figure 1. Structure of the androgen receptor and Primers Used for PCR Amplification. Exons A through H and the locations of the transactivating, DNA-binding, and hormone-binding domains are shown. The positions and orientations of the primers used are also shown. The sequences of the primers are as follows: 1, CTACGGCTACACTCGGCCCCCTCA; 2, CGACTTCACCGCACCTGATGTGT; 3, GCATGGTGAGCAGAGTGCCCTATC; 4, AAACATGGTCCCTGGCAGTCTCCA; 5, TCCCAGAGTCATCCCTGCTTCAT; 6, TAACAGGCAGAAGACATCTGAAAG; and 7, ACAGACTGTACATCAATAGAGGAAATTC. UT denotes untranslated.

 
Androgen ablation causes dramatic regression of prostate cancer and normal prostate tissue in most patients and in animal models of prostate cancer.¹⁰ At the cellular level, androgen ablation induces programmed cell death, or apoptosis,¹¹ which appears to be mediated directly or indirectly by unligated androgen receptors. It seems, therefore, that androgen-independent prostate-cancer cells can escape the apoptosis induced by androgen ablation. A mechanism for this escape could be by mutations in the androgen-receptor gene that allow the receptors to stimulate the growth of prostate cells in the absence of androgen. Mutations in the androgen-receptor gene have been shown to cause the androgen-insensitivity syndrome^12,13,14 and the spinal and bulbar muscular atrophy syndrome,¹⁵ but they have been detected only rarely in prostate cancer. In a large number of primary prostate cancers analyzed by several groups, only a single mutant androgen-receptor gene was identified.^{16,17,18,19,20}

The androgen-receptor genes of metastatic androgen-independent prostate cancers have not been examined extensively, owing partly to difficulty in obtaining the appropriate tissue. Nevertheless, recent reports suggest that mutations in the androgen-receptor gene can occur in androgen-independent prostate cancer.^18,19,21 In this report we show that in 5 of 10 patients with metastatic androgen-independent prostate cancer, the androgen-receptor genes had point mutations, all in the hormone-binding domain. One mutation was in the same codon as the previously described mutation in the prostate-cancer cell line (LNCaP).²² Functional studies showed that two of the mutant androgen receptors could be activated by progesterone and estrogen. These results suggest that mutant androgen-receptor genes are a selective advantage in metastatic androgen-independent prostate cancer, perhaps because they remain active after androgen ablation.

Methods

Tissue Procurement and Synthesis of Complementary DNA

Prostate-tumor tissue was obtained from patients with metastatic prostate cancer in relapse after androgen ablation by either orchiectomy or the administration of an LHRH agonist. When possible, bone marrow biopsies of posterior iliac-crest metastases were done at sites that correlated with abnormalities identified on bone scans. Other bone marrow samples were obtained at sites of pathologic fractures or from other metastatic sites. All samples were snap-frozen in liquid nitrogen and stored at -80°C until analysis. RNA was extracted from 4 to 10 frozen sections measuring 10 µm, and complementary DNA (cDNA) was synthesized according to standard methods, as described previously.²³ Additional frozen sections were analyzed microscopically to confirm the presence of prostate cancer in the samples.

Quantitation of cDNA and Expression of Androgen Receptors

To estimate the amount of cDNA in each sample, amplifications with the polymerase chain reaction (PCR) were carried out with primers for the ubiquitously expressed protein beta₂-microglobulin.²⁴ Serial dilutions of cDNA were amplified by PCR with a beta₂-microglobulin sense primer spanning exons 1 and 2 (atccagcgtactccaaagattcag) and an antisense primer in exon 4 (aaattgaaagttaacttatgcacgc). Each 20-µl reaction mixture contained cDNA, 50 ng of each primer, 100 µg of bovine serum albumin per milliliter, 0.2 mM deoxynucleoside triphosphates, 1.5 mM magnesium chloride, 50 mM potassium chloride, 10 mM TRIS (pH 9.0 at 25°C), and 1 U of Taq DNA polymerase. PCR amplifications were done for 25 to 30 cycles at 94°C for 20 seconds, 55°C for 30 seconds, and 72°C for 60 seconds, followed by a 7-minute extension at 72°C. The PCR products were separated on agarose gels, underwent Southern blotting with a beta₂-microglobulin probe (cacgtcatccagcaga, the sense primer in exon 2), and were quantitated with a phosphorimager (Molecular Dynamics, Sunnyvale, Calif.).

Approximately equal amounts of cDNA, on the basis of the expression of beta₂-microglobulin, were then amplified by PCR with androgen-receptor primers 3 and 5, located in exons A and C, respectively (Figure 1), and primers for beta₂-microglobulin. The PCR reactions were carried out for 24 cycles exactly as described above, except for the inclusion of 50 ng of each androgen-receptor primer. This number of cycles was determined in preliminary experiments to precede the plateau phase of the reaction. The products were analyzed on agarose gels and then hybridized with internal oligonucleotide probes specific for beta₂-microglobulin (see above) and androgen receptor (primer 4).

PCR Amplification, Cloning, and Sequencing of the Androgen Receptor

The androgen-receptor gene was amplified by PCR with primers 1 and 7, located at the 3' end of exon A and in the 3' untranslated region, respectively (Figure 1). A seminested PCR was then carried out with an internal primer in exon A (primer 2). The PCR products were then digested with KpnI and PstI (which cut the sample just 3' of primer 2 in exon A and 5' of primer 7 in exon H) and cloned into the PstI and KpnI sites of pBluescript. Bacterial colonies containing the androgen receptor were identified by hybridization, and multiple isolates from each patient were selected. Plasmids were purified and subjected to double-stranded sequencing with Sequenase and a series of internal sequencing primers, as described by the manufacturer (United States Biochemicals, Cleveland). Between 10 and 14 plasmids from each patient were sequenced. Additional sequencing of plasmids and direct sequencing of PCR products were carried out on a DNA sequencer (model 373A, Applied Biosystems, Foster City, Calif.) with Taq DNA polymerase and fluorescent dideoxynucleotides (Applied Biosystems). Base changes were determined to be mutations, rather than Taq polymerase errors, on the basis of their identification in multiple plasmids and their isolation after a second independent PCR amplification and analysis.

Functional Analysis of Mutant Androgen Receptors

Mutations in the androgen-receptor genes were cloned into the androgen-receptor expression vector pSV.AR_o (kindly provided by Dr. Albert Brinkmann, Erasmus University, Rotterdam, the Netherlands).²⁵ The reporter plasmid MMTVpA3LUC was derived from pHHLUC²⁶ and contained the luciferase gene under the control of an androgen-responsive element in the mouse-mammary-tumor-virus long terminal repeat (kindly provided by Dr. Richard Pestell, Northwestern University Medical School, Chicago). All experiments also included a pSV--galactosidase plasmid to control for the efficiency of transfection (Promega, Madison, Wis.). Transient transfections into CV-1 cells were carried out in triplicate with calcium phosphate (Mammalian Cell Transfection Kit, Specialty Media, Lavallette, N.J.) as described by the manufacturer. Approximately 12 hours after the transfections were initiated, the cells were washed and placed in medium containing steroid hormone–free fetal-calf serum for 4 hours. Hormones were then added, and the cells were incubated for another 24 hours. The cells were then lysed, and luciferase and -galactosidase activity were measured.

Results

Expression of Androgen Receptors in Bone Marrow Metastases from Patients with Androgen-Independent Prostate Cancer

Patients with advanced androgen-independent prostate cancer generally have widespread metastatic disease in the bone marrow. Previous studies showed that the level of expression of androgen receptors by normal lymphoid and myeloid cells was quite low or absent.²⁷ We therefore used a semiquantitative reverse-transcriptase PCR method to measure androgen-receptor transcripts in bone marrow in the presence or absence of prostate cancer.

Figure 2 shows that bone marrow samples from four patients with androgen-independent prostate cancer who were treated by androgen ablation had readily detectable levels of androgen-receptor gene transcripts (lanes 1, 3, 4, and 5). The levels in these marrow samples were similar to the level expressed by LNCaP (lane 7). In contrast, expression of the androgen-receptor gene was not detectable in samples from patients who were in complete remission after androgen ablation (Figure 2, lane 2, and data not shown). Since none of these samples contained pure populations of tumor cells (Figure 2), the average level of androgen-receptor transcripts in the tumor cells was high relative to that in LNCaP. Figure 2 also shows the level of androgen-receptor gene transcripts in a biopsy specimen obtained during a channel transurethral prostatectomy in a patient with androgen-independent prostate cancer (lane 6). This sample contained a large proportion of tumor cells and showed a correspondingly high level of androgen-receptor gene transcripts.

View larger version (13K): [in this window] [in a new window]   Figure 2. Results of Semiquantitative Reverse-Transcriptase PCR Amplification of the Androgen Receptor. Samples were amplified simultaneously to measure the amount of beta2-microglobulin and androgen-receptor cDNA, subjected to Southern blotting, and hybridized with internal oligonucleotide probes for beta2-microglobulin and androgen receptor. Lanes 1, 3, 4, and 5 show bone marrow specimens from patients with advanced androgen-independent prostate cancer (the sample in lane 5 was completely replaced by tumor, whereas the other biopsy specimens had scattered foci of tumor); lane 2, a bone marrow specimen from a patient with prostate cancer in complete remission after androgen ablation; lane 6, cells obtained during a channel transurethral prostatectomy in a patient with androgen-independent prostate cancer; and lane 7, LNCaP cells.

 
These results confirmed that metastatic androgen-independent prostate cancers contain high levels of androgen-receptor gene transcripts, whereas cells in normal bone marrow have relatively little. On the basis of these observations, we proceeded to analyze the androgen-receptor genes expressed in bone marrow and other metastatic sites in 10 patients with androgen-independent prostate cancer.

Identification of Androgen-Receptor Mutations

Tumor cells from 10 patients with metastatic androgen-independent prostate cancer (Table 1) were obtained from bone marrow (Patients 1, 2, 3, 4, 6, 8, 9, and 10), pleural fluid (Patient 5), or a skin nodule (Patient 7). The DNA-binding and hormone-binding domains of the androgen-receptor gene were amplified by PCR and cloned. Multiple isolates (10 to 14 from each patient) were sequenced. Androgen-receptor gene mutations were identified in 5 of the 10 patients (Table 2). Each of these mutations was confirmed by independent PCR amplifications.

View this table: [in this window] [in a new window]   Table 1. Clinical Characteristics of 10 Patients with Prostate Cancer.

 

View this table: [in this window] [in a new window]   Table 2. Mutations in the Androgen-Receptor Gene Identified in Five Patients with Androgen-Independent Prostate Cancer.

 
Four of the bone marrow samples (Patients 1, 2, 3, and 4) contained androgen-receptor genes with single point mutations in the hormone-binding domain. The mutation in Patient 1 was in the same codon as the mutation reported previously in LNCaP, but resulted in a different amino acid change (threonine to serine, rather than threonine to alanine).²² Both mutant and wild-type androgen-receptor genes were identified in Patients 1, 3, and 4. The wild-type genes could have been derived from normal cells in the biopsy specimens or from tumor cells with wild-type androgen-receptor genes. In contrast, every androgen-receptor gene isolated from Patient 2 had a mutation in codon 874, raising the possibility that this variation was a polymorphism and not a somatic mutation related to the malignant cell itself. To distinguish between these two possibilities, genomic DNA was isolated from peripheral-blood mononuclear cells and amplified with exon H–specific primers. The germ-line androgen-receptor gene in this material was wild type. Thus, the codon 874 variant in Patient 2 was a somatic mutation (data not shown).

Paraffin blocks containing primary-tumor specimens obtained during a prostatectomy (Patient 3) and a core biopsy of the prostate (Patient 4) were available. Areas containing tumor were microdissected, and the DNA was extracted and amplified by PCR with exon-specific primers. The androgen-receptor genes in both cases were wild type, whereas these genes were mutated in the metastatic tumors.

The cells from Patient 5, which were derived from a malignant pleural effusion, had an androgen-receptor gene with four mutations located in exons D, E, and H (Table 2). Every isolate from two separate PCR amplifications contained these four mutations, which were also evident when the amplified PCR products were sequenced directly (data not shown). This patient's prostate cancer was unusual clinically in that it presented in an inguinal lymph node and the subsequent malignant pleural effusion, which contained cells weakly positive for prostate-specific antigen, resolved with flutamide treatment. Analysis of DNA from peripheral-blood mononuclear cells with primers specific for exons E and H demonstrated that the mutations in these exons were not polymorphisms (data not shown).

Functional Analysis of Mutant Androgen Receptors

The mutant androgen-receptor genes from Patients 1 and 2, which contained single point mutations and appeared to be expressed by the majority of tumor cells, were studied functionally. The cloned genes from these two tumors were transfected into CV-1 cells, and their ability to respond to progesterone and estradiol was assessed. The wild-type and mutant androgen receptors were inactive in the absence of androgen but could be stimulated by androgen (Figure 3). As has been shown previously,²² the wild-type androgen receptor was specific for androgens and was only weakly stimulated by estrogen or progesterone (Figure 3). In contrast, the mutant androgen receptors from both patients were stimulated by estrogen and progesterone (Figure 3).

View larger version (4K): [in this window] [in a new window]   Figure 3. Functional Analysis of Androgen-Receptor Mutations. Wild-type or mutant androgen receptors were transiently expressed in CV-1 cells with a luciferase reporter gene and various concentrations of estradiol or progesterone. The luciferase activity (expressed in relative light units [RLU]) was normalized for -galactosidase activity to yield a standardized RLU. The maximal responses to androgen (5-dihydrotestosterone) for each androgen receptor averaged approximately 2,200,000 RLU for the wild-type androgen receptor, 1,500,000 RLU for the codon 874 androgen receptor, and 800,000 RLU for the codon 877 androgen receptor in three experiments. All determinations were done in triplicate, and the mean (±SE) results of a representative experiment are shown.

 
Discussion

We showed that semiquantitative amplification with reverse transcription PCR can detect transcripts of the androgen-receptor gene in metastatic androgen-independent prostate-cancer cells. The level of androgen-receptor gene expression in these samples was at least comparable to the amount expressed by LNCaP. This finding is consistent with results of immunohistochemical analysis of the expression of androgen-receptor genes in patients with advanced androgen-independent prostate cancer.^20,29 They indicate that down-regulation of the gene cannot be a frequent mechanism of escape from programmed cell death triggered by androgen ablation. Instead, they suggest that tumor-cell growth after androgen ablation requires the expression of a functional androgen-receptor gene.

Sequence analyses revealed point mutations in the hormone-binding domain of the androgen-receptor gene in 5 of 10 patients with androgen-independent prostate cancer. Mutations in the androgen-receptor gene were not found in the two archival specimens of primary tumor examined, a result consistent with previous studies showing that these mutations are extremely rare in primary prostate cancer.^{16,17,18,19,20} This finding indicates that androgen ablation selects for tumor cells with certain mutations of the androgen-receptor gene, presumably because these mutant androgen receptors do not require the usual levels of androgen to stimulate cell growth. Functional studies showing that these mutations alter the hormone specificity of the androgen receptor further support this conclusion.

The mutations in codons 874 and 877 studied in this report both generated androgen receptors that could be stimulated by estrogen and progesterone. The LNCaP mutation described previously in codon 877 (threonine to alanine) generated an androgen receptor that could also be activated by estrogen, progesterone, and flutamide.²² A mutant androgen receptor recently isolated from a patient with androgen-independent prostate cancer (with a substitution of methionine for valine at codon 715) could similarly be stimulated by progesterone.¹⁸ These observations, together with previous mutagenesis studies of codon 877,³⁰ indicate that a number of mutations in the hormone-binding domain can alter the specificity of the androgen receptor. In vitro studies indicate that the androgen receptor can also be constitutively activated by deletions in the hormone-binding domain,³¹ although such deletions have not yet been identified in vivo. Point mutations and deletions in the estrogen receptor have been found in breast cancer.^32,33

Clinical data indicate that many androgen-independent prostate cancers are sensitive to secondary hormonal treatments, including flutamide withdrawal.^4,5 These observations also suggest that functionally altered androgen receptors may be present in a substantial proportion of patients with androgen-independent prostate cancer. Nonetheless, there are other possible mechanisms of androgen independence,^34,35 the importance of which remains to be established. It is most likely that androgen-independent prostate cancers are heterogeneous, even in individual patients. The relatively short-lived response to androgen ablation indicates that a large number of cells must be androgen-independent before androgen ablation as a result of independent mutations in the androgen-receptor gene and alterations in other proteins. Our results suggest that mutant androgen-receptor genes in androgen-independent prostate cancer could be useful targets of new drugs for the treatment of prostate cancer.

Supported by a Hematology Career Training Program grant (HL07516) (to Drs. Taplin and Shuster), by a Junior Faculty Research Award from the American Cancer Society (to Dr. Balk), and by a National Cancer Institute award (R-29 CA51438) (to Dr. Bubley).

We are indebted to Drs. Albert Brinkmann (Erasmus University) and Richard Pestell (Northwestern University Medical School) for providing plasmids; to Dr. William DeWolf (Urology Division, Beth Israel Hospital), Dr. Michael Constantine (Hematology–Oncology Division, Beth Israel Hospital), Dr. Phillip Kantoff (Dana–Farber Cancer Institute), and other members of the Beth Israel Hospital Hematology–Oncology Division for their cooperation and help in obtaining biopsy specimens; to Janet R. Butmare (Department of Pathology, Beth Israel Hospital) for cutting frozen sections; and to Pushpa Srivastava for automated sequencing.

Source Information

From the Oncology Division, Department of Medicine, University of Massachusetts Medical Center, Worcester (M.-E.T.), and the Hematology–Oncology Division, Department of Medicine, Beth Israel Hospital and Harvard Medical School, Boston (G.J.B., T.D.S., M.E.F., A.E.S., G.K.O., H.N.K., S.P.B.).

Address reprint requests to Dr. Balk at the Hematology–Oncology Division, Beth Israel Hospital, 330 Brookline Ave., Boston, MA 02215.

References

1. Boring CC, Squires TS, Tong T. Cancer statistics, 1992. CA Cancer J Clin 1992;42:19-38. [Erratum, CA Cancer J Clin 1992;42:127-8.] [Medline]
2. Crawford ED. Challenges in the management of prostate cancer. Br J Urol 1992;70:Suppl 1:33-38. 
3. van Tinteren H, Dalesio O. Systematic overview (metaanalysis) of all randomized trials of treatment of prostate cancer. Cancer 1993;72:Suppl:3847-3850. [CrossRef][Medline]
4. Dawson NA. Treatment of progressive metastatic prostate cancer. Oncology 1993;7:17-24, 27. [Erratum, Oncology (Huntingt) 1993;7:2.]
5. Scher HI, Kelly WK. Flutamide withdrawal syndrome: its impact on clinical trials in hormone-refractory prostate cancer. J Clin Oncol 1993;11:1566-1572. [Free Full Text]
6. Cunha GR, Donjacour AA, Cooke PS, et al. The endocrinology and developmental biology of the prostate. Endocr Rev 1987;8:338-362. [Free Full Text]
7. Evans RM. The steroid and thyroid hormone receptor superfamily. Science 1988;240:889-895. [Free Full Text]
8. Beato M. Gene regulation by steroid hormones. Cell 1989;56:335-344. [CrossRef][Medline]
9. Riegman PHJ, Vlietstra RJ, van der Korput JAGM, Brinkmann AO, Trapman J. The promoter of the prostate-specific antigen gene contains a functional androgen responsive element. Mol Endocrinol 1991;5:1921-1930. [Free Full Text]
10. Huggins C, Stevens RE Jr, Hodges CV. Studies on prostate cancer. II. The effects of castration on advanced carcinoma of the prostate gland. Arch Surg 1941;43:209-223. [Free Full Text]
11. Colombel M, Olsson CA, Ng PY, Buttyan R. Hormone-regulated apoptosis results from reentry of differentiated prostate cells onto a defective cell cycle. Cancer Res 1992;52:4313-4319. [Free Full Text]
12. Marcelli M, Tilley WD, Wilson CM, Griffin JE, Wilson JD, McPhaul MJ. Definition of the human androgen receptor gene structure permits the identification of mutations that cause androgen resistance: premature termination of the receptor protein at amino acid residue 588 causes complete androgen resistance. Mol Endocrinol 1990;4:1105-1116. [Free Full Text]
13. Lubahn DB, Brown TR, Simental JA, et al. Sequence of the intron/exon junctions of the coding region of the human androgen receptor gene and identification of a point mutation in a family with complete androgen insensitivity. Proc Natl Acad Sci U S A 1989;86:9534-9538. [Erratum, Proc Natl Acad Sci U S A 1990;87:4411.] [Free Full Text]
14. De Bellis A, Quigley CA, Cariello NF, et al. Single base mutations in the human androgen receptor gene causing complete androgen insensitivity: rapid detection by a modified denaturing gradient gel electrophoresis technique. Mol Endocrinol 1992;6:1909-1920. [Free Full Text]
15. Caskey CT, Pizzuti A, Fu Y-H, Fenwick RG Jr, Nelson DL. Triplet repeat mutations in human disease. Science 1992;256:784-789. [Free Full Text]
16. Newmark JR, Hardy DO, Tonb DC, et al. Androgen receptor gene mutations in human prostate cancer. Proc Natl Acad Sci U S A 1992;89:6319-6323. [Free Full Text]
17. Culig Z, Klocker H, Eberle J, et al. DNA sequence of the androgen receptor in prostatic tumor cell lines and tissue specimens assessed by means of the polymerase chain reaction. Prostate 1993;22:11-22. [Medline]
18. Culig Z, Hobisch A, Cronauer MV, et al. Mutant androgen receptor detected in an advanced-stage prostatic carcinoma is activated by adrenal androgens and progesterone. Mol Endocrinol 1993;7:1541-1550. [Free Full Text]
19. Suzuki H, Sato N, Watabe Y, Masai M, Seino S, Shimazaki J. Androgen receptor gene mutations in human prostate cancer. J Steroid Biochem Mol Biol 1993;46:759-765. [CrossRef][Medline]
20. Ruizeveld de Winter JA, Janssen PJA, Sleddens HMEB, et al. Androgen receptor status in localized and locally progressive hormone refractory human prostate cancer. Am J Pathol 1994;144:735-746. [Abstract]
21. Gaddipati JP, McLeod DG, Heidenberg HB, et al. Frequent detection of codon 877 mutation in the androgen receptor gene in advanced prostate cancers. Cancer Res 1994;54:2861-2864. [Free Full Text]
22. Veldscholte J, Ris-Stalpers C, Kuiper GGJM, et al. A mutation in the ligand binding domain of the androgen receptor of human LNCaP cells affects steroid binding characteristics and response to anti-androgens. Biochem Biophys Res Commun 1990;173:534-540. [CrossRef][Medline]
23. Porcelli S, Yockey CE, Brenner MB, Balk SP. Analysis of T cell antigen receptor (TCR) expression by human peripheral blood CD4-8- / T cells demonstrates preferential use of several V genes and an invariant TCR chain. J Exp Med 1993;178:1-16. [Free Full Text]
24. Gussow D, Rein R, Ginjaar I, et al. The human 2-microglobulin gene: primary structure and definition of the transcriptional unit. J Immunol 1987;139:3132-3138. [Abstract]
25. Brinkmann AO, Faber PW, van Rooij HCJ, et al. The human androgen receptor: domain structure, genomic organization and regulation of expression. J Steroid Biochem 1989;34:307-310. [CrossRef][Medline]
26. Nordeen SK. Luciferase reporter gene vectors for analysis of promoters and enhancers. Biotechniques 1988;6:454-458. [Medline]
27. Quarmby VE, Yarbrough WG, Lubahn DB, French FS, Wilson EM. Autologous down-regulation of androgen receptor messenger ribonucleic acid. Mol Endocrinol 1990;4:22-28. [Free Full Text]
28. Lubahn DB, Joseph DR, Sar M, et al. The human androgen receptor: complementary deoxyribonucleic acid cloning, sequence analysis and gene expression in prostate. Mol Endocrinol 1988;2:1265-1275. [Free Full Text]
29. van der Kwast TH, Schalken J, Ruizeveld de Winter JA, et al. Androgen receptors in endocrine-therapy-resistant human prostate cancer. Int J Cancer 1991;48:189-193. [Medline]
30. Ris-Staplers C, Verleun-Mooijman MCT, Trapman J, Brinkmann AO. Threonine on amino acid position 868 in the human androgen receptor is essential for androgen binding specificity and functional activity. Biochem Biophys Res Commun 1993;196:173-180. [CrossRef][Medline]
31. Jenster G, van der Korput HAGM, van Vroonhoven C, van der Kwast TH, Trapman J, Brinkmann AO. Domains of the human androgen receptor involved in steroid binding, transcriptional activation, and subcellular localization. Mol Endocrinol 1991;5:1396-1404. [Free Full Text]
32. Fuqua SA, Chamness GC, McGuire WL. Estrogen receptor mutations in breast cancer. J Cell Biochem 1993;51:135-139. [CrossRef][Medline]
33. Karnik PS, Kulkarni S, Liu XP, Budd GT, Bukowski RM. Estrogen receptor mutations in tamoxifen-resistant breast cancer. Cancer Res 1994;54:349-353. [Free Full Text]
34. McDonnell TJ, Troncoso P, Brisbay SM, et al. Expression of the protooncogene bcl-2 in the prostate and its association with emergence of androgen-independent prostate cancer. Cancer Res 1992;52:6940-6944. [Free Full Text]
35. Bookstein R, MacGrogan D, Hilsenbeck SG, Sharkey F, Allred DC. p53 Is mutated in a subset of advanced-stage prostate cancers. Cancer Res 1993;53:3369-3373. [Free Full Text]

Abstract PDF Letters Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

Related Letters:

Mutated Androgen Receptors of Prostate-Cancer Cells
Figg W. D., Middleman M., Sartor O., Balk S. P., Bubley G. J., Shuster T. D.
Extract | Full Text  
N Engl J Med 1995; 333:1010-1011, Oct 12, 1995. Correspondence

This article has been cited by other articles:

• Cai, C., Wang, H., Xu, Y., Chen, S., Balk, S. P. (2009). Reactivation of Androgen Receptor-Regulated TMPRSS2:ERG Gene Expression in Castration-Resistant Prostate Cancer. Cancer Res. 69: 6027-6032 [Abstract] [Full Text]  
• Cai, C., Portnoy, D. C., Wang, H., Jiang, X., Chen, S., Balk, S. P. (2009). Androgen Receptor Expression in Prostate Cancer Cells Is Suppressed by Activation of Epidermal Growth Factor Receptor and ErbB2. Cancer Res. 69: 5202-5209 [Abstract] [Full Text]  
• Li, Y., Wang, L., Zhang, M., Melamed, J., Liu, X., Reiter, R., Wei, J., Peng, Y., Zou, X., Pellicer, A., Garabedian, M. J., Ferrari, A., Lee, P. (2009). LEF1 in Androgen-Independent Prostate Cancer: Regulation of Androgen Receptor Expression, Prostate Cancer Growth, and Invasion. Cancer Res. 69: 3332-3338 [Abstract] [Full Text]  
• Wu, K., Katiyar, S., Witkiewicz, A., Li, A., McCue, P., Song, L.-N., Tian, L., Jin, M., Pestell, R. G. (2009). The Cell Fate Determination Factor Dachshund Inhibits Androgen Receptor Signaling and Prostate Cancer Cellular Growth. Cancer Res. 69: 3347-3355 [Abstract] [Full Text]  
• O'Mahony, O. A., Steinkamp, M. P., Albertelli, M. A., Brogley, M., Rehman, H., Robins, D. M. (2008). Profiling Human Androgen Receptor Mutations Reveals Treatment Effects in a Mouse Model of Prostate Cancer. Mol Cancer Res 6: 1691-1701 [Abstract] [Full Text]  
• Zhang, Y., Linn, D., Liu, Z., Melamed, J., Tavora, F., Young, C. Y., Burger, A. M., Hamburger, A. W. (2008). EBP1, an ErbB3-binding protein, is decreased in prostate cancer and implicated in hormone resistance. Molecular Cancer Therapeutics 7: 3176-3186 [Abstract] [Full Text]  
• Risek, B., Bilski, P., Rice, A. B., Schrader, W. T. (2008). Androgen Receptor-Mediated Apoptosis Is Regulated by Photoactivatable Androgen Receptor Ligands. Mol. Endocrinol. 22: 2099-2115 [Abstract] [Full Text]  
• Shah, S., Hess-Wilson, J. K., Webb, S., Daly, H., Godoy-Tundidor, S., Kim, J., Boldison, J., Daaka, Y., Knudsen, K. E. (2008). 2,2-Bis(4-Chlorophenyl)-1,1-Dichloroethylene Stimulates Androgen Independence in Prostate Cancer Cells through Combinatorial Activation of Mutant Androgen Receptor and Mitogen-Activated Protein Kinase Pathways. Mol Cancer Res 6: 1507-1520 [Abstract] [Full Text]  
• Liu, Y., Mo, J. Q., Hu, Q., Boivin, G., Levin, L., Lu, S., Yang, D., Dong, Z., Lu, S. (2008). Targeted Overexpression of Vav3 Oncogene in Prostatic Epithelium Induces Nonbacterial Prostatitis and Prostate Cancer. Cancer Res. 68: 6396-6406 [Abstract] [Full Text]  
• Vasaitis, T., Belosay, A., Schayowitz, A., Khandelwal, A., Chopra, P., Gediya, L. K., Guo, Z., Fang, H.-B., Njar, V. C.O., Brodie, A. M.H. (2008). Androgen receptor inactivation contributes to antitumor efficacy of 17{alpha}-hydroxylase/17,20-lyase inhibitor 3{beta}-hydroxy-17-(1H-benzimidazole-1-yl)androsta-5,16-diene in prostate cancer. Molecular Cancer Therapeutics 7: 2348-2357 [Abstract] [Full Text]  
• Schayowitz, A., Sabnis, G., Njar, V. C.O., Brodie, A. M.H. (2008). Synergistic effect of a novel antiandrogen, VN/124-1, and signal transduction inhibitors in prostate cancer progression to hormone independence in vitro. Molecular Cancer Therapeutics 7: 121-132 [Abstract] [Full Text]  
• Kurahashi, N., Sasazuki, S., Iwasaki, M., Inoue, M., Shoichiro Tsugane for the JPHC Study Group, (2008). Green Tea Consumption and Prostate Cancer Risk in Japanese Men: A Prospective Study. Am J Epidemiol 167: 71-77 [Abstract] [Full Text]  
• Hodgson, M. C., Astapova, I., Hollenberg, A. N., Balk, S. P. (2007). Activity of Androgen Receptor Antagonist Bicalutamide in Prostate Cancer Cells Is Independent of NCoR and SMRT Corepressors. Cancer Res. 67: 8388-8395 [Abstract] [Full Text]  
• Askew, E. B., Gampe, R. T. Jr., Stanley, T. B., Faggart, J. L., Wilson, E. M. (2007). Modulation of Androgen Receptor Activation Function 2 by Testosterone and Dihydrotestosterone. J. Biol. Chem. 282: 25801-25816 [Abstract] [Full Text]  
• Nakauchi, H., Matsuda, K.-i., Ochiai, I., Kawauchi, A., Mizutani, Y., Miki, T., Kawata, M. (2007). A Differential Ligand-mediated Response of Green Fluorescent Protein-tagged Androgen Receptor in Living Prostate Cancer and Non-prostate Cancer Cell Lines. J. Histochem. Cytochem. 55: 535-544 [Abstract] [Full Text]  
• Haelens, A., Tanner, T., Denayer, S., Callewaert, L., Claessens, F. (2007). The Hinge Region Regulates DNA Binding, Nuclear Translocation, and Transactivation of the Androgen Receptor. Cancer Res. 67: 4514-4523 [Abstract] [Full Text]  
• Li, T.-H., Zhao, H., Peng, Y., Beliakoff, J., Brooks, J. D., Sun, Z. (2007). A promoting role of androgen receptor in androgen-sensitive and -insensitive prostate cancer cells. Nucleic Acids Res 0: gkm198v1-10 [Abstract] [Full Text]  
• Yang, Z., Chang, Y.-J., Miyamoto, H., Yeh, S., Yao, J. L., di Sant'Agnese, P. A., Tsai, M.-Y., Chang, C. (2007). Suppression of Androgen Receptor Transactivation and Prostate Cancer Cell Growth by Heterogeneous Nuclear Ribonucleoprotein A1 via Interaction with Androgen Receptor Coregulator ARA54. Endocrinology 148: 1340-1349 [Abstract] [Full Text]  
• Yang, Z., Chang, Y.-J., Miyamoto, H., Ni, J., Niu, Y., Chen, Z., Chen, Y.-L., Yao, J. L., di Sant'Agnese, P. A., Chang, C. (2007). Transgelin Functions as a Suppressor via Inhibition of ARA54-Enhanced Androgen Receptor Transactivation and Prostate Cancer Cell Growth. Mol. Endocrinol. 21: 343-358 [Abstract] [Full Text]  
• Inoue, T., Yoshida, T., Shimizu, Y., Kobayashi, T., Yamasaki, T., Toda, Y., Segawa, T., Kamoto, T., Nakamura, E., Ogawa, O. (2006). Requirement of Androgen-Dependent Activation of Protein Kinase C{zeta} for Androgen-Dependent Cell Proliferation in LNCaP Cells and Its Roles in Transition to Androgen-Independent Cells. Mol. Endocrinol. 20: 3053-3069 [Abstract] [Full Text]  
• Wetherill, Y. B., Hess-Wilson, J. K., Comstock, C. E.S., Shah, S. A., Buncher, C. R., Sallans, L., Limbach, P. A., Schwemberger, S., Babcock, G. F., Knudsen, K. E. (2006). Bisphenol A facilitates bypass of androgen ablation therapy in prostate cancer. Molecular Cancer Therapeutics 5: 3181-3190 [Abstract] [Full Text]  
• Chen, S., Xu, Y., Yuan, X., Bubley, G. J., Balk, S. P. (2006). Androgen receptor phosphorylation and stabilization in prostate cancer by cyclin-dependent kinase 1. Proc. Natl. Acad. Sci. USA 103: 15969-15974 [Abstract] [Full Text]  
• Bhuiyan, M. M.R., Li, Y., Banerjee, S., Ahmed, F., Wang, Z., Ali, S., Sarkar, F. H. (2006). Down-regulation of Androgen Receptor by 3,3'-Diindolylmethane Contributes to Inhibition of Cell Proliferation and Induction of Apoptosis in Both Hormone-Sensitive LNCaP and Insensitive C4-2B Prostate Cancer Cells.. Cancer Res. 66: 10064-10072 [Abstract] [Full Text]  
• Dong, Z., Liu, Y., Lu, S., Wang, A., Lee, K., Wang, L.-H., Revelo, M., Lu, S. (2006). Vav3 Oncogene Is Overexpressed and Regulates Cell Growth and Androgen Receptor Activity in Human Prostate Cancer. Mol. Endocrinol. 20: 2315-2325 [Abstract] [Full Text]  
• Yuan, X., Li, T., Wang, H., Zhang, T., Barua, M., Borgesi, R. A., Bubley, G. J., Lu, M. L., Balk, S. P. (2006). Androgen Receptor Remains Critical for Cell-Cycle Progression in Androgen-Independent CWR22 Prostate Cancer Cells. Am. J. Pathol. 169: 682-696 [Abstract] [Full Text]  
• Park, S.-Y., Kim, Y.-J., Gao, A. C., Mohler, J. L., Onate, S. A., Hidalgo, A. A., Ip, C., Park, E.-M., Yoon, S. Y., Park, Y.-M. (2006). Hypoxia increases androgen receptor activity in prostate cancer cells.. Cancer Res. 66: 5121-5129 [Abstract] [Full Text]  
• Pienta, K. J., Bradley, D. (2006). Mechanisms underlying the development of androgen-independent prostate cancer.. Clin. Cancer Res. 12: 1665-1671 [Full Text]  
• He, B., Gampe, R. T. Jr., Hnat, A. T., Faggart, J. L., Minges, J. T., French, F. S., Wilson, E. M. (2006). Probing the Functional Link between Androgen Receptor Coactivator and Ligand-binding Sites in Prostate Cancer and Androgen Insensitivity. J. Biol. Chem. 281: 6648-6663 [Abstract] [Full Text]  
• Stanbrough, M., Bubley, G. J., Ross, K., Golub, T. R., Rubin, M. A., Penning, T. M., Febbo, P. G., Balk, S. P. (2006). Increased expression of genes converting adrenal androgens to testosterone in androgen-independent prostate cancer.. Cancer Res. 66: 2815-2825 [Abstract] [Full Text]  
• Zheng, Z., Cai, C., Omwancha, J., Chen, S.-Y., Baslan, T., Shemshedini, L. (2006). SUMO-3 Enhances Androgen Receptor Transcriptional Activity through a Sumoylation-independent Mechanism in Prostate Cancer Cells. J. Biol. Chem. 281: 4002-4012 [Abstract] [Full Text]  
• Duff, J., McEwan, I. J. (2005). Mutation of Histidine 874 in the Androgen Receptor Ligand-Binding Domain Leads to Promiscuous Ligand Activation and Altered p160 Coactivator Interactions. Mol. Endocrinol. 19: 2943-2954 [Abstract] [Full Text]  
• Song, L.-N., Gelmann, E. P. (2005). Interaction of {beta}-Catenin and TIF2/GRIP1 in Transcriptional Activation by the Androgen Receptor. J. Biol. Chem. 280: 37853-37867 [Abstract] [Full Text]  
• Talcott, J. A. (2005). Rebalancing Ratios and Improving Impressions: Later Thoughts From the Prostate Cancer Prevention Trial Investigators. JCO 23: 7388-7390 [Full Text]  
• Rau, K-M, Kang, H-Y, Cha, T-L, Miller, S A, Hung, M-C (2005). The mechanisms and managements of hormone-therapy resistance in breast and prostate cancers. Endocr Relat Cancer 12: 511-532 [Abstract] [Full Text]  
• Schaufele, F., Carbonell, X., Guerbadot, M., Borngraeber, S., Chapman, M. S., Ma, A. A. K., Miner, J. N., Diamond, M. I. (2005). The structural basis of androgen receptor activation: Intramolecular and intermolecular amino-carboxy interactions. Proc. Natl. Acad. Sci. USA 102: 9802-9807 [Abstract] [Full Text]  
• Zhang, Y., Wang, X.-W., Jelovac, D., Nakanishi, T., Yu, M.-h., Akinmade, D., Goloubeva, O., Ross, D. D., Brodie, A., Hamburger, A. W. (2005). The ErbB3-binding protein Ebp1 suppresses androgen receptor-mediated gene transcription and tumorigenesis of prostate cancer cells. Proc. Natl. Acad. Sci. USA 102: 9890-9895 [Abstract] [Full Text]  
• Hughes, C, Murphy, A, Martin, C, Sheils, O, O'Leary, J (2005). Molecular pathology of prostate cancer. J. Clin. Pathol. 58: 673-684 [Abstract] [Full Text]  
• d'Ancona, F.C.H., Debruyne, F.M.J. (2005). Endocrine approaches in the therapy of prostate carcinoma. Hum Reprod Update 11: 309-317 [Abstract] [Full Text]  
• Lim, J. T. E., Mansukhani, M., Weinstein, I. B. (2005). Cyclin-dependent kinase 6 associates with the androgen receptor and enhances its transcriptional activity in prostate cancer cells. Proc. Natl. Acad. Sci. USA 102: 5156-5161 [Abstract] [Full Text]  
• Arnold, J. T., Le, H., McFann, K. K., Blackman, M. R. (2005). Comparative effects of DHEA vs. testosterone, dihydrotestosterone, and estradiol on proliferation and gene expression in human LNCaP prostate cancer cells. Am. J. Physiol. Endocrinol. Metab. 288: E573-E584 [Abstract] [Full Text]  
• Hodgson, M. C., Astapova, I., Cheng, S., Lee, L. J., Verhoeven, M. C., Choi, E., Balk, S. P., Hollenberg, A. N. (2005). The Androgen Receptor Recruits Nuclear Receptor CoRepressor (N-CoR) in the Presence of Mifepristone via Its N and C Termini Revealing a Novel Molecular Mechanism for Androgen Receptor Antagonists. J. Biol. Chem. 280: 6511-6519 [Abstract] [Full Text]  
• Wetherill, Y. B., Fisher, N. L., Staubach, A., Danielsen, M., de Vere White, R. W., Knudsen, K. E. (2005). Xenoestrogen Action in Prostate Cancer: Pleiotropic Effects Dependent on Androgen Receptor Status. Cancer Res. 65: 54-65 [Abstract] [Full Text]  
• Umar, A., Berrevoets, C. A., Van, N. M., van Leeuwen, M., Verbiest, M., Kleijer, W. J., Dooijes, D., Grootegoed, J. A., Drop, S. L. S., Brinkmann, A. O. (2005). Functional Analysis of a Novel Androgen Receptor Mutation, Q902K, in an Individual with Partial Androgen Insensitivity. J. Clin. Endocrinol. Metab. 90: 507-515 [Abstract] [Full Text]  
• Verras, M., Brown, J., Li, X., Nusse, R., Sun, Z. (2004). Wnt3a Growth Factor Induces Androgen Receptor-Mediated Transcription and Enhances Cell Growth in Human Prostate Cancer Cells. Cancer Res. 64: 8860-8866 [Abstract] [Full Text]  
• Masiello, D., Chen, S.-Y., Xu, Y., Verhoeven, M. C., Choi, E., Hollenberg, A. N., Balk, S. P. (2004). Recruitment of {beta}-Catenin by Wild-Type or Mutant Androgen Receptors Correlates with Ligand-Stimulated Growth of Prostate Cancer Cells. Mol. Endocrinol. 18: 2388-2401 [Abstract] [Full Text]  
• Papandreou, C. N., Logothetis, C. J. (2004). Bortezomib as a Potential Treatment for Prostate Cancer. Cancer Res. 64: 5036-5043 [Abstract] [Full Text]  
• Nakashiro, K.-i., Hara, S., Shinohara, Y., Oyasu, M., Kawamata, H., Shintani, S., Hamakawa, H., Oyasu, R. (2004). Phenotypic Switch from Paracrine to Autocrine Role of Hepatocyte Growth Factor in an Androgen-Independent Human Prostatic Carcinoma Cell Line, CWR22R. Am. J. Pathol. 165: 533-540 [Abstract] [Full Text]  
• Li, H., Ahonen, T. J., Alanen, K., Xie, J., LeBaron, M. J., Pretlow, T. G., Ealley, E. L., Zhang, Y., Nurmi, M., Singh, B., Martikainen, P. M., Nevalainen, M. T. (2004). Activation of Signal Transducer and Activator of Transcription 5 in Human Prostate Cancer Is Associated with High Histological Grade. Cancer Res. 64: 4774-4782 [Abstract] [Full Text]  
• Ellem, S. J., Schmitt, J. F., Pedersen, J. S., Frydenberg, M., Risbridger, G. P. (2004). Local Aromatase Expression in Human Prostate Is Altered in Malignancy. J. Clin. Endocrinol. Metab. 89: 2434-2441 [Abstract] [Full Text]  
• Heinlein, C. A., Chang, C. (2004). Androgen Receptor in Prostate Cancer. Endocr. Rev. 25: 276-308 [Abstract] [Full Text]  
• Ling, M.-T., Wang, X., Lee, D. T., Tam, P.C., Tsao, S.-W., Wong, Y.-C. (2004). Id-1 expression induces androgen-independent prostate cancer cell growth through activation of epidermal growth factor receptor (EGF-R). Carcinogenesis 25: 517-525 [Abstract] [Full Text]  
• Rahman, M., Miyamoto, H., Chang, C. (2004). Androgen Receptor Coregulators in Prostate Cancer: Mechanisms and Clinical Implications. Clin. Cancer Res. 10: 2208-2219 [Full Text]  
• Small, E. J., Halabi, S., Dawson, N. A., Stadler, W. M., Rini, B. I., Picus, J., Gable, P., Torti, F. M., Kaplan, E., Vogelzang, N. J. (2004). Antiandrogen Withdrawal Alone or in Combination With Ketoconazole in Androgen-Independent Prostate Cancer Patients: A Phase III Trial (CALGB 9583). JCO 22: 1025-1033 [Abstract] [Full Text]  
• Scholz, I. V., Cengic, N., Goke, B., Morris, J. C., Spitzweg, C. (2004). Dexamethasone Enhances the Cytotoxic Effect of Radioiodine Therapy in Prostate Cancer Cells Expressing the Sodium Iodide Symporter. J. Clin. Endocrinol. Metab. 89: 1108-1116 [Abstract] [Full Text]  
• Linja, M. J., Porkka, K. P., Kang, Z., Savinainen, K. J., Janne, O. A., Tammela, T. L. J., Vessella, R. L., Palvimo, J. J., Visakorpi, T. (2004). Expression of Androgen Receptor Coregulators in Prostate Cancer. Clin. Cancer Res. 10: 1032-1040 [Abstract] [Full Text]  
• Mohler, J. L., Gregory, C. W., Ford, O. H. III, Kim, D., Weaver, C. M., Petrusz, P., Wilson, E. M., French, F. S. (2004). The Androgen Axis in Recurrent Prostate Cancer. Clin. Cancer Res. 10: 440-448 [Abstract] [Full Text]  
• Ochiai, I., Matsuda, K.-i., Nishi, M., Ozawa, H., Kawata, M. (2004). Imaging Analysis of Subcellular Correlation of Androgen Receptor and Estrogen Receptor {alpha} in Single Living Cells Using Green Fluorescent Protein Color Variants. Mol. Endocrinol. 18: 26-42 [Abstract] [Full Text]  
• Song, L.-N., Coghlan, M., Gelmann, E. P. (2004). Antiandrogen Effects of Mifepristone on Coactivator and Corepressor Interactions with the Androgen Receptor. Mol. Endocrinol. 18: 70-85 [Abstract] [Full Text]  
• Fu, M., Rao, M., Wang, C., Sakamaki, T., Wang, J., Di Vizio, D., Zhang, X., Albanese, C., Balk, S., Chang, C., Fan, S., Rosen, E., Palvimo, J. J., Janne, O. A., Muratoglu, S., Avantaggiati, M. L., Pestell, R. G. (2003). Acetylation of Androgen Receptor Enhances Coactivator Binding and Promotes Prostate Cancer Cell Growth. Mol. Cell. Biol. 23: 8563-8575 [Abstract] [Full Text]  
• Yang, S.-Z., Abdulkadir, S. A. (2003). Early Growth Response Gene 1 Modulates Androgen Receptor Signaling in Prostate Carcinoma Cells. J. Biol. Chem. 278: 39906-39911 [Abstract] [Full Text]  
• Lee, D. K., Chang, C. (2003). Expression and Degradation of Androgen Receptor: Mechanism and Clinical Implication. J. Clin. Endocrinol. Metab. 88: 4043-4054 [Abstract] [Full Text]  
• Nishimura, K., Ting, H.-J., Harada, Y., Tokizane, T., Nonomura, N., Kang, H.-Y., Chang, H.-C., Yeh, S., Miyamoto, H., Shin, M., Aozasa, K., Okuyama, A., Chang, C. (2003). Modulation of Androgen Receptor Transactivation by Gelsolin: A Newly Identified Androgen Receptor Coregulator. Cancer Res. 63: 4888-4894 [Abstract] [Full Text]  
• Pan, Y., Zhang, J.-S., Gazi, M. H., Young, C. Y. F. (2003). The Cyclooxygenase 2-specific Nonsteroidal Anti-inflammatory Drugs Celecoxib and Nimesulide Inhibit Androgen Receptor Activity via Induction of c-Jun in Prostate Cancer Cells. Cancer Epidemiol. Biomarkers Prev. 12: 769-774 [Abstract] [Full Text]  
• Goetz, M. P., Toft, D. O., Ames, M. M., Erlichman, C. (2003). The Hsp90 chaperone complex as a novel target for cancer therapy. Ann Oncol 14: 1169-1176 [Abstract] [Full Text]  
• Nelson, W. G., De Marzo, A. M., Isaacs, W. B. (2003). Prostate Cancer. NEJM 349: 366-381 [Full Text]  
• Taplin, M.-E., Rajeshkumar, B., Halabi, S., Werner, C. P., Woda, B. A., Picus, J., Stadler, W., Hayes, D. F., Kantoff, P. W., Vogelzang, N. J., Small, E. J. (2003). Androgen Receptor Mutations in Androgen-Independent Prostate Cancer: Cancer and Leukemia Group B Study 9663. JCO 21: 2673-2678 [Abstract] [Full Text]  
• Rahman, M. M., Miyamoto, H., Takatera, H., Yeh, S., Altuwaijri, S., Chang, C. (2003). Reducing the Agonist Activity of Antiandrogens by a Dominant-negative Androgen Receptor Coregulator ARA70 in Prostate Cancer Cells. J. Biol. Chem. 278: 19619-19626 [Abstract] [Full Text]  
• de la Taille, A., Rubin, M. A., Chen, M.-W., Vacherot, F., de Medina, S. G.-D., Burchardt, M., Buttyan, R., Chopin, D. (2003). {beta}-Catenin-related Anomalies in Apoptosis-resistant and Hormone-refractory Prostate Cancer Cells. Clin. Cancer Res. 9: 1801-1807 [Abstract] [Full Text]  
• Rahman, M. M., Miyamoto, H., Lardy, H., Chang, C. (2003). Inactivation of androgen receptor coregulator ARA55 inhibits androgen receptor activity and agonist effect of antiandrogens in prostate cancer cells. Proc. Natl. Acad. Sci. USA 100: 5124-5129 [Abstract] [Full Text]  
• Bakin, R. E., Gioeli, D., Bissonette, E. A., Weber, M. J. (2003). Attenuation of Ras Signaling Restores Androgen Sensitivity to Hormone-refractory C4-2 Prostate Cancer Cells. Cancer Res. 63: 1975-1980 [Abstract] [Full Text]  
• Song, L.-N., Herrell, R., Byers, S., Shah, S., Wilson, E. M., Gelmann, E. P. (2003). {beta}-Catenin Binds to the Activation Function 2 Region of the Androgen Receptor and Modulates the Effects of the N-Terminal Domain and TIF2 on Ligand-Dependent Transcription. Mol. Cell. Biol. 23: 1674-1687 [Abstract] [Full Text]  
• Lamb, D. J., Puxeddu, E., Malik, N., Stenoien, D. L., Nigam, R., Saleh, G. Y., Mancini, M., Weigel, N. L., Marcelli, M. (2003). Molecular Analysis of the Androgen Receptor in Ten Prostate Cancer Specimens Obtained Before and After Androgen Ablation. J Androl 24: 215-225 [Abstract] [Full Text]  
• Santamaria, A., Fernandez, P. L., Farre, X., Benedit, P., Reventos, J., Morote, J., Paciucci, R., Thomson, T. M. (2003). PTOV-1, a Novel Protein Overexpressed in Prostate Cancer, Shuttles between the Cytoplasm and the Nucleus and Promotes Entry into the S Phase of the Cell Division Cycle. Am. J. Pathol. 162: 897-905 [Abstract] [Full Text]  
• Thin, T. H., Wang, L., Kim, E., Collins, L. L., Basavappa, R., Chang, C. (2003). Isolation and Characterization of Androgen Receptor Mutant, AR(M749L), with Hypersensitivity to 17-beta Estradiol Treatment. J. Biol. Chem. 278: 7699-7708 [Abstract] [Full Text]  
• Balk, S. P., Ko, Y.-J., Bubley, G. J. (2003). Biology of Prostate-Specific Antigen. JCO 21: 383-391 [Abstract] [Full Text]  
• Hara, T., Miyazaki, J.-i., Araki, H., Yamaoka, M., Kanzaki, N., Kusaka, M., Miyamoto, M. (2003). Novel Mutations of Androgen Receptor: A Possible Mechanism of Bicalutamide Withdrawal Syndrome. Cancer Res. 63: 149-153 [Abstract] [Full Text]  
• Comuzzi, B., Lambrinidis, L., Rogatsch, H., Godoy-Tundidor, S., Knezevic, N., Krhen, I., Marekovic, Z., Bartsch, G., Klocker, H., Hobisch, A., Culig, Z. (2003). The Transcriptional Co-Activator cAMP Response Element-Binding Protein-Binding Protein Is Expressed in Prostate Cancer and Enhances Androgen- and Anti-Androgen-Induced Androgen Receptor Function. Am. J. Pathol. 162: 233-241 [Abstract] [Full Text]  
• Lee, Y.-F., Lin, W.-J., Huang, J., Messing, E. M., Chan, F. L., Wilding, G., Chang, C. (2002). Activation of Mitogen-activated Protein Kinase Pathway by the Antiandrogen Hydroxyflutamide in Androgen Receptor-negative Prostate Cancer Cells. Cancer Res. 62: 6039-6044 [Abstract] [Full Text]  
• Masiello, D., Cheng, S., Bubley, G. J., Lu, M. L., Balk, S. P. (2002). Bicalutamide Functions as an Androgen Receptor Antagonist by Assembly of a Transcriptionally Inactive Receptor. J. Biol. Chem. 277: 26321-26326 [Abstract] [Full Text]  
• Gelmann, E. P. (2002). Molecular Biology of the Androgen Receptor. JCO 20: 3001-3015 [Abstract] [Full Text]  
• Dai, J., Shen, R., Sumitomo, M., Stahl, R., Navarro, D., Gershengorn, M. C., Nanus, D. M. (2002). Synergistic Activation of the Androgen Receptor by Bombesin and Low-Dose Androgen. Clin. Cancer Res. 8: 2399-2405 [Abstract] [Full Text]  
• Nelson, K. A., Witte, J. S. (2002). Androgen Receptor CAG Repeats and Prostate Cancer. Am J Epidemiol 155: 883-890 [Abstract] [Full Text]  
• Krishnan, A. V., Zhao, X.-Y., Swami, S., Brive, L., Peehl, D. M., Ely, K. R., Feldman, D. (2002). A Glucocorticoid-Responsive Mutant Androgen Receptor Exhibits Unique Ligand Specificity: Therapeutic Implications for Androgen-Independent Prostate Cancer. Endocrinology 143: 1889-1900 [Abstract] [Full Text]  
• Wetherill, Y. B., Petre, C. E., Monk, K. R., Puga, A., Knudsen, K. E. (2002). The Xenoestrogen Bisphenol A Induces Inappropriate Androgen Receptor Activation and Mitogenesis in Prostatic Adenocarcinoma Cells. Molecular Cancer Therapeutics 1: 515-524 [Abstract] [Full Text]  
• Chang, C.-Y., McDonnell, D. P. (2002). Evaluation of Ligand-Dependent Changes in AR Structure Using Peptide Probes. Mol. Endocrinol. 16: 647-660 [Abstract] [Full Text]  
• Sasaki, M., Tanaka, Y., Perinchery, G., Dharia, A., Kotcherguina, I., Fujimoto, S. i., Dahiya, R. (2002). Methylation and Inactivation of Estrogen, Progesterone, and Androgen Receptors in Prostate Cancer. JNCI J Natl Cancer Inst 94: 384-390 [Abstract] [Full Text]  
• Shi, X.-B., Ma, A.-H., Xia, L., Kung, H.-J., de Vere White, R. W. (2002). Functional Analysis of 44 Mutant Androgen Receptors from Human Prostate Cancer. Cancer Res. 62: 1496-1502 [Abstract] [Full Text]  
• Miyamoto, H., Rahman, M., Takatera, H., Kang, H.-Y., Yeh, S., Chang, H.-C., Nishimura, K., Fujimoto, N., Chang, C. (2002). A Dominant-negative Mutant of Androgen Receptor Coregulator ARA54 Inhibits Androgen Receptor-mediated Prostate Cancer Growth. J. Biol. Chem. 277: 4609-4617 [Abstract] [Full Text]  
• Lee, S. R., Ramos, S. M., Ko, A., Masiello, D., Swanson, K. D., Lu, M. L., Balk, S. P. (2002). AR and ER Interaction with a p21-Activated Kinase (PAK6). Mol. Endocrinol. 16: 85-99 [Abstract] [Full Text]  
• Chang, C.-Y., Walther, P. J., McDonnell, D. P. (2001). Glucocorticoids Manifest Androgenic Activity in a Cell Line Derived from a Metastatic Prostate Cancer. Cancer Res. 61: 8712-8717 [Abstract] [Full Text]  
• Grossmann, M. E., Huang, H., Tindall, D. J. (2001). Androgen Receptor Signaling in Androgen-Refractory Prostate Cancer. JNCI J Natl Cancer Inst 93: 1687-1697 [Abstract] [Full Text]  
• Stanbrough, M., Leav, I., Kwan, P. W. L., Bubley, G. J., Balk, S. P. (2001). Prostatic intraepithelial neoplasia in mice expressing an androgen receptor transgene in prostate epithelium. Proc. Natl. Acad. Sci. USA 10.1073/pnas.191235898v1 [Abstract] [Full Text]  
• Taplin, M. E., Ho, S.-M. (2001). The Endocrinology of Prostate Cancer. J. Clin. Endocrinol. Metab. 86: 3467-3477 [Full Text]  
• Matsubara, S., Wada, Y., Gardner, T. A., Egawa, M., Park, M.-S., Hsieh, C.-L., Zhau, H. E., Kao, C., Kamidono, S., Gillenwater, J. Y., Chung, L. W. K. (2001). A Conditional Replication-competent Adenoviral Vector, Ad-OC-E1a, to Cotarget Prostate Cancer and Bone Stroma in an Experimental Model of Androgen-independent Prostate Cancer Bone Metastasis. Cancer Res. 61: 6012-6019 [Abstract] [Full Text]  
• Reutens, A. T., Fu, M., Wang, C., Albanese, C., McPhaul, M. J., Sun, Z., Balk, S. P., Jänne, O. A., Palvimo, J. J., Pestell, R. G. (2001). Cyclin D1 Binds the Androgen Receptor and Regulates Hormone-Dependent Signaling in a p300/CBP-Associated Factor (P/CAF)-Dependent Manner. Mol. Endocrinol. 15: 797-811 [Abstract] [Full Text]  
• Linja, M. J., Savinainen, K. J., Saramäki, O. R., Tammela, T. L. J., Vessella, R. L., Visakorpi, T. (2001). Amplification and Overexpression of Androgen Receptor Gene in Hormone-Refractory Prostate Cancer. Cancer Res. 61: 3550-3555 [Abstract] [Full Text]