Background Congenital bilateral absence of the vas deferens(CBAVD) is a form of male infertility in which mutations inthe cystic fibrosis transmembrane conductance regulator (CFTR)gene have been identified. The molecular basis of CBAVD is notcompletely understood. Although patients with cystic fibrosishave mutations in both copies of the CFTR gene, most patientswith CBAVD have mutations in only one copy of the gene.
Methods To investigate CBAVD at the molecular level, we havecharacterized the mutations in the CFTR gene in 102 patientswith this condition. None had clinical manifestations of cysticfibrosis. We also analyzed a DNA variant (the 5T allele) ina noncoding region of CFTR that causes reduced levels of thenormal CFTR protein. Parents of patients with cystic fibrosis,patients with types of infertility other than CBAVD, and normalsubjects were studied as controls.
Results Nineteen of the 102 patients with CBAVD had mutationsin both copies of the CFTR gene, and none of them had the 5Tallele. Fifty-four patients had a mutation in one copy of CFTR,and 34 of them (63 percent) had the 5T allele in the other CFTRgene. In 29 patients no CFTR mutations were found, but 7 ofthem (24 percent) had the 5T allele. In contrast, the frequencyof this allele in the general population was about 5 percent.
Conclusions Most patients with CBAVD have mutations in the CFTRgene. The combination of the 5T allele in one copy of the CFTRgenewith a cystic fibrosis mutation in the other copy is themost common cause of CBAVD. The 5T allele mutation has a widerange of clinical presentations, occurring in patients withCBAVD or moderate forms of cystic fibrosis and in fertile men.
Congenital bilateral absence of the vas deferens (CBAVD) accountsfor at least 6 percent of cases of obstructive azoospermia andis responsible for 1 to 2 percent of cases of infertility inmen.1 CBAVD is also present in about 95 percent of male patientswith cystic fibrosis, a disorder characterized by chronic pulmonarydisease, pancreatic exocrine insufficiency, and elevated concentrationsof electrolytes in sweat.2
Mutations in the cystic fibrosis transmembrane conductance regulator(CFTR) gene, which encodes a cyclic AMP–regulated chloridechannel,3,4 have been found in patients with cystic fibrosis.5,6Patients with the classic form of cystic fibrosis have severemutations in each copy of the CFTR gene, whereas patients witha less severe phenotype (i.e., with normal pancreatic functionand mild lung disease) have a severe mutation in one copy ofCFTR and a mild mutation in the other, or mild mutations inboth copies.7
Mutations in the CFTR gene have also been identified in patientswith CBAVD, which suggests that this condition is a primarilygenital form of cystic fibrosis.8,9,10,11,12 Thus, patientswith CBAVD would be expected, like all patients with cysticfibrosis, to have two CFTR mutations. However, few patientswith CBAVD have mutations in both copies of the CFTR gene; inthe majority of cases, only one mutation has been found, andin about a third no mutations have been detected. The inabilityof investigators to identify two CFTR mutations in these patients,even after analyzing the entire coding sequence, is not wellunderstood, but it could be explained by the presence of mutationsin noncoding regions of the gene. Such mutations would produceabnormally low levels of CFTR protein, which may cause obstructionof the vas deferens, but there may be sufficient protein toprevent disease in other organs normally affected by cysticfibrosis.
Low levels of the CFTR protein could be due to a decreased proportionof the normal messenger RNA (mRNA) of CFTR. Studies of CFTRmRNA in tissue from normal persons have identified various mRNAmolecules that lack exon 4, 9, or 12.13,14,15,16,17 Whetheror not CFTR mRNA contains exon 9 depends on the variable lengthof a DNA sequence of thymines in intron 8 of CFTR (Figure 1).18This sequence, known as a polyT sequence, contains five, seven,or nine thymines (the 5T, 7T, and 9T alleles, respectively).Since the 5T allele causes reduced levels of normal CFTR mRNA,18this DNA variant would appear likely to be involved in the pathogenesisof CBAVD.
Figure 1. DNA Variants in Intron 8 of the CFTR Gene and Their Effects at the mRNA Level.
The region of the CFTR gene that includes exons 7 to 10 is shown at the top. During processing, the sequences not involved with protein synthesis (introns) are eliminated, and the remaining sequences (exons) are spliced to form mature mRNA (center left). The processing of CFTR is not completely efficient, because 10 to 92 percent of transcripts lack exon 9 (bottom left), depending on the person's genotype.13,18 When both CFTR genes bear the 5T allele (the 5T/5T genotype), the proportion of normal CFTR mRNA is reduced to approximately 8 to 12 percent, indicating that the shorter the sequence of thymines in intron 8, the higher the proportion of CFTR mRNA in which exon 9 is lacking.18
To understand the molecular genetics of CBAVD better, we havecharacterized the CFTR mutations in patients with this conditionand studied the putative involvement of the 5T allele in CBAVDand other types of male infertility.
Methods
Patients
We studied 102 unrelated men with azoospermia and CBAVD, asdiagnosed on the basis of scrotal exploration and analysis ofsemen (volume and pH of semen, sperm count, and concentrationsof fructose and citrate). The patients came from Belgium, France,Spain, and the United States.12,19,20 None had pulmonary orgastrointestinal manifestations of cystic fibrosis. The resultsof sweat chloride analysis and additional clinical data on thesepatients have already been presented.12,19,20 The diagnosesof CBAVD were initially suggested by the clinical observationof impalpable vasa in the patients and were subsequently confirmedby analyses of semen and transrectal and abdominal ultrasonography.Each patient had a sperm count of zero.
Control Subjects
We studied 186 fathers and 44 mothers of patients with cysticfibrosis, each of whom carried a known CFTR mutation,21 and46 normal subjects from the general population in Spain. Wealso studied 12 patients with congenital unilateral absenceof the vas deferens (CUAVD) and 10 patients with obstructiveazoospermia not due to CBAVD or CUAVD. The patients with azoospermiabut without CBAVD were in the care of the Andrology Departmentof the Institute of Urology, Nephrology, and Andrology in Barcelona,Spain, because of infertility; those with CUAVD were seen becauseof infertility or prostate problems or because they had requestedvasectomy. The mean sperm concentration in the patients withCUAVD was 10.6 x 106 per milliliter (range, 0 to 90 x 106).
Analysis of CFTR Mutations
DNA was isolated from peripheral-blood lymphocytes accordingto standard protocols.22 Genomic DNA from the patients withCBAVD was first analyzed for the most common cystic fibrosismutation, F508.5 To identify other cystic fibrosis mutationsin these patients, each of the 27 exons of the CFTR gene andtheir flanking sequences were amplified by the polymerase chainreaction (PCR). After PCR, all exons were studied by denaturinggradient-gel electrophoresis or by single-strand conformationanalysis, as previously described.23,24
The 5T Allele of Intron 8 of CFTR
We analyzed the frequency of the 5T allele (the sequence offive thymines mainly responsible for the absence of exon 9 inCFTR mRNA) in the general population (i.e., in apparently normalchromosomes), fathers and mothers of patients with cystic fibrosis(who carry one chromosome with the cystic fibrosis mutationand one normal chromosome), and men with CBAVD. To evaluatethe incidence of the 5T allele of intron 8 in CBAVD and infertility,we studied the frequency of heterozygosity for the allele inpatients with CBAVD, patients with CUAVD, patients with azoospermiabut not CBAVD, and the general population.
Exon 9 was first amplified with primers 9i-5 and 9i-3.25 ThePCR conditions were as follows: denaturation at 95°C for30 seconds, annealing at 54°C for 30 seconds, and extensionat 74°C for 40 seconds, for 25 cycles. The reaction mixturecontained 5 µl of PCR buffer (N808-0006, Perkin-ElmerCetus); 200 µM each of deoxyadenosine triphosphate, deoxycytidinetriphosphate, deoxyguanosine triphosphate, and deoxythymidinetriphosphate; 20 pmol of each primer; and 1 unit of Taq DNApolymerase in a final volume of 50 µl, containing 100ng of genomic DNA. To amplify the polypyrimidine sequence whileavoiding the adjacent dinucleotide repeat (GT)n,13 we performeda nested PCR with primers I9D9 (5'CCGCCGCTGTGTGTGTGTGTGTGTTTTT3')and E9R2 (5'GGATCCAGCAACCGCCAACA3'). The conditions of the nestedPCR were as described above except that 1 µl from thefirst PCR was used, but for 35 cycles. The final PCR productswere digested with XmnI and visualized on an 8 percent nondenaturingpolyacrylamide gel after electrophoresis for four to five hoursat 180 V (Figure 2).
Figure 2. PCR Analysis of Alleles in the polyT Sequence of Intron 8 of the CFTR Gene.
Heteroduplex molecules (H) are due to the hybridization of strands from the 5T, 7T, and 9T alleles (A). The genotypes are indicated beneath each lane.
Statistical Analysis
Differences between proportions were tested by the chi-squarestatistic.26 Yates' correction for continuity was used in thetwo-by-two tables. Relative risks were calculated for the comparisonof the patients with CBAVD with the normal patients. All P valueswere based on two-sided comparisons. P values of less than 0.05were considered to indicate statistical significance.
Results
CFTR Mutations in CBAVD
We studied a group of 102 patients with CBAVD from Europe andthe United States with regard to mutations in the CFTR gene.The analysis of the entire coding sequence allowed us to identify28 different mutations (Table 1). Most of the mutations havebeen described previously in patients with cystic fibrosis,but others have been detected specifically in patients withCBAVD. Nineteen patients had mutations in both copies of CFTR(one severe and one mild mutation in 16 patients, and two mildmutations in 3), and 54 patients had mutations in only one CFTRallele. In 29 patients, after comprehensive screening, we wereunable to find any mutations in the coding or splice regionsof CFTR.12,19,20
Table 1. CFTR and polyT Genotypes of 102 Patients with CBAVD.
Frequencies of the 5T Allele DNA Variant of Intron 8 of CFTR
In the Spanish population, the frequency of the 5T allele, whichis responsible for abnormal CFTR mRNA, was similar (5.4 percent)to that previously reported in other populations (5.2 percent)27,28,29(P = 0.98), and the populations were pooled for comparativeanalyses (frequency of the 5T allele in the general population,5.2 percent). The frequency of the 5T allele in the normal chromosomesof mothers of patients with cystic fibrosis (the non–cysticfibrosis chromosomes) was similar (4.5 percent) to that in thegeneral population (P = 0.87), but the frequency was lower inthe normal chromosomes of fathers of patients with cystic fibrosis(2.1 percent) (P = 0.12). In contrast, the 5T allele was significantlymore frequent in the chromosomes of patients with CBAVD (21.1percent) than in the general population (chi-square = 39.3,P<0.001) (Table 2).
Table 2. Frequencies of the polyT Alleles in Intron 8 of CFTR in Members of the General Population and Subjects with CBAVD, and in the Non–Cystic Fibrosis Chromosomes of Parents of Patients with Cystic Fibrosis.
The 5T Allele and Infertility
We evaluated the incidence of the 5T allele in men with varioustypes of infertility. Table 3 shows that the percentage of patientswith CBAVD who had this allele was significantly higher thanthat of the general population (40.2 vs. 10.9 percent) (chi-square= 11.4, P<0.001, relative risk = 5.1), whereas the proportionof patients with CUAVD who had the 5T allele (25 percent) waslower than, but not significantly different from, the proportionamong patients with CBAVD (P = 0.48). On the other hand, theproportion of patients with azoospermia but without CBAVD whohad the 5T allele was similar to that of the general population(P = 0.71).
Table 3. Frequency of Heterozygosity for the CFTR 5T Allele among Patients with CBAVD, CUAVD, or Azoospermia but No CBAVD and Members of the General Population.
CFTR Mutations and the 5T Allele in Patients with Cbavd
In most patients with CBAVD, the 5T allele was strongly associatedwith the presence of a cystic fibrosis mutation in the othercopy of the CFTR gene (chi-square = 9.9, P = 0.0016), but noneof the patients with CBAVD who had two CFTR mutations carriedthis allele (Table 4). Two patients were each found to havetwo 5T alleles. In one patient one of the alleles was associatedwith a mild cystic fibrosis mutation,19 whereas in the otherpatient no CFTR mutations were identified.
Table 4. Classification of 102 Patients with CBAVD According to the Presence or Absence of the CFTR Mutation and of a polyT Allele at Intron 8.
The association between the various CFTR mutations and the 5Tallele in the patients with CBAVD was analyzed by studying thetransmission of the mutations within families (Table 1). Onlyone CFTR mutation (A800G) was associated with the 5T allele,whereas all the others were associated with the 7T or the 9Tallele, confirming that in each patient with CBAVD the 5T allelecorresponded to the chromosome that did not carry the CFTR mutation.
Discussion
The main objectives of this study were to determine whetherpatients with CBAVD had mutations in the CFTR gene and to explorewhether noncoding sequences that produce low levels of CFTRmRNA (the 5T allele) were responsible for CBAVD.
Most patients with CBAVD in this study (72 percent) had a mutationin at least one of their CFTR genes, but only 19 percent hadmutations on both chromosomes, with at least one of the twomutations being mild.12,19,20 Inability to identify the secondmutation in most patients with CBAVD, even after all 27 CFTRexons were analyzed, suggests that mutations could be locatedelsewhere in the noncoding regions of CFTR. These mutationsmay result in a CFTR protein with a normal structure but lowlevels of expression,10 which may cause disease only in theorgans most sensitive to CFTR dysfunction, such as the vas deferens.30,31
The reduced levels of normal CFTR mRNA due to the deletion ofexon 9 depend on the presence of the 5T allele sequence in intron8. This nonfunctional CFTR mRNA accounts for up to 92 percentof the total mRNA when both CFTR genes have the 5T allele.18We have found a significant proportion of men with CBAVD whohave the 5T allele, as compared with men in the general population,which suggests that this allele functions as a disease mutationin CBAVD. Similarly, the proportion of men with CUAVD who havethe 5T allele was higher than in the general population, butlower than among men with CBAVD. Because CFTR mutations havealso been found in patients with CUAVD,12,19 that conditioncould be an incomplete form of CBAVD. In contrast, the proportionof men with azoospermia but without CBAVD who had the 5T allelewas similar to that in the general population, suggesting thatazoospermia not due to CBAVD or CUAVD is unrelated to CFTR.
The particular combination of the two CFTR alleles in a givenperson (the genotype) results in specific levels of normal CFTRmRNA and in a specific clinical phenotype (Figure 3). It hasbeen shown that if normal CFTR mRNA is present at a level ofless than 1 to 3 percent, a severe cystic fibrosis phenotyperesults32; if the level is above 8 to 12 percent, the phenotypeis normal18; and at intermediate levels, the phenotype is oneof mild cystic fibrosis.33 Thus, patients with one cystic fibrosismutation on one chromosome and the 5T allele on the other shouldhave abnormally low levels of normal CFTR mRNA.
Figure 3. Comparison of Percentages of Normal CFTR mRNA, Clinical Phenotypes, and CFTR Genotypes.
Levels of normal CFTR mRNA depend on the genotype determining the length of the thymine sequence in intron 8 of CFTR, the presence of cystic fibrosis mutations, or both. Decreased levels of normal CFTR mRNA may be involved in various clinical phenotypes, ranging from the normal phenotype to the phenotypes of CBAVD, cystic fibrosis with pancreatic sufficiency (PS), and cystic fibrosis with pancreatic insufficiency (PI). Genotypes that correspond to the combination of a cystic fibrosis mutation with a 5T allele (CF/5T) have been found in normal persons, patients with CBAVD, and patients with cystic fibrosis and pancreatic sufficiency. Genotypes combining a severe and a moderate cystic fibrosis mutation (CF/CFM) or two moderate mutations (CFM/CFM) can be involved in either CBAVD or cystic fibrosis with pancreatic sufficiency (bracket). The delimitation between the normal, CBAVD, and cystic fibrosis phenotypes and their relations with levels of CFTR mRNA is only approximate. The distribution of levels of CFTR mRNA in relation to the presence of the 5T, 7T, and 9T alleles and genotypes is derived from the work of Chu et al.18
The study performed here allows patients with CBAVD to be classifiedin five categories (Table 4): patients with two CFTR mutations(group 1a, 19 percent of patients with CBAVD); patients withone CFTR mutation and the 5T allele (group 1b, 33 percent);patients with only one CFTR mutation (group 2a, 20 percent);patients with only the 5T allele (group 2b, 7 percent); andpatients without CFTR mutations (group 3, 21 percent). Group1 is completely characterized if the 5T allele is a mutationin patients with CBAVD, whereas in group 2 other, as yet unknown,mutations in the CFTR gene may be involved. Finally, in group3, a gene or genes other than CFTR may be responsible for CBAVD.
Parents of patients with cystic fibrosis have one normal CFTRgene and one gene with a cystic fibrosis mutation. Since fathersof patients with cystic fibrosis are not infertile, if the 5Tallele was involved in CBAVD, it would be expected to be presentat a low frequency in these subjects. Our data show that thefrequency of the 5T allele in fathers who carry the cystic fibrosismutation is slightly lower than that in both the general populationand mothers who carry the mutation (2.1 percent vs. 5.2 percentand 4.5 percent), reinforcing the hypothesis that the 5T allelehas a role in CBAVD (Table 2).
Four fathers who were carriers of cystic fibrosis had one CFTRgene with the 5T allele and the other with a severe cystic fibrosismutation (G542X, N1303K, 1812-1GA, or 936delTA). Although thesegenotypes should have been associated with CBAVD, these menhad offspring and are clinically normal. Three hypotheses couldexplain the strong but not complete correlation between theappearance of the 5T allele and CBAVD. First, there could bea nonrandom association between the 5T allele and CBAVD, withthe allele segregating with the CBAVD phenotype but not beingits cause. Second, there could be a partially causal role forthe 5T allele, together with additional mutations in other partsof the CFTR gene. Third, the 5T allele could have a causal rolein CBAVD, with other factors accounting for these exceptionalmen without CBAVD (the four fathers bearing the cystic fibrosismutation). The work presented here argues convincingly againstthe first two hypotheses. Nonrandom association is not the case,since the analysis of several DNA markers within CFTR in thefour fathers and in patients with CBAVD showed that severalhaplotypes (combinations of alleles on the same chromosome)were associated with the 5T allele (data not shown). The presenceof another mutation in the same CFTR gene as the 5T allele isalso excluded, since CFTR was thoroughly analyzed in all patientswith CBAVD and it is extremely unlikely that all patients withthe 5T allele had mutations outside the CFTR coding region.These data and the association of the 5T allele with low levelsof normal CFTR mRNA18 strongly support the concept that the5T mutation generally causes CBAVD when it is associated witha cystic fibrosis mutation on the other chromosome.
Additional information about the importance of the 5T mutationwas obtained by screening 120 patients with cystic fibrosis.We identified three adults with the F508/5T genotype who hadmild lung disease starting in their 30s and CBAVD, but no pancreaticdisease. Three other patients, 8, 12, and 14 years of age withthe genotypes E585X/5T and K710X/5T (two were siblings), hada diagnosis of cystic fibrosis due to elevated concentrationsof electrolytes in sweat (>60 mmol per liter) and episodesof dehydration, but no other clinical features. Since personswith a cystic fibrosis mutation and the 5T allele may have levelsof normal CFTR mRNA below the range of 8 to 12 percent (theminimal level for a normal phenotype18) but above the rangeof 1 to 3 percent (the level below which severe cystic fibrosisoccurs31), a wide clinical variation is expected in them, dependingon the variability of levels of normal CFTR mRNA. These clinicalforms should include CBAVD, moderate cystic fibrosis, and theabsence of fertility problems (Figure 3).
In summary, we report the following findings: First, that the5T allele in intron 8 of CFTR has clinical effects related tomale infertility. Second, that in 33 percent of cases the CBAVDphenotype results from the combined action of the 5T alleleand a cystic fibrosis mutation on the other chromosome. In addition,19 percent of cases of CBAVD are due to the presence of twoCFTR mutations other than the 5T allele. Moreover, the presenceof only one CFTR mutation (without the 5T allele) in 20 percentof patients suggests that other undetected changes in CFTR maybe involved in CBAVD. Furthermore, the relatively high proportionof patients with CBAVD who do not have CFTR mutations (22 percent)allows us to propose that another gene or genes could be responsiblefor CBAVD. Finally, CUAVD could be an incomplete form of CBAVD.
A large number of cystic fibrosis mutations have been discoveredduring the past five years, and it seems that we are now betterprepared to understand how mutations combine to cause disease.The combination of the 5T allele with a cystic fibrosis mutationin the other CFTR gene is the most common cause of CBAVD, butit also has other clinical presentations. Our report on CFTRmutations in patients with CBAVD indicates that CBAVD and cysticfibrosis are extreme forms of a wide nosologic spectrum of conditionsthat have a common molecular basis.
Supported by a grant (93/0202E) from the Fondo de InvestigacionesSanitarias de la Seguridad Social and by grants from the InstitutCatalà de la Salut (Generalitat de Catalunya) and theAssociation Française de Lutte contre la Mucoviscidose.
We are indebted to Drs. M. Pritchard and F. Cardellach for usefulsuggestions and comments, to H. Kruyer for assistance with themanuscript, and to J. Giménez, M.D. Ramos, and M. Mirandafor technical assistance.
Source Information
From the Cancer Research Institute, Molecular Genetics Department, Hospital Duran i Reynals, L'Hospitalet de Llobregat, Barcelona, Spain (M. Chillón, T.C., V.N., X.E.); the Centre de Biogénétique, University Hospital, Brest, France (B.M., C.V., C.F.); the Andrology Department, Institute of Urology, Nephrology, and Andrology, Fundació Puigvert, Barcelona (L.B., J.R.-R.); the Department of Medical Genetics, Vrije Universiteit, Brussels, Belgium (W.L.); the Department of Urology and Microsurgery, St. Luke's Hospital, St. Louis (S.S.); the Laboratoire de Biochimie Génétique, Institut de Biologie, Montpellier, France (M.-C.R., M. Claustres); and the Genetics Service, Hospital Clinic, Barcelona (X.E.).
Address reprint requests to Dr. Estivill at the Cancer Research Institute, Hospital Duran i Reynals, Avia. Castelldefels Km 2.7, 08907 L'Hospitalet de Llobregat, Barcelona, Catalonia, Spain.
References
Jequier AM, Ansell ID, Bullimore NJ. Congenital absence of the vasa deferentia presenting with infertility. J Androl 1985;6:15-19. [Free Full Text]
Boat TF, Welsh MJ, Beaudet AL. Cystic fibrosis. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic basis of inherited disease. 6th ed. Vol. 2. New York: McGraw-Hill, 1989:2649-80.
Riordan JR, Rommens JM, Kerem B, et al. Identification of the cystic fibrosis gene: cloning and characterization of complementary DNA. Science 1989;245:1066-1073. [Erratum, Science 1989;245:1437.] [Free Full Text]
Anderson MP, Berger HA, Rich DP, Gregory RJ, Smith AE, Welsh MJ. Nucleoside triphosphates are required to open the CFTR chloride channel. Cell 1991;67:775-784. [CrossRef][Medline]
Kerem BS, Rommens JM, Buchanan JA, et al. Identification of the cystic fibrosis gene: genetic analysis. Science 1989;245:1073-1080. [Free Full Text]
Tsui L-C. The spectrum of cystic fibrosis mutations. Trends Genet 1992;8:392-398. [Medline]
The Cystic Fibrosis Genotype-Phenotype Consortium. Correlation between genotype and phenotype in patients with cystic fibrosis. N Engl J Med 1993;329:1308-1313. [Free Full Text]
Dumur V, Gervais R, Rigot JM, et al. Abnormal distribution of CF F508 allele in azoospermic men with congenital aplasia of epididymis and vas deferens. Lancet 1990;336:512-512. [Medline]
Anguiano A, Oates RD, Amos JA, et al. Congenital bilateral absence of the vas deferens: a primary genital form of cystic fibrosis. JAMA 1992;267:1794-1797. [Abstract]
Osborne LR, Lynch M, Middleton PG, et al. Nasal epithelial ion transport and genetic analysis of infertile men with congenital bilateral absence of the vas deferens. Hum Mol Genet 1993;2:1605-1609. [Erratum, Hum Mol Genet 1993;2:1990.] [Free Full Text]
Gervais R, Dumur V, Rigot JM, et al. High frequency of the R117H cystic fibrosis mutation in patients with congenital absence of the vas deferens. N Engl J Med 1993;328:446-447. [Free Full Text]
Culard JF, Desgeorges M, Costa P, et al. Analysis of the whole CFTR coding regions and splice junctions in azoospermic men with congenital bilateral aplasia of epididymis or vas deferens. Hum Genet 1994;93:467-470. [Medline]
Chu CS, Trapnell BC, Murtagh JJ Jr, et al. Variable deletion of exon 9 coding sequences in cystic fibrosis transmembrane conductance regulator gene mRNA transcripts in normal bronchial epithelium. EMBO J 1991;10:1355-1363. [Medline]
Bremer S, Hoof T, Wilke M, et al. Quantitative expression patterns of multidrug-resistance P-glycoprotein (MDR1) and differentially spliced cystic-fibrosis transmembrane-conductance regulator mRNA transcripts in human epithelia. Eur J Biochem 1992;206:137-149. [Medline]
Slomski R, Schloesser M, Berg LP, et al. Omission of exon 12 in cystic fibrosis transmembrane conductance regulator (CFTR) gene transcripts. Hum Genet 1992;89:615-619. [Medline]
Delaney SJ, Rich DP, Thomson SA, et al. Cystic fibrosis transmembrane conductance regulator splice variants are not conserved and fail to produce chloride channels. Nat Genet 1993;4:426-431. [CrossRef][Medline]
Strong TV, Wilkinson DJ, Mansoura MK, et al. Expression of an abundant alternatively spliced form of the cystic fibrosis transmembrane conductance regulator (CFTR) gene is not associated with a cAMP-activated chloride conductance. Hum Mol Genet 1993;2:225-230. [Free Full Text]
Casals T, Bassas LL, Ruiz-Romero J, et al. Extensive analysis of 40 infertile patients with congenital absence of the vas deferens: in 50% of cases only one CFTR allele could be detected. Hum Genet 1995;95:205-211. [CrossRef][Medline]
Mercier B, Verlingue C, Lissens W, et al. Is congenital bilateral absence of vas deferens a primary form of cystic fibrosis? Analyses of the CFTR gene in 67 patients. Am J Hum Genet 1995;56:272-277. [Medline]
Chillón M, Casals T, Giménez J, et al. Analysis of the CFTR gene confirms the high genetic heterogeneity of the Spanish population: 43 mutations account for only 78% of CF chromosomes. Hum Genet 1994;93:447-451. [Medline]
Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215-1215. [Free Full Text]
Audrézet MP, Mercier B, Guillermit H, et al. Identification of 12 novel mutations in the CFTR gene. Hum Mol Genet 1993;2:51-54. [Erratum, Hum Mol Genet 1993;2:496.] [Free Full Text]
Chillón M, Casals T, Giménez J, Nunes V, Estivill X. Analysis of the CFTR gene in the Spanish population: SSCP-screening for 60 known mutations and identification of four new mutations (Q30X, A120T, 1812-1 G A, and 3667del4). Hum Mutat 1994;3:223-230. [CrossRef][Medline]
Zielenski J, Rozmahel R, Bozon D, et al. Genomic DNA sequence of the cystic fibrosis transmembrane regulator (CFTR) gene. Genomics 1991;10:214-228. [CrossRef][Medline]
Fleiss JL. Statistical methods for rates and proportions. 2nd ed. New York: John Wiley, 1981.
Kiesewetter S, Macek M Jr, Davis C, et al. A mutation in CFTR produces different phenotypes depending on chromosomal background. Nat Genet 1993;5:274-278. [CrossRef][Medline]
Dörk T, Fislage R, Neumann T, Wulf B, Tümmler B. Exon 9 of the CFTR gene: splice site haplotypes and cystic fibrosis mutations. Hum Genet 1994;93:67-73. [Medline]
Cuppens H, Teng H, Raeymaekers P, De Boeck C, Cassiman JJ. CFTR haplotype backgrounds on normal and mutant CFTR genes. Hum Mol Genet 1994;3:607-614. [Free Full Text]
Trezise AE, Chambers JA, Wardle CJ, Gould S, Harris A. Expression of cystic fibrosis gene in human foetal tissues. Hum Mol Genet 1993;2:213-218. [Free Full Text]
Tizzano EF, Chitayat D, Buchwald M. Cell-specific localization of CFTR mRNA shows developmentally regulated expression in human fetal tissues. Hum Mol Genet 1993;2:219-224. [Free Full Text]
Chillón M, Dörk T, Casals T, et al. A novel donor splice site in intron 11 of the CFTR gene, created by mutation 1811+1.6kbA G, produces a new exon: high frequency in Spanish cystic fibrosis chromosomes and association with severe phenotype. Am J Hum Genet 1995;56:623-629. [Medline]
Highsmith WE, Burch LH, Zhou Z, et al. A novel mutation in the cystic fibrosis gene in patients with pulmonary disease but normal sweat chloride concentrations. N Engl J Med 1994;331:974-980. [Free Full Text]
Radpour, R., Gourabi, H., Dizaj, A. V., Holzgreve, W., Zhong, X. Y.
(2008). Genetic Investigations of CFTR Mutations in Congenital Absence of Vas Deferens, Uterus, and Vagina as a Cause of Infertility. J Androl
29: 506-513
[Abstract][Full Text]
Costa, C., Costa, J.-M., Martin, J., Boissier, B., Goossens, M., Girodon, E.
(2008). Multiplex Allele-Specific Fluorescent PCR for Haplotyping the IVS8 (TG)m(T)n Locus in the CFTR Gene. Clin. Chem.
54: 1564-1567
[Abstract][Full Text]
Radpour, R., Gourabi, H., Gilani, M. A. S., Dizaj, A. V.
(2008). Correlation Between CFTR Gene Mutations in Iranian Men With Congenital Absence of the Vas Deferens and Anatomical Genital Phenotype. J Androl
29: 35-40
[Abstract][Full Text]
Bareil, C., Guittard, C., Altieri, J.-P., Templin, C., Claustres, M., des Georges, M.
(2007). Comprehensive and Rapid Genotyping of Mutations and Haplotypes in Congenital Bilateral Absence of the Vas Deferens and Other Cystic Fibrosis Transmembrane Conductance Regulator-Related Disorders. J. Mol. Diagn.
9: 582-588
[Abstract][Full Text]
Radpour, R., Gourabi, H., Gilani, M. A. S., Dizaj, A. V.
(2007). Molecular Study of (TG)m(T)n Polymorphisms in Iranian Males With Congenital Bilateral Absence of the Vas Deferens. J Androl
28: 541-547
[Abstract][Full Text]
Ratbi, I., Legendre, M., Niel, F., Martin, J., Soufir, J.-C., Izard, V., Costes, B., Costa, C., Goossens, M., Girodon, E.
(2007). Detection of cystic fibrosis transmembrane conductance regulator (CFTR) gene rearrangements enriches the mutation spectrum in congenital bilateral absence of the vas deferens and impacts on genetic counselling. Hum Reprod
22: 1285-1291
[Abstract][Full Text]
Mantovani, V., Garagnani, P., Selva, P., Rossi, C., Ferrari, S., Cenci, M., Calza, N., Cerreta, V., Luiselli, D., Romeo, G.
(2007). Simple Method for Haplotyping the Poly(TG) Repeat in Individuals Carrying the IVS8 5T Allele in the CFTR Gene. Clin. Chem.
53: 531-533
[Abstract][Full Text]
Vilozni, D., Bentur, L., Efrati, O., Minuskin, T., Barak, A., Szeinberg, A., Blau, H., Picard, E., Kerem, E., Yahav, Y., Augarten, A.
(2007). Spirometry in Early Childhood in Cystic Fibrosis Patients. Chest
131: 356-361
[Abstract][Full Text]
Radpour, R., Gourabi, H., Gilani, M. A.S., Dizaj, A. V., Rezaee, M., Mollamohamadi, S.
(2006). Two novel missense and one novel nonsense CFTR mutations in Iranian males with congenital bilateral absence of the vas deferens. Mol Hum Reprod
12: 717-721
[Abstract][Full Text]
Ziedalski, T. M., Kao, P. N., Henig, N. R., Jacobs, S. S., Ruoss, S. J.
(2006). Prospective analysis of cystic fibrosis transmembrane regulator mutations in adults with bronchiectasis or pulmonary nontuberculous mycobacterial infection.. Chest
130: 995-1002
[Abstract][Full Text]
Wilschanski, M., Dupuis, A., Ellis, L., Jarvi, K., Zielenski, J., Tullis, E., Martin, S., Corey, M., Tsui, L.-C., Durie, P.
(2006). Mutations in the Cystic Fibrosis Transmembrane Regulator Gene and In Vivo Transepithelial Potentials. Am. J. Respir. Crit. Care Med.
174: 787-794
[Abstract][Full Text]
Faa, V., Bettoli, P. P., Demurtas, M., Zanda, M., Ferri, V., Cao, A., Rosatelli, M. C.
(2006). A New Insertion/Deletion of the Cystic Fibrosis Transmembrane Conductance Regulator Gene Accounts for 3.4% of Cystic Fibrosis Mutations in Sardinia: Implications for Population Screening. J. Mol. Diagn.
8: 499-503
[Abstract][Full Text]
O'Sullivan, B. P., Zwerdling, R. G., Dorkin, H. L., Comeau, A. M., Parad, R.
(2006). Early Pulmonary Manifestation of Cystic Fibrosis in Children With the {Delta}F508/R117H-7T Genotype. Pediatrics
118: 1260-1265
[Abstract][Full Text]
Raviv, G., Mor, Y., Levron, J., Shefi, S., Zilberman, D., Ramon, J., Madgar, I.
(2006). Role of transrectal ultrasonography in the evaluation of azoospermic men with low-volume ejaculate.. J Ultrasound Med
25: 825-829
[Abstract][Full Text]
Elborn, J S, Bradley, J M
(2006). Diagnosing CF: sweat, blood and years.. Thorax
61: 556-557
[Full Text]
Radpour, R., Gilani, M. A. S., Gourabi, H., Dizaj, A. V., Mollamohamadi, S.
(2006). Molecular analysis of the IVS8-T splice variant 5T and M470V exon 10 missense polymorphism in Iranian males with congenital bilateral absence of the vas deferens. Mol Hum Reprod
12: 469-473
[Abstract][Full Text]
De Boeck, K, Wilschanski, M, Castellani, C, Taylor, C, Cuppens, H, Dodge, J, Sinaasappel, M, on behalf of the Diagnostic Working Group,
(2006). Cystic fibrosis: terminology and diagnostic algorithms. Thorax
61: 627-635
[Abstract][Full Text]
Van Goor, F., Straley, K. S., Cao, D., Gonzalez, J., Hadida, S., Hazlewood, A., Joubran, J., Knapp, T., Makings, L. R., Miller, M., Neuberger, T., Olson, E., Panchenko, V., Rader, J., Singh, A., Stack, J. H., Tung, R., Grootenhuis, P. D. J., Negulescu, P.
(2006). Rescue of {Delta}F508-CFTR trafficking and gating in human cystic fibrosis airway primary cultures by small molecules. Am. J. Physiol. Lung Cell. Mol. Physiol.
290: L1117-L1130
[Abstract][Full Text]
Carter, K., Currie, G.P., Devereux, G.
(2006). Patients with bronchiectasis: look for specific causes. QJM
99: 196-197
[Full Text]
Creus, M., Vogel, W., Zoller, H.
(2006). Of Genes and Men: The Alternative View of Sex Differences in Cystic Fibrosis: Response to Sims et al. and Milla et al.. Diabetes Care
29: 179-180
[Full Text]
Weiss, F U, Simon, P, Bogdanova, N, Mayerle, J, Dworniczak, B, Horst, J, Lerch, M M
(2005). Complete cystic fibrosis transmembrane conductance regulator gene sequencing in patients with idiopathic chronic pancreatitis and controls. Gut
54: 1456-1460
[Abstract][Full Text]
Piluso, G, Politano, L, Aurino, S, Fanin, M, Ricci, E, Ventriglia, V M, Belsito, A, Totaro, A, Saccone, V, Topaloglu, H, Nascimbeni, A C, Fulizio, L, Broccolini, A, Canki-Klain, N, Comi, L I, Nigro, G, Angelini, C, Nigro, V
(2005). Extensive scanning of the calpain-3 gene broadens the spectrum of LGMD2A phenotypes. J. Med. Genet.
42: 686-693
[Abstract][Full Text]
Wu, C.-C., Alper, O. M., Lu, J.-F., Wang, S.-P., Guo, L., Chiang, H.-S., Wong, L.-J. C.
(2005). Mutation spectrum of the CFTR gene in Taiwanese patients with congenital bilateral absence of the vas deferens. Hum Reprod
20: 2470-2475
[Abstract][Full Text]
Schrijver, I., Oitmaa, E., Metspalu, A., Gardner, P.
(2005). Genotyping Microarray for the Detection of More Than 200 CFTR Mutations in Ethnically Diverse Populations. J. Mol. Diagn.
7: 375-387
[Abstract][Full Text]
Morea, A., Cameran, M., Rebuffi, A. G., Marzenta, D., Marangon, O., Picci, L., Zacchello, F., Scarpa, M.
(2005). Gender-sensitive association of CFTR gene mutations and 5T allele emerging from a large survey on infertility. Mol Hum Reprod
11: 607-614
[Abstract][Full Text]
de Gracia, J, Mata, F, Alvarez, A, Casals, T, Gatner, S, Vendrell, M, de la Rosa, D, Guarner, L, Hermosilla, E
(2005). Genotype-phenotype correlation for pulmonary function in cystic fibrosis. Thorax
60: 558-563
[Abstract][Full Text]
Rowe, S. M., Miller, S., Sorscher, E. J.
(2005). Cystic Fibrosis. NEJM
352: 1992-2001
[Full Text]
Schrijver, I., Ramalingam, S., Sankaran, R., Swanson, S., Dunlop, C. L.M., Keiles, S., Moss, R. B., Oehlert, J., Gardner, P., Wassman, E. R., Kammesheidt, A.
(2005). Diagnostic Testing by CFTR Gene Mutation Analysis in a Large Group of Hispanics: Novel Mutations and Assessment of a Population-Specific Mutation Spectrum. J. Mol. Diagn.
7: 289-299
[Abstract][Full Text]
Sermet-Gaudelus, I., Dechaux, M., Vallee, B., Fajac, A., Girodon, E., Nguyen-Khoa, T., Marianovski, R., Hurbain, I., Bresson, J. L., Lenoir, G., Edelman, A.
(2005). Chloride Transport in Nasal Ciliated Cells of Cystic Fibrosis Heterozygotes. Am. J. Respir. Crit. Care Med.
171: 1026-1031
[Abstract][Full Text]
Berger, A. L., Randak, C. O., Ostedgaard, L. S., Karp, P. H., Vermeer, D. W., Welsh, M. J.
(2005). Curcumin Stimulates Cystic Fibrosis Transmembrane Conductance Regulator Cl- Channel Activity. J. Biol. Chem.
280: 5221-5226
[Abstract][Full Text]
Faustino, N. A., Cooper, T. A.
(2005). Identification of Putative New Splicing Targets for ETR-3 Using Sequences Identified by Systematic Evolution of Ligands by Exponential Enrichment. Mol. Cell. Biol.
25: 879-887
[Abstract][Full Text]
Ellaffi, M., Vinsonneau, C., Coste, J., Hubert, D., Burgel, P.-R., Dhainaut, J.-F., Dusser, D.
(2005). One-year Outcome after Severe Pulmonary Exacerbation in Adults with Cystic Fibrosis. Am. J. Respir. Crit. Care Med.
171: 158-164
[Abstract][Full Text]
Hadd, A. G., Laosinchai-Wolf, W., Novak, C. R., Badgett, M. R., Isgur, L. A., Goldrick, M., WalkerPeach, C. R.
(2004). Microsphere Bead Arrays and Sequence Validation of 5/7/9T Genotypes for Multiplex Screening of Cystic Fibrosis Polymorphisms. J. Mol. Diagn.
6: 348-355
[Abstract][Full Text]
Niel, F, Martin, J, Dastot-Le Moal, F, Costes, B, Boissier, B, Delattre, V, Goossens, M, Girodon, E
(2004). Rapid detection of CFTR gene rearrangements impacts on genetic counselling in cystic fibrosis. J. Med. Genet.
41: e118-e118
[Full Text]
Grangeia, A., Niel, F., Carvalho, F., Fernandes, S., Ardalan, A., Girodon, E., Silva, J., Ferras, L., Sousa, M., Barros, A.
(2004). Characterization of cystic fibrosis conductance transmembrane regulator gene mutations and IVS8 poly(T) variants in Portuguese patients with congenital absence of the vas deferens. Hum Reprod
19: 2502-2508
[Abstract][Full Text]
Southernl, K W, Peckham, D
(2004). Establishing a diagnosis of cystic fibrosis. Chronic Respiratory Disease
1: 205-210
[Abstract]
Kamory, E., Csokay, B., Hollo, Z.
(2004). Rapid Detection of Cystic Fibrosis Transmembrane Conductance Regulator Gene IVS8 5T Variant by Real-Time PCR. Clin. Chem.
50: 1837-1839
[Full Text]
Lunenfeld, B., Van Steirteghem, A., on behalf of all participants,
(2004). Infertility in the third millennium: implications for the individual, family and society: Condensed Meeting Report from the Bertarelli Foundation's Second Global Conference. Hum Reprod Update
10: 317-326
[Abstract][Full Text]
Dayangac, D., Erdem, H., Yilmaz, E., Sahin, A., Sohn, C., Ozguc, M., Dork, T.
(2004). Mutations of the CFTR gene in Turkish patients with congenital bilateral absence of the vas deferens. Hum Reprod
19: 1094-1100
[Abstract][Full Text]
Zuccato, E., Buratti, E., Stuani, C., Baralle, F. E., Pagani, F.
(2004). An Intronic Polypyrimidine-rich Element Downstream of the Donor Site Modulates Cystic Fibrosis Transmembrane Conductance Regulator Exon 9 Alternative Splicing. J. Biol. Chem.
279: 16980-16988
[Abstract][Full Text]
King, P T, Freezer, N J, Holmes, P W, Holdsworth, S R, Forshaw, K, Sart, D D
(2004). Role of CFTR mutations in adult bronchiectasis. Thorax
59: 357-358
[Full Text]
Hefferon, T. W., Groman, J. D., Yurk, C. E., Cutting, G. R.
(2004). A variable dinucleotide repeat in the CFTR gene contributes to phenotype diversity by forming RNA secondary structures that alter splicing. Proc. Natl. Acad. Sci. USA
101: 3504-3509
[Abstract][Full Text]
Ruz, R., Andonian, S., Hermo, L.
(2004). Immunolocalization and Regulation of Cystic Fibrosis Transmembrane Conductance Regulator in the Adult Rat Epididymis. J Androl
25: 265-273
[Abstract][Full Text]
Danziger, K. L., Black, L. D., Keiles, S. B., Kammesheidt, A., Turek, P. J.
(2004). Improved detection of cystic fibrosis mutations in infertility patients with DNA sequence analysis. Hum Reprod
19: 540-546
[Abstract][Full Text]
Wu, C.C., Hsieh-Li, H.M., Lin, Y.M., Chiang, H.S.
(2004). Cystic fibrosis transmembrane conductance regulator gene screening and clinical correlation in Taiwanese males with congenital bilateral absence of the vas deferens. Hum Reprod
19: 250-253
[Abstract][Full Text]
Gilljam, M., Moltyaner, Y., Downey, G. P., Devlin, R., Durie, P., Cantin, A. M., Zielenski, J., Tullis, D. E.
(2004). Airway Inflammation and Infection in Congenital Bilateral Absence of the Vas Deferens. Am. J. Respir. Crit. Care Med.
169: 174-179
[Abstract][Full Text]
Sebastian, S., Spitzer, S. G., Grosso, L. E., Amos, J., Schaefer, F. V., Lyon, E., Wolff, D. J., Hajianpour, A., Taylor, A. K., Millson, A., Stenzel, T. T.
(2004). Multicenter Characterization and Validation of the Intron-8 Poly(T) Tract (IVS8-T) Status in 25 Coriell Cell Repository Cystic Fibrosis Reference Cell Lines for Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) Gene Mutation Assays. Clin. Chem.
50: 251-254
[Full Text]
Gibson, R. L., Burns, J. L., Ramsey, B. W.
(2003). Pathophysiology and Management of Pulmonary Infections in Cystic Fibrosis. Am. J. Respir. Crit. Care Med.
168: 918-951
[Abstract][Full Text]
Fong, P., Argent, B. E., Guggino, W. B., Gray, M. A.
(2003). Characterization of vectorial chloride transport pathways in the human pancreatic duct adenocarcinoma cell line HPAF. Am. J. Physiol. Cell Physiol.
285: C433-C445
[Abstract][Full Text]
Ninis, V N, Kylync, M O, Kandemir, M, Dathly, E, Tolun, A
(2003). High frequency of T9 and CFTR mutations in children with idiopathic bronchiectasis. J. Med. Genet.
40: 530-535
[Full Text]
Pagani, F., Stuani, C., Tzetis, M., Kanavakis, E., Efthymiadou, A., Doudounakis, S., Casals, T., Baralle, F. E.
(2003). New type of disease causing mutations: the example of the composite exonic regulatory elements of splicing in CFTR exon 12. Hum Mol Genet
12: 1111-1120
[Abstract][Full Text]
Witt, H
(2003). Chronic pancreatitis and cystic fibrosis. Gut
52: ii31-41
[Abstract][Full Text]
Faustino, N. A., Cooper, T. A.
(2003). Pre-mRNA splicing and human disease. Genes Dev.
17: 419-437
[Full Text]
Pagani, F., Stuani, C., Zuccato, E., Kornblihtt, A. R., Baralle, F. E.
(2003). Promoter Architecture Modulates CFTR Exon 9 Skipping. J. Biol. Chem.
278: 1511-1517
[Abstract][Full Text]
Knowles, M. R., Durie, P. R.
(2002). What Is Cystic Fibrosis?. NEJM
347: 439-442
[Full Text]
Wang, Z., Milunsky, J., Yamin, M., Maher, T., Oates, R., Milunsky, A.
(2002). Analysis by mass spectrometry of 100 cystic fibrosis gene mutations in 92 patients with congenital bilateral absence of the vas deferens. Hum Reprod
17: 2066-2072
[Abstract][Full Text]
Blau, H, Freud, E, Mussaffi, H, Werner, M, Konen, O, Rathaus, V
(2002). Urogenital abnormalities in male children with cystic fibrosis. Arch. Dis. Child.
87: 135-138
[Abstract][Full Text]
Venarske, D. L., deShazo, R. D.
(2002). Sinobronchial Allergic Mycosis* : The SAM Syndrome. Chest
121: 1670-1676
[Abstract][Full Text]
Layman, L C
(2002). Human gene mutations causing infertility. J. Med. Genet.
39: 153-161
[Abstract][Full Text]
Dohle, G.R., Halley, D.J.J., Van Hemel, J.O., van den Ouwel, A.M.W., Pieters, M.H.E.C., Weber, R.F.A., Govaerts, L.C.P.
(2002). Genetic risk factors in infertile men with severe oligozoospermia and azoospermia. Hum Reprod
17: 13-16
[Abstract][Full Text]
Bacon, A. L., Dunlop, M. G., Farrington, S. M.
(2001). Hypermutability at a poly(A/T) tract in the human germline. Nucleic Acids Res
29: 4405-4413
[Abstract][Full Text]
Amaral, M. D, Pacheco, P., Beck, S., Farinha, C. M, Penque, D., Nogueira, P., Barreto, C., Lopes, B., Casals, T., Dapena, J., Gartner, S., Vasquez, C., Perez-Frias, J., Olveira, C., Cabanas, R., Estivill, X., Tzetis, M., Kanavakis, E., Doudounakis, S., Dork, T., Tummler, B., Girodon-Boulandet, E., Cazeneuve, C., Goossens, M., Blayau, M., Verlingue, C., Vieira, I., Ferec, C., Claustres, M., Georges, M. d., Clavel, C., Birembaut, P., Hubert, D., Bienvenu, T., Adoun, M., Chomel, J.-C., De Boeck, K., Cuppens, H., Lavinha, J.
(2001). Cystic fibrosis patients with the 3272-26A>G splicing mutation have milder disease than F508del homozygotes: a large European study. J. Med. Genet.
38: 777-783
[Full Text]
Josserand, R. N., Bey-Omar, F., Rollet, J., Lejeune, H., Boggio, D., Durand, D. V., Durieu, I.
(2001). Cystic fibrosis phenotype evaluation and paternity outcome in 50 males with congenital bilateral absence of vas deferens. Hum Reprod
16: 2093-2097
[Abstract][Full Text]
Gong, X.D., Li, J.C.H., Cheung, K.H., Leung, G.P.H., Chew, S.B.C., Wong, P.Y.D.
(2001). Expression of the cystic fibrosis transmembrane conductance regulator in rat spermatids: implication for the site of action of antispermatogenic agents. Mol Hum Reprod
7: 705-713
[Abstract][Full Text]
Larriba, S., Bassas, L., Egozcue, S., Gimenez, J., Ramos, M. D., Briceno, O., Estivill, X., Casals, T.
(2001). Adenosine Triphosphate-Binding Cassette Superfamily Transporter Gene Expression in Severe Male Infertility. Biol. Reprod.
65: 394-400
[Abstract][Full Text]
Doull, I. J M
(2001). Recent advances: Recent advances in cystic fibrosis. Arch. Dis. Child.
85: 62-66
[Abstract][Full Text]
Massie, R.J.H., Poplawski, N., Wilcken, B., Goldblatt, J., Byrnes, C., Robertson, C.
(2001). Intron-8 polythymidine sequence in Australasian individuals with CF mutations R117H and R117C. Eur Respir J
17: 1195-1200
[Abstract][Full Text]
Wilschanski, M., Famini, H., Strauss-Liviatan, N., Rivlin, J., Blau, H., Bibi, H., Bentur, L., Yahav, Y., Springer, H., Kramer, M.R., Klar, A., Ilani, A., Kerem, B., Kerem, E.
(2001). Nasal potential difference measurements in patients with atypical cystic fibrosis. Eur Respir J
17: 1208-1215
[Abstract][Full Text]
Marchand, E., Verellen-Dumoulin, C., Mairesse, M., Delaunois, L., Brancaleone, P., Rahier, J.-F., Vandenplas, O.
(2001). Frequency of Cystic Fibrosis Transmembrane Conductance Regulator Gene Mutations and 5T Allele in Patients With Allergic Bronchopulmonary Aspergillosis. Chest
119: 762-767
[Abstract][Full Text]
Meng, M. V., Black, L. D., Cha, I., Ljung, B.-M., Pera, R. A.R., Turek, P. J.
(2001). Impaired spermatogenesis in men with congenital absence of the vas deferens. Hum Reprod
16: 529-533
[Abstract][Full Text]
CASTELLANI, C., BENETAZZO, M. G., TAMANINI, A., BEGNINI, A., MASTELLA, G., PIGNATTI, P.
(2001). Analysis of the entire coding region of the cystic fibrosis transmembrane regulator gene in neonatal hypertrypsinaemia with normal sweat test. J. Med. Genet.
38: 202-205
[Full Text]
McCallum, T.J., Milunsky, J.M., Munarriz, R., Carson, R., Sadeghi-Nejad, H., Oates, R.D.
(2001). Unilateral renal agenesis associated with congenital bilateral absence of the vas deferens: phenotypic findings and genetic considerations. Hum Reprod
16: 282-288
[Abstract][Full Text]
HUGHES, D., DÖRK, T., STUHRMANN, M., GRAHAM, C.
(2001). Mutation and haplotype analysis of the CFTR gene in atypically mild cystic fibrosis patients from Northern Ireland. J. Med. Genet.
38: 136-139
[Full Text]
Malats, N, Casals, T, Porta, M, Guarner, L, Estivill, X, Real, F X
(2001). Cystic fibrosis transmembrane regulator (CFTR) Delta F508 mutation and 5T allele in patients with chronic pancreatitis and exocrine pancreatic cancer. Gut
48: 70-74
[Abstract][Full Text]
Jezequel, P., Dubourg, C., Le Lannou, D., Odent, S., Le Gall, J.-Y., Blayau, M., Le Treut, A., David, V.
(2000). Molecular screening of the CFTR gene in men with anomalies of the vas deferens: identification of three novel mutations. Mol Hum Reprod
6: 1063-1067
[Abstract][Full Text]
PERSU, A., DEVUYST, O., LANNOY, N., MATERNE, R., BROSNAHAN, G., GABOW, P. A., PIRSON, Y., VERELLEN-DUMOULIN, C.
(2000). CF Gene and Cystic Fibrosis Transmembrane Conductance Regulator Expression in Autosomal Dominant Polycystic Kidney Disease. J. Am. Soc. Nephrol.
11: 2285-2296
[Abstract][Full Text]
NOONE, P. G., PUE, C. A., ZHOU, Z., FRIEDMAN, K. J., WAKELING, E. L., GANESHANANTHAN, M., SIMON, R. H., SILVERMAN, L. M., KNOWLES, M. R.
(2000). Lung Disease Associated with the IVS8 5T Allele of the CFTR Gene. Am. J. Respir. Crit. Care Med.
162: 1919-1924
[Abstract][Full Text]
Ezeh, U. I.O.
(2000). Beyond the clinical classification of azoospermia: Opinion. Hum Reprod
15: 2356-2359
[Abstract][Full Text]
Lewis-Jones, D.I., Gazvani, M.R., Mountford, R.
(2000). Cystic fibrosis in infertility: screening before assisted reproduction: Opinion. Hum Reprod
15: 2415-2417
[Abstract][Full Text]
Wang, X., Moylan, B., Leopold, D. A., Kim, J., Rubenstein, R. C., Togias, A., Proud, D., Zeitlin, P. L., Cutting, G. R.
(2000). Mutation in the Gene Responsible for Cystic Fibrosis and Predisposition to Chronic Rhinosinusitis in the General Population. JAMA
284: 1814-1819
[Abstract][Full Text]
MASSIE, J., DU SART, D., FORSHAW, K., CARLIN, J., FORREST, S M
(2000). The relationship between neonatal immunoreactive trypsinogen, Delta F508, and IVS8-5T. J. Med. Genet.
37: 629-632
[Full Text]
ABRAMOWICZ, M. J, DESSARS, B., SEVENS, C., GOOSSENS, M., BOULANDET, E. G.
(2000). Fetal bowel hyperechogenicity may indicate mild atypical cystic fibrosis: a case associated with a complex CFTR allele. J. Med. Genet.
37: 15e-15
[Full Text]
Fokstuen, S., Balakrishnan, J., Kotzot, D., Hergersberg, M., Hobi, Ch.
(2000). Homozygosity of the cystic fibrosis (CF) gene allele IVS8-(5T) in a Tamil male with congenital bilateral absence of the vas deferens (CBAVD). Mol Hum Reprod
6: 669-670
[Full Text]
Casals, T., Bassas, L., Egozcue, S., Ramos, M. D., Gimenez, J., Segura, A., Garcia, F., Carrera, M., Larriba, S., Sarquella, J., Estivill, X.
(2000). Heterogeneity for mutations in the CFTR gene and clinical correlations in patients with congenital absence of the vas deferens. Hum Reprod
15: 1476-1483
[Abstract][Full Text]
Viville, S., Warter, S., Meyer, J.-M., Wittemer, C., Loriot, M., Mollard, R., Jacqmin, D.
(2000). Histological and genetic analysis and risk assessment for chromosomal aberration after ICSI for patients presenting with CBAVD. Hum Reprod
15: 1613-1618
[Abstract][Full Text]
BOYNE, J., EVANS, S., POLLITT, R. J, TAYLOR, C. J, DALTON, A.
(2000). Many Delta F508 heterozygote neonates with transient hypertrypsinaemia have a second, mild CFTR mutation. J. Med. Genet.
37: 543-547
[Full Text]
Dreesen, J.C.F.M., Jacobs, L.J.A.M., Bras, M., Herbergs, J., Dumoulin, J.C.M., Geraedts, J.P.M., Evers, J.L.H., Smeets, H.J.M.
(2000). Multiplex PCR of polymorphic markers flanking the CFTR gene; a general approach for preimplantation genetic diagnosis of cystic fibrosis. Mol Hum Reprod
6: 391-396
[Abstract][Full Text]
Phillipson, G.T.M., Petrucco, O.M., Matthews, C.D.
(2000). Congenital bilateral absence of the vas deferens, cystic fibrosis mutation analysis and intracytoplasmic sperm injection. Hum Reprod
15: 431-435
[Abstract][Full Text]
Mak, V., Zielenski, J., Tsui, L.-C., Durie, P., Zini, A., Martin, S., Longley, T. B., Jarvi, K. A.
(2000). Cystic fibrosis gene mutations and infertile men with primary testicular failure. Hum Reprod
15: 436-439
[Abstract][Full Text]
Black, L.D., Nudell, D.M., Cha, I., Cherry, A.M., Turek, P.J.
(2000). Compound genetic factors as a cause of male infertility: Case Report. Hum Reprod
15: 449-451
[Abstract][Full Text]
Pallares-Ruiz, N., Carles, S., Des Georges, M., Guittard, C., Arnal, F., Humeau, C., Claustres, M.
(1999). Complete mutational screening of the cystic fibrosis transmembrane conductance regulator gene: cystic fibrosis mutations are not involved in healthy men with reduced sperm quality. Hum Reprod
14: 3035-3040
[Abstract][Full Text]
de Kretser, D. M., Baker, H. W. G.
(1999). Infertility in Men: Recent Advances and Continuing Controversies. J. Clin. Endocrinol. Metab.
84: 3443-3450
[Full Text]
Parad, R. B., Gerard, C. J., Zurakowski, D., Nichols, D. P., Pier, G. B.
(1999). Pulmonary Outcome in Cystic Fibrosis Is Influenced Primarily by Mucoid Pseudomonas aeruginosa Infection and Immune Status and Only Modestly by Genotype. Infect. Immun.
67: 4744-4750
[Abstract][Full Text]
Weyler, R. T., Yurko-Mauro, K. A., Rubenstein, R., Kollen, W. J. W., Reenstra, W., Altschuler, S. M., Egan, M., Mulberg, A. E.
(1999). CFTR is functionally active in GnRH-expressing GT1-7 hypothalamic neurons. Am. J. Physiol. Cell Physiol.
277: C563-C571
[Abstract][Full Text]
Jakubiczka, S., Bettecken, Th., Stumm, M., Nickel, I., Musebeck, J., Krebs, P., Fischer, Ch., Kleinstein, J., Wieacker, P.
(1999). Frequency of CFTR gene mutations in males participating in an ICSI programme: Brief communication. Hum Reprod
14: 1833-1834
[Abstract][Full Text]
Friedman, K. J., Silverman, L. M.
(1999). Cystic Fibrosis Syndrome: A New Paradigm for Inherited Disorders and Implications for Molecular Diagnostics. Clin. Chem.
45: 929-931
[Full Text]
Mak, V., Zielenski, J., Tsui, L.-C., Durie, P., Zini, A., Martin, S., Longley, T. B., Jarvi, K. A.
(1999). Proportion of Cystic Fibrosis Gene Mutations Not Detected by Routine Testing in Men With Obstructive Azoospermia. JAMA
281: 2217-2224
[Abstract][Full Text]
Boucher, D., Creveaux, I., Grizard, G., Jimenez, C., Hermabessiere, J., Dastugue, B.
(1999). Screening for cystic fibrosis transmembrane conductance regulator gene mutations in men included in an intracytoplasmic sperm injection programme. Mol Hum Reprod
5: 587-593
[Abstract][Full Text]
Bogardus, S. T. Jr, Concato, J., Feinstein, A. R.
(1999). Clinical Epidemiological Quality in Molecular Genetic Research: The Need for Methodological Standards. JAMA
281: 1919-1926
[Abstract][Full Text]
F508.5 To identify other cystic fibrosis mutations in these patients, each of the 27 exons of the CFTR gene and their flanking sequences were amplified by the polymerase chain reaction (PCR). After PCR, all exons were studied by denaturing gradient-gel electrophoresis or by single-strand conformation analysis, as previously described.23,24 
A, or 936delTA). Although these genotypes should have been associated with CBAVD, these men had offspring and are clinically normal. Three hypotheses could explain the strong but not complete correlation between the appearance of the 5T allele and CBAVD. First, there could be a nonrandom association between the 5T allele and CBAVD, with the allele segregating with the CBAVD phenotype but not being its cause. Second, there could be a partially causal role for the 5T allele, together with additional mutations in other parts of the CFTR gene. Third, the 5T allele could have a causal role in CBAVD, with other factors accounting for these exceptional men without CBAVD (the four fathers bearing the cystic fibrosis mutation). The work presented here argues convincingly against the first two hypotheses. Nonrandom association is not the case, since the analysis of several DNA markers within CFTR in the four fathers and in patients with CBAVD showed that several haplotypes (combinations of alleles on the same chromosome) were associated with the 5T allele (data not shown). The presence of another mutation in the same CFTR gene as the 5T allele is also excluded, since CFTR was thoroughly analyzed in all patients with CBAVD and it is extremely unlikely that all patients with the 5T allele had mutations outside the CFTR coding region. These data and the association of the 5T allele with low levels of normal CFTR mRNA18 strongly support the concept that the 5T mutation generally causes CBAVD when it is associated with a cystic fibrosis mutation on the other chromosome. 
Previous
