The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
Original Article
PreviousPrevious
Volume 332:1475-1480 June 1, 1995 Number 22
NextNext

Mutations in the Cystic Fibrosis Gene in Patients with Congenital Absence of the Vas Deferens
Miguel Chillón, Ph.D., Teresa Casals, B.S., Bernard Mercier, Ph.D., Lluís Bassas, M.D., Willy Lissens, Ph.D., Sherman Silber, M.D., Marie-Catherine Romey, B.S., Javier Ruiz-Romero, M.D., Claudine Verlingue, M.D., Mireille Claustres, M.D., Ph.D., Virginia Nunes, Ph.D., Claude Férec, M.D., Ph.D., and Xavier Estivill, M.D., Ph.D.

 

This Article
-Abstract
- PDF

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation
ABSTRACT

Background Congenital bilateral absence of the vas deferens (CBAVD) is a form of male infertility in which mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene have been identified. The molecular basis of CBAVD is not completely understood. Although patients with cystic fibrosis have mutations in both copies of the CFTR gene, most patients with CBAVD have mutations in only one copy of the gene.

Methods To investigate CBAVD at the molecular level, we have characterized the mutations in the CFTR gene in 102 patients with this condition. None had clinical manifestations of cystic fibrosis. We also analyzed a DNA variant (the 5T allele) in a noncoding region of CFTR that causes reduced levels of the normal CFTR protein. Parents of patients with cystic fibrosis, patients with types of infertility other than CBAVD, and normal subjects were studied as controls.

Results Nineteen of the 102 patients with CBAVD had mutations in both copies of the CFTR gene, and none of them had the 5T allele. Fifty-four patients had a mutation in one copy of CFTR, and 34 of them (63 percent) had the 5T allele in the other CFTR gene. In 29 patients no CFTR mutations were found, but 7 of them (24 percent) had the 5T allele. In contrast, the frequency of this allele in the general population was about 5 percent.

Conclusions Most patients with CBAVD have mutations in the CFTR gene. The combination of the 5T allele in one copy of the CFTR gene with a cystic fibrosis mutation in the other copy is the most common cause of CBAVD. The 5T allele mutation has a wide range of clinical presentations, occurring in patients with CBAVD or moderate forms of cystic fibrosis and in fertile men.


Congenital bilateral absence of the vas deferens (CBAVD) accounts for at least 6 percent of cases of obstructive azoospermia and is responsible for 1 to 2 percent of cases of infertility in men.1 CBAVD is also present in about 95 percent of male patients with cystic fibrosis, a disorder characterized by chronic pulmonary disease, pancreatic exocrine insufficiency, and elevated concentrations of electrolytes in sweat.2

Mutations in the cystic fibrosis transmembrane conductance regulator (CFTR) gene, which encodes a cyclic AMP–regulated chloride channel,3,4 have been found in patients with cystic fibrosis.5,6 Patients with the classic form of cystic fibrosis have severe mutations in each copy of the CFTR gene, whereas patients with a less severe phenotype (i.e., with normal pancreatic function and mild lung disease) have a severe mutation in one copy of CFTR and a mild mutation in the other, or mild mutations in both copies.7

Mutations in the CFTR gene have also been identified in patients with CBAVD, which suggests that this condition is a primarily genital form of cystic fibrosis.8,9,10,11,12 Thus, patients with CBAVD would be expected, like all patients with cystic fibrosis, to have two CFTR mutations. However, few patients with CBAVD have mutations in both copies of the CFTR gene; in the majority of cases, only one mutation has been found, and in about a third no mutations have been detected. The inability of investigators to identify two CFTR mutations in these patients, even after analyzing the entire coding sequence, is not well understood, but it could be explained by the presence of mutations in noncoding regions of the gene. Such mutations would produce abnormally low levels of CFTR protein, which may cause obstruction of the vas deferens, but there may be sufficient protein to prevent disease in other organs normally affected by cystic fibrosis.

Low levels of the CFTR protein could be due to a decreased proportion of the normal messenger RNA (mRNA) of CFTR. Studies of CFTR mRNA in tissue from normal persons have identified various mRNA molecules that lack exon 4, 9, or 12.13,14,15,16,17 Whether or not CFTR mRNA contains exon 9 depends on the variable length of a DNA sequence of thymines in intron 8 of CFTR (Figure 1).18 This sequence, known as a polyT sequence, contains five, seven, or nine thymines (the 5T, 7T, and 9T alleles, respectively). Since the 5T allele causes reduced levels of normal CFTR mRNA,18 this DNA variant would appear likely to be involved in the pathogenesis of CBAVD.


View larger version (6K):
[in this window]
[in a new window]
 
Figure 1. DNA Variants in Intron 8 of the CFTR Gene and Their Effects at the mRNA Level.

The region of the CFTR gene that includes exons 7 to 10 is shown at the top. During processing, the sequences not involved with protein synthesis (introns) are eliminated, and the remaining sequences (exons) are spliced to form mature mRNA (center left). The processing of CFTR is not completely efficient, because 10 to 92 percent of transcripts lack exon 9 (bottom left), depending on the person's genotype.13,18 When both CFTR genes bear the 5T allele (the 5T/5T genotype), the proportion of normal CFTR mRNA is reduced to approximately 8 to 12 percent, indicating that the shorter the sequence of thymines in intron 8, the higher the proportion of CFTR mRNA in which exon 9 is lacking.18

 
To understand the molecular genetics of CBAVD better, we have characterized the CFTR mutations in patients with this condition and studied the putative involvement of the 5T allele in CBAVD and other types of male infertility.

Methods

Patients

We studied 102 unrelated men with azoospermia and CBAVD, as diagnosed on the basis of scrotal exploration and analysis of semen (volume and pH of semen, sperm count, and concentrations of fructose and citrate). The patients came from Belgium, France, Spain, and the United States.12,19,20 None had pulmonary or gastrointestinal manifestations of cystic fibrosis. The results of sweat chloride analysis and additional clinical data on these patients have already been presented.12,19,20 The diagnoses of CBAVD were initially suggested by the clinical observation of impalpable vasa in the patients and were subsequently confirmed by analyses of semen and transrectal and abdominal ultrasonography. Each patient had a sperm count of zero.

Control Subjects

We studied 186 fathers and 44 mothers of patients with cystic fibrosis, each of whom carried a known CFTR mutation,21 and 46 normal subjects from the general population in Spain. We also studied 12 patients with congenital unilateral absence of the vas deferens (CUAVD) and 10 patients with obstructive azoospermia not due to CBAVD or CUAVD. The patients with azoospermia but without CBAVD were in the care of the Andrology Department of the Institute of Urology, Nephrology, and Andrology in Barcelona, Spain, because of infertility; those with CUAVD were seen because of infertility or prostate problems or because they had requested vasectomy. The mean sperm concentration in the patients with CUAVD was 10.6 x 106 per milliliter (range, 0 to 90 x 106).

Analysis of CFTR Mutations

DNA was isolated from peripheral-blood lymphocytes according to standard protocols.22 Genomic DNA from the patients with CBAVD was first analyzed for the most common cystic fibrosis mutation, {Delta}F508.5 To identify other cystic fibrosis mutations in these patients, each of the 27 exons of the CFTR gene and their flanking sequences were amplified by the polymerase chain reaction (PCR). After PCR, all exons were studied by denaturing gradient-gel electrophoresis or by single-strand conformation analysis, as previously described.23,24

The 5T Allele of Intron 8 of CFTR

We analyzed the frequency of the 5T allele (the sequence of five thymines mainly responsible for the absence of exon 9 in CFTR mRNA) in the general population (i.e., in apparently normal chromosomes), fathers and mothers of patients with cystic fibrosis (who carry one chromosome with the cystic fibrosis mutation and one normal chromosome), and men with CBAVD. To evaluate the incidence of the 5T allele of intron 8 in CBAVD and infertility, we studied the frequency of heterozygosity for the allele in patients with CBAVD, patients with CUAVD, patients with azoospermia but not CBAVD, and the general population.

Exon 9 was first amplified with primers 9i-5 and 9i-3.25 The PCR conditions were as follows: denaturation at 95°C for 30 seconds, annealing at 54°C for 30 seconds, and extension at 74°C for 40 seconds, for 25 cycles. The reaction mixture contained 5 µl of PCR buffer (N808-0006, Perkin-Elmer Cetus); 200 µM each of deoxyadenosine triphosphate, deoxycytidine triphosphate, deoxyguanosine triphosphate, and deoxythymidine triphosphate; 20 pmol of each primer; and 1 unit of Taq DNA polymerase in a final volume of 50 µl, containing 100 ng of genomic DNA. To amplify the polypyrimidine sequence while avoiding the adjacent dinucleotide repeat (GT)n,13 we performed a nested PCR with primers I9D9 (5'CCGCCGCTGTGTGTGTGTGTGTGTTTTT3') and E9R2 (5'GGATCCAGCAACCGCCAACA3'). The conditions of the nested PCR were as described above except that 1 µl from the first PCR was used, but for 35 cycles. The final PCR products were digested with XmnI and visualized on an 8 percent nondenaturing polyacrylamide gel after electrophoresis for four to five hours at 180 V (Figure 2).


View larger version (10K):
[in this window]
[in a new window]
 
Figure 2. PCR Analysis of Alleles in the polyT Sequence of Intron 8 of the CFTR Gene.

Heteroduplex molecules (H) are due to the hybridization of strands from the 5T, 7T, and 9T alleles (A). The genotypes are indicated beneath each lane.

 
Statistical Analysis

Differences between proportions were tested by the chi-square statistic.26 Yates' correction for continuity was used in the two-by-two tables. Relative risks were calculated for the comparison of the patients with CBAVD with the normal patients. All P values were based on two-sided comparisons. P values of less than 0.05 were considered to indicate statistical significance.

Results

CFTR Mutations in CBAVD

We studied a group of 102 patients with CBAVD from Europe and the United States with regard to mutations in the CFTR gene. The analysis of the entire coding sequence allowed us to identify 28 different mutations (Table 1). Most of the mutations have been described previously in patients with cystic fibrosis, but others have been detected specifically in patients with CBAVD. Nineteen patients had mutations in both copies of CFTR (one severe and one mild mutation in 16 patients, and two mild mutations in 3), and 54 patients had mutations in only one CFTR allele. In 29 patients, after comprehensive screening, we were unable to find any mutations in the coding or splice regions of CFTR.12,19,20

View this table:
[in this window]
[in a new window]
 
Table 1. CFTR and polyT Genotypes of 102 Patients with CBAVD.

 
Frequencies of the 5T Allele DNA Variant of Intron 8 of CFTR

In the Spanish population, the frequency of the 5T allele, which is responsible for abnormal CFTR mRNA, was similar (5.4 percent) to that previously reported in other populations (5.2 percent)27,28,29 (P = 0.98), and the populations were pooled for comparative analyses (frequency of the 5T allele in the general population, 5.2 percent). The frequency of the 5T allele in the normal chromosomes of mothers of patients with cystic fibrosis (the non–cystic fibrosis chromosomes) was similar (4.5 percent) to that in the general population (P = 0.87), but the frequency was lower in the normal chromosomes of fathers of patients with cystic fibrosis (2.1 percent) (P = 0.12). In contrast, the 5T allele was significantly more frequent in the chromosomes of patients with CBAVD (21.1 percent) than in the general population (chi-square = 39.3, P<0.001) (Table 2).

View this table:
[in this window]
[in a new window]
 
Table 2. Frequencies of the polyT Alleles in Intron 8 of CFTR in Members of the General Population and Subjects with CBAVD, and in the Non–Cystic Fibrosis Chromosomes of Parents of Patients with Cystic Fibrosis.

 
The 5T Allele and Infertility

We evaluated the incidence of the 5T allele in men with various types of infertility. Table 3 shows that the percentage of patients with CBAVD who had this allele was significantly higher than that of the general population (40.2 vs. 10.9 percent) (chi-square = 11.4, P<0.001, relative risk = 5.1), whereas the proportion of patients with CUAVD who had the 5T allele (25 percent) was lower than, but not significantly different from, the proportion among patients with CBAVD (P = 0.48). On the other hand, the proportion of patients with azoospermia but without CBAVD who had the 5T allele was similar to that of the general population (P = 0.71).

View this table:
[in this window]
[in a new window]
 
Table 3. Frequency of Heterozygosity for the CFTR 5T Allele among Patients with CBAVD, CUAVD, or Azoospermia but No CBAVD and Members of the General Population.

 
CFTR Mutations and the 5T Allele in Patients with Cbavd

In most patients with CBAVD, the 5T allele was strongly associated with the presence of a cystic fibrosis mutation in the other copy of the CFTR gene (chi-square = 9.9, P = 0.0016), but none of the patients with CBAVD who had two CFTR mutations carried this allele (Table 4). Two patients were each found to have two 5T alleles. In one patient one of the alleles was associated with a mild cystic fibrosis mutation,19 whereas in the other patient no CFTR mutations were identified.

View this table:
[in this window]
[in a new window]
 
Table 4. Classification of 102 Patients with CBAVD According to the Presence or Absence of the CFTR Mutation and of a polyT Allele at Intron 8.

 
The association between the various CFTR mutations and the 5T allele in the patients with CBAVD was analyzed by studying the transmission of the mutations within families (Table 1). Only one CFTR mutation (A800G) was associated with the 5T allele, whereas all the others were associated with the 7T or the 9T allele, confirming that in each patient with CBAVD the 5T allele corresponded to the chromosome that did not carry the CFTR mutation.

Discussion

The main objectives of this study were to determine whether patients with CBAVD had mutations in the CFTR gene and to explore whether noncoding sequences that produce low levels of CFTR mRNA (the 5T allele) were responsible for CBAVD.

Most patients with CBAVD in this study (72 percent) had a mutation in at least one of their CFTR genes, but only 19 percent had mutations on both chromosomes, with at least one of the two mutations being mild.12,19,20 Inability to identify the second mutation in most patients with CBAVD, even after all 27 CFTR exons were analyzed, suggests that mutations could be located elsewhere in the noncoding regions of CFTR. These mutations may result in a CFTR protein with a normal structure but low levels of expression,10 which may cause disease only in the organs most sensitive to CFTR dysfunction, such as the vas deferens.30,31

The reduced levels of normal CFTR mRNA due to the deletion of exon 9 depend on the presence of the 5T allele sequence in intron 8. This nonfunctional CFTR mRNA accounts for up to 92 percent of the total mRNA when both CFTR genes have the 5T allele.18 We have found a significant proportion of men with CBAVD who have the 5T allele, as compared with men in the general population, which suggests that this allele functions as a disease mutation in CBAVD. Similarly, the proportion of men with CUAVD who have the 5T allele was higher than in the general population, but lower than among men with CBAVD. Because CFTR mutations have also been found in patients with CUAVD,12,19 that condition could be an incomplete form of CBAVD. In contrast, the proportion of men with azoospermia but without CBAVD who had the 5T allele was similar to that in the general population, suggesting that azoospermia not due to CBAVD or CUAVD is unrelated to CFTR.

The particular combination of the two CFTR alleles in a given person (the genotype) results in specific levels of normal CFTR mRNA and in a specific clinical phenotype (Figure 3). It has been shown that if normal CFTR mRNA is present at a level of less than 1 to 3 percent, a severe cystic fibrosis phenotype results32; if the level is above 8 to 12 percent, the phenotype is normal18; and at intermediate levels, the phenotype is one of mild cystic fibrosis.33 Thus, patients with one cystic fibrosis mutation on one chromosome and the 5T allele on the other should have abnormally low levels of normal CFTR mRNA.


View larger version (6K):
[in this window]
[in a new window]
 
Figure 3. Comparison of Percentages of Normal CFTR mRNA, Clinical Phenotypes, and CFTR Genotypes.

Levels of normal CFTR mRNA depend on the genotype determining the length of the thymine sequence in intron 8 of CFTR, the presence of cystic fibrosis mutations, or both. Decreased levels of normal CFTR mRNA may be involved in various clinical phenotypes, ranging from the normal phenotype to the phenotypes of CBAVD, cystic fibrosis with pancreatic sufficiency (PS), and cystic fibrosis with pancreatic insufficiency (PI). Genotypes that correspond to the combination of a cystic fibrosis mutation with a 5T allele (CF/5T) have been found in normal persons, patients with CBAVD, and patients with cystic fibrosis and pancreatic sufficiency. Genotypes combining a severe and a moderate cystic fibrosis mutation (CF/CFM) or two moderate mutations (CFM/CFM) can be involved in either CBAVD or cystic fibrosis with pancreatic sufficiency (bracket). The delimitation between the normal, CBAVD, and cystic fibrosis phenotypes and their relations with levels of CFTR mRNA is only approximate. The distribution of levels of CFTR mRNA in relation to the presence of the 5T, 7T, and 9T alleles and genotypes is derived from the work of Chu et al.18

 
The study performed here allows patients with CBAVD to be classified in five categories (Table 4): patients with two CFTR mutations (group 1a, 19 percent of patients with CBAVD); patients with one CFTR mutation and the 5T allele (group 1b, 33 percent); patients with only one CFTR mutation (group 2a, 20 percent); patients with only the 5T allele (group 2b, 7 percent); and patients without CFTR mutations (group 3, 21 percent). Group 1 is completely characterized if the 5T allele is a mutation in patients with CBAVD, whereas in group 2 other, as yet unknown, mutations in the CFTR gene may be involved. Finally, in group 3, a gene or genes other than CFTR may be responsible for CBAVD.

Parents of patients with cystic fibrosis have one normal CFTR gene and one gene with a cystic fibrosis mutation. Since fathers of patients with cystic fibrosis are not infertile, if the 5T allele was involved in CBAVD, it would be expected to be present at a low frequency in these subjects. Our data show that the frequency of the 5T allele in fathers who carry the cystic fibrosis mutation is slightly lower than that in both the general population and mothers who carry the mutation (2.1 percent vs. 5.2 percent and 4.5 percent), reinforcing the hypothesis that the 5T allele has a role in CBAVD (Table 2).

Four fathers who were carriers of cystic fibrosis had one CFTR gene with the 5T allele and the other with a severe cystic fibrosis mutation (G542X, N1303K, 1812-1G->A, or 936delTA). Although these genotypes should have been associated with CBAVD, these men had offspring and are clinically normal. Three hypotheses could explain the strong but not complete correlation between the appearance of the 5T allele and CBAVD. First, there could be a nonrandom association between the 5T allele and CBAVD, with the allele segregating with the CBAVD phenotype but not being its cause. Second, there could be a partially causal role for the 5T allele, together with additional mutations in other parts of the CFTR gene. Third, the 5T allele could have a causal role in CBAVD, with other factors accounting for these exceptional men without CBAVD (the four fathers bearing the cystic fibrosis mutation). The work presented here argues convincingly against the first two hypotheses. Nonrandom association is not the case, since the analysis of several DNA markers within CFTR in the four fathers and in patients with CBAVD showed that several haplotypes (combinations of alleles on the same chromosome) were associated with the 5T allele (data not shown). The presence of another mutation in the same CFTR gene as the 5T allele is also excluded, since CFTR was thoroughly analyzed in all patients with CBAVD and it is extremely unlikely that all patients with the 5T allele had mutations outside the CFTR coding region. These data and the association of the 5T allele with low levels of normal CFTR mRNA18 strongly support the concept that the 5T mutation generally causes CBAVD when it is associated with a cystic fibrosis mutation on the other chromosome.

Additional information about the importance of the 5T mutation was obtained by screening 120 patients with cystic fibrosis. We identified three adults with the {Delta} F508/5T genotype who had mild lung disease starting in their 30s and CBAVD, but no pancreatic disease. Three other patients, 8, 12, and 14 years of age with the genotypes E585X/5T and K710X/5T (two were siblings), had a diagnosis of cystic fibrosis due to elevated concentrations of electrolytes in sweat (>60 mmol per liter) and episodes of dehydration, but no other clinical features. Since persons with a cystic fibrosis mutation and the 5T allele may have levels of normal CFTR mRNA below the range of 8 to 12 percent (the minimal level for a normal phenotype18) but above the range of 1 to 3 percent (the level below which severe cystic fibrosis occurs31), a wide clinical variation is expected in them, depending on the variability of levels of normal CFTR mRNA. These clinical forms should include CBAVD, moderate cystic fibrosis, and the absence of fertility problems (Figure 3).

In summary, we report the following findings: First, that the 5T allele in intron 8 of CFTR has clinical effects related to male infertility. Second, that in 33 percent of cases the CBAVD phenotype results from the combined action of the 5T allele and a cystic fibrosis mutation on the other chromosome. In addition, 19 percent of cases of CBAVD are due to the presence of two CFTR mutations other than the 5T allele. Moreover, the presence of only one CFTR mutation (without the 5T allele) in 20 percent of patients suggests that other undetected changes in CFTR may be involved in CBAVD. Furthermore, the relatively high proportion of patients with CBAVD who do not have CFTR mutations (22 percent) allows us to propose that another gene or genes could be responsible for CBAVD. Finally, CUAVD could be an incomplete form of CBAVD.

A large number of cystic fibrosis mutations have been discovered during the past five years, and it seems that we are now better prepared to understand how mutations combine to cause disease. The combination of the 5T allele with a cystic fibrosis mutation in the other CFTR gene is the most common cause of CBAVD, but it also has other clinical presentations. Our report on CFTR mutations in patients with CBAVD indicates that CBAVD and cystic fibrosis are extreme forms of a wide nosologic spectrum of conditions that have a common molecular basis.

Supported by a grant (93/0202E) from the Fondo de Investigaciones Sanitarias de la Seguridad Social and by grants from the Institut Català de la Salut (Generalitat de Catalunya) and the Association Française de Lutte contre la Mucoviscidose.

We are indebted to Drs. M. Pritchard and F. Cardellach for useful suggestions and comments, to H. Kruyer for assistance with the manuscript, and to J. Giménez, M.D. Ramos, and M. Miranda for technical assistance.


Source Information

From the Cancer Research Institute, Molecular Genetics Department, Hospital Duran i Reynals, L'Hospitalet de Llobregat, Barcelona, Spain (M. Chillón, T.C., V.N., X.E.); the Centre de Biogénétique, University Hospital, Brest, France (B.M., C.V., C.F.); the Andrology Department, Institute of Urology, Nephrology, and Andrology, Fundació Puigvert, Barcelona (L.B., J.R.-R.); the Department of Medical Genetics, Vrije Universiteit, Brussels, Belgium (W.L.); the Department of Urology and Microsurgery, St. Luke's Hospital, St. Louis (S.S.); the Laboratoire de Biochimie Génétique, Institut de Biologie, Montpellier, France (M.-C.R., M. Claustres); and the Genetics Service, Hospital Clinic, Barcelona (X.E.).

Address reprint requests to Dr. Estivill at the Cancer Research Institute, Hospital Duran i Reynals, Avia. Castelldefels Km 2.7, 08907 L'Hospitalet de Llobregat, Barcelona, Catalonia, Spain.

References

  1. Jequier AM, Ansell ID, Bullimore NJ. Congenital absence of the vasa deferentia presenting with infertility. J Androl 1985;6:15-19. [Free Full Text]
  2. Boat TF, Welsh MJ, Beaudet AL. Cystic fibrosis. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic basis of inherited disease. 6th ed. Vol. 2. New York: McGraw-Hill, 1989:2649-80.
  3. Riordan JR, Rommens JM, Kerem B, et al. Identification of the cystic fibrosis gene: cloning and characterization of complementary DNA. Science 1989;245:1066-1073. [Erratum, Science 1989;245:1437.] [Free Full Text]
  4. Anderson MP, Berger HA, Rich DP, Gregory RJ, Smith AE, Welsh MJ. Nucleoside triphosphates are required to open the CFTR chloride channel. Cell 1991;67:775-784. [CrossRef][Medline]
  5. Kerem BS, Rommens JM, Buchanan JA, et al. Identification of the cystic fibrosis gene: genetic analysis. Science 1989;245:1073-1080. [Free Full Text]
  6. Tsui L-C. The spectrum of cystic fibrosis mutations. Trends Genet 1992;8:392-398. [Medline]
  7. The Cystic Fibrosis Genotype-Phenotype Consortium. Correlation between genotype and phenotype in patients with cystic fibrosis. N Engl J Med 1993;329:1308-1313. [Free Full Text]
  8. Dumur V, Gervais R, Rigot JM, et al. Abnormal distribution of CF {Delta}F508 allele in azoospermic men with congenital aplasia of epididymis and vas deferens. Lancet 1990;336:512-512. [Medline]
  9. Anguiano A, Oates RD, Amos JA, et al. Congenital bilateral absence of the vas deferens: a primary genital form of cystic fibrosis. JAMA 1992;267:1794-1797. [Abstract]
  10. Osborne LR, Lynch M, Middleton PG, et al. Nasal epithelial ion transport and genetic analysis of infertile men with congenital bilateral absence of the vas deferens. Hum Mol Genet 1993;2:1605-1609. [Erratum, Hum Mol Genet 1993;2:1990.] [Free Full Text]
  11. Gervais R, Dumur V, Rigot JM, et al. High frequency of the R117H cystic fibrosis mutation in patients with congenital absence of the vas deferens. N Engl J Med 1993;328:446-447. [Free Full Text]
  12. Culard JF, Desgeorges M, Costa P, et al. Analysis of the whole CFTR coding regions and splice junctions in azoospermic men with congenital bilateral aplasia of epididymis or vas deferens. Hum Genet 1994;93:467-470. [Medline]
  13. Chu CS, Trapnell BC, Murtagh JJ Jr, et al. Variable deletion of exon 9 coding sequences in cystic fibrosis transmembrane conductance regulator gene mRNA transcripts in normal bronchial epithelium. EMBO J 1991;10:1355-1363. [Medline]
  14. Bremer S, Hoof T, Wilke M, et al. Quantitative expression patterns of multidrug-resistance P-glycoprotein (MDR1) and differentially spliced cystic-fibrosis transmembrane-conductance regulator mRNA transcripts in human epithelia. Eur J Biochem 1992;206:137-149. [Medline]
  15. Slomski R, Schloesser M, Berg LP, et al. Omission of exon 12 in cystic fibrosis transmembrane conductance regulator (CFTR) gene transcripts. Hum Genet 1992;89:615-619. [Medline]
  16. Delaney SJ, Rich DP, Thomson SA, et al. Cystic fibrosis transmembrane conductance regulator splice variants are not conserved and fail to produce chloride channels. Nat Genet 1993;4:426-431. [CrossRef][Medline]
  17. Strong TV, Wilkinson DJ, Mansoura MK, et al. Expression of an abundant alternatively spliced form of the cystic fibrosis transmembrane conductance regulator (CFTR) gene is not associated with a cAMP-activated chloride conductance. Hum Mol Genet 1993;2:225-230. [Free Full Text]
  18. Chu CS, Trapnell BC, Curristin S, Cutting GR, Crystal RG. Genetic basis of variable exon 9 skipping in cystic fibrosis transmembrane conductance regulator mRNA. Nat Genet 1993;3:151-156. [CrossRef][Medline]
  19. Casals T, Bassas LL, Ruiz-Romero J, et al. Extensive analysis of 40 infertile patients with congenital absence of the vas deferens: in 50% of cases only one CFTR allele could be detected. Hum Genet 1995;95:205-211. [CrossRef][Medline]
  20. Mercier B, Verlingue C, Lissens W, et al. Is congenital bilateral absence of vas deferens a primary form of cystic fibrosis? Analyses of the CFTR gene in 67 patients. Am J Hum Genet 1995;56:272-277. [Medline]
  21. Chillón M, Casals T, Giménez J, et al. Analysis of the CFTR gene confirms the high genetic heterogeneity of the Spanish population: 43 mutations account for only 78% of CF chromosomes. Hum Genet 1994;93:447-451. [Medline]
  22. Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215-1215. [Free Full Text]
  23. Audrézet MP, Mercier B, Guillermit H, et al. Identification of 12 novel mutations in the CFTR gene. Hum Mol Genet 1993;2:51-54. [Erratum, Hum Mol Genet 1993;2:496.] [Free Full Text]
  24. Chillón M, Casals T, Giménez J, Nunes V, Estivill X. Analysis of the CFTR gene in the Spanish population: SSCP-screening for 60 known mutations and identification of four new mutations (Q30X, A120T, 1812-1 G ->A, and 3667del4). Hum Mutat 1994;3:223-230. [CrossRef][Medline]
  25. Zielenski J, Rozmahel R, Bozon D, et al. Genomic DNA sequence of the cystic fibrosis transmembrane regulator (CFTR) gene. Genomics 1991;10:214-228. [CrossRef][Medline]
  26. Fleiss JL. Statistical methods for rates and proportions. 2nd ed. New York: John Wiley, 1981.
  27. Kiesewetter S, Macek M Jr, Davis C, et al. A mutation in CFTR produces different phenotypes depending on chromosomal background. Nat Genet 1993;5:274-278. [CrossRef][Medline]
  28. Dörk T, Fislage R, Neumann T, Wulf B, Tümmler B. Exon 9 of the CFTR gene: splice site haplotypes and cystic fibrosis mutations. Hum Genet 1994;93:67-73. [Medline]
  29. Cuppens H, Teng H, Raeymaekers P, De Boeck C, Cassiman JJ. CFTR haplotype backgrounds on normal and mutant CFTR genes. Hum Mol Genet 1994;3:607-614. [Free Full Text]
  30. Trezise AE, Chambers JA, Wardle CJ, Gould S, Harris A. Expression of cystic fibrosis gene in human foetal tissues. Hum Mol Genet 1993;2:213-218. [Free Full Text]
  31. Tizzano EF, Chitayat D, Buchwald M. Cell-specific localization of CFTR mRNA shows developmentally regulated expression in human fetal tissues. Hum Mol Genet 1993;2:219-224. [Free Full Text]
  32. Chillón M, Dörk T, Casals T, et al. A novel donor splice site in intron 11 of the CFTR gene, created by mutation 1811+1.6kbA-> G, produces a new exon: high frequency in Spanish cystic fibrosis chromosomes and association with severe phenotype. Am J Hum Genet 1995;56:623-629. [Medline]
  33. Highsmith WE, Burch LH, Zhou Z, et al. A novel mutation in the cystic fibrosis gene in patients with pulmonary disease but normal sweat chloride concentrations. N Engl J Med 1994;331:974-980. [Free Full Text]

 

This Article
-Abstract
- PDF

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation

This article has been cited by other articles:



HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2008 Massachusetts Medical Society. All rights reserved.