Hormone-resistance syndromes can be broadly defined as conditionsresulting from reduced or absent end-organ responsiveness tobiologically active hormones. They are caused by defects inhormone receptors or post-receptor defects.1,2,3 Mutations inthe thyroid hormone–receptor gene cause resistance tothyroid hormone, which is characterized by elevated serum thyroidhormone concentrations with few or no clinical and biochemicalmanifestations of thyroid hormone excess and, most notably,normal or slightly increased thyrotropin secretion.1 Mutationsthat inactivate the thyrotropin receptor or the G (guanine nucleotide–binding)protein that couples the receptor to adenylate cyclase shouldcause thyrotropin resistance, resulting in either hypothyroidismor euthyroidism with increased thyrotropin secretion, dependingon the completeness of the defect. There have been several reportsof patients with congenital hypothyroidism,4,5,6 including somewith familial hypothyroidism,7 and an apparent resistance tothe action of thyrotropin. However, sequencing of the thyrotropinand thyrotropin-receptor genes in these patients revealed noabnormalities.8
We describe three siblings who were euthyroid and had normalserum concentrations of thyroid hormone but high concentrationsof thyrotropin. They had mutations in both alleles of the thyrotropin-receptorgene, one inherited from each parent. The mutant thyrotropinreceptor inherited from the father had almost no biologic activity,and that inherited from the mother had reduced activity.
Case Reports
The propositus, the second of three daughters born to unrelatedparents, had a blood thyrotropin concentration of 103 mU perliter (normal, <20) on neonatal screening. Her thyroid glandwas normal on radioiodide scanning. At 16 days of age, she hada serum thyrotropin concentration of 47 mU per liter and a serumthyroxine (T4) concentration of 9.2 µg per deciliter (119nmol per liter); the 24-hour uptake of radioiodide by the thyroidwas 23 percent (normal, 8 to 30 percent). Because of the highserum thyrotropin values, she was treated with T4.
These results prompted the testing of her older sister (Daughter1), then four years of age, whose physical and mental developmentwas normal. Her serum thyrotropin concentration was 80 mU perliter (normal, 0.5 to 6.2), and her serum T4 concentration was9.8 µg per deciliter (126 nmol per liter; normal, 6.0to 13.0 µg per deciliter [77 to 167 nmol per liter]).She had a normal thyroidal radioiodide scan, with a three-houruptake of 9 percent. One year later she was treated with T4at a daily dose of 50 µg, which reduced her serum thyrotropinconcentration to 38 mU per liter. Four years later, the youngestdaughter (Daughter 3) was also found to have a high blood thyrotropinconcentration (96 mU per liter) at birth, with a normal T4 concentration(13.0 µg per deciliter [168 nmol per liter]). After thehigh thyrotropin value was confirmed by its measurement in serum(53 mU per liter), she was treated with T4.
All family members had thyroid glands of normal size, and nonehad symptoms or signs of hypothyroidism at any time. The threegirls continued to develop normally without adjustment of theirT4 doses, which at the time of our study were lower than theusual replacement dose (Table 1). The results of thyroid-functiontests in the three girls before and 3, 6, and 12 months afterthe discontinuation of T4 therapy as well as in their parentsare shown in Table 1. Additional studies in the eldest girlconducted two months after T4 was discontinued revealed a serumglycoprotein hormone -subunit concentration of 0.6 µgper liter (normal, <1.0) and no serum antithyrotropin antibodies,as determined by the binding of radiolabeled thyrotropin toserum immunoglobulins. Her serum thyrotropin concentration increasedfrom 66 mU per liter to a peak of 338 mU per liter 15 minutesafter the intravenous administration of 400 µg of thyrotropin-releasinghormone. Serum calcium, parathyroid hormone, luteinizing hormone,and follicle-stimulating hormone concentrations were all normal.The child's bone age was 14 years at a chronologic age of 12.3years. The parents consented to these studies.
Table 1. Tests of Thyroid Function in Members of a Family with Resistance to Thyrotropin.
Methods
Tests of Thyroid Function
Serum T4 and triiodothyronine (T3) concentrations were measuredby radioimmunoassay (Diagnostic Products, Los Angeles), andthyrotropin by chemiluminescence assay (Nichols Institute, SanJuan Capistrano, Calif.). The serum free T4 index was calculatedas the product of the serum T4 and T4-resin uptake values.9Serum free T4 and free T3 concentrations were measured by equilibriumdialysis (Nichols Institute).
Clinical Studies
The responsiveness of the pituitary and peripheral tissues tothyroid hormone was evaluated in the eldest daughter (Daughter1).1 She was given a dose of 25 µg of T3 every 12 hoursfor three days, followed by a 50-µg dose every 12 hoursfor three days. Blood samples were obtained before and 12 hoursafter the last 25-µg and 50-µg dose for the measurementof serum T4, T3, free T4 index, thyrotropin, sex hormone–bindingglobulin, alkaline phosphatase, cholesterol, and creatine kinase.
Preparation of Genomic DNA, RNA, and Complementary DNA and DNA Sequencing
Genomic DNA was isolated from peripheral-blood leukocytes. TotalRNA was extracted from the same source by the acid guanidiniumthiocyanate technique.10 The coding regions (exons 2 and 3)of the thyrotropin gene and exon 10 of the thyrotropin-receptorgene were sequenced, with genomic DNA used as the template.Sequences of exon 1 through the 5' end of exon 10 of the thyrotropin-receptorgene were obtained from complementary DNA (cDNA) synthesizedby reverse transcription of very small amounts of thyrotropin-receptormessenger RNA from blood mononuclear cells (illegitimate transcription).DNA was amplified by the polymerase chain reaction (PCR) withspecific oligonucleotide primers, subcloned into M13 bacteriophagesor pBluescript plasmids, and then sequenced (Sequenase, U.S.Biochemical, Cleveland). The sequences of the oligonucleotideprimers used are available elsewhere.
Confirmation of the Mutations and Haplotyping
To confirm the presence of each mutation and polymorphism (cytosineor adenine at position 253),11 degenerate oligonucleotide primerscomplementary to sequences near but not overlapping the variantnucleotide were synthesized. The primers were designed so thatthe product of amplification would create a unique restrictionsite only in the presence of the variant nucleotide (endonuclease-digestionallele-specific–primer method).11,12
After the subjects' genomic DNA was amplified by PCR, the DNAfragments were digested with the appropriate enzymes and thensubjected to electrophoresis in a 3 percent NuSieve–1percent agarose gel. Partial cleavage of the PCR products indicatedthat the mutant nucleotide was present in one of the two alleles.
Construction of Wild-Type and Mutant Thyrotropin-Receptor cDNA Expression Vectors
The full-length wild-type thyrotropin-receptor cDNA was clonedinto pSVL.13 Appropriate DNA fragments carrying each mutationand polymorphism identified in the subjects were replaced togenerate vectors expressing alanine at position 162 (Ala162),threonine at position 52 and alanine at position 162 (Thr52-Ala162),and asparagine at position 167 (Asn167). The final constructswere verified by sequencing.
The reporter-gene construct, -846 -Luc, responsive to cyclicAMP,14 contained 846 base pairs (bp) of the 5'-flanking sequenceand 44 bp of exon 1 of the human glycoprotein -subunit genelinked to the luciferase gene in the plasmid pA3 Luc.
Functional Studies of the Thyrotropin Receptors in a Transient Transfection System
Cos-7 cells were propagated in Dulbecco's modified Eagle's medium(GIBCO BRL, Gaithersburg, Md.) containing 10 percent fetal-calfserum at 37°C and 5 percent carbon dioxide. The cells wereplated in 12-well dishes in concentrations of 2x105 cells perwell and transfected 24 hours later by the calcium phosphateprecipitation method15 with 1 µg of the reporter vector,-846 -Luc, and 1 µg of each of the thyrotropin-receptorexpression vectors described above. Eight to 12 hours aftertransfection, the cells were washed and incubated for 48 hourswith the complete medium in the absence or presence of variousamounts of recombinant human thyrotropin (Genzyme, Cambridge,Mass.). The cells were lysed and assayed for luciferase activity(Promega, Madison, Wis.). The individual data points we reportare the means (± range) for duplicate incubation mixtures,expressed as multiples of the base-line level of luciferaseactivity in the absence of thyrotropin.
Results
The results of thyroid-function tests of all family membersare shown in Table 1. The distinctive features of the syndromein the three daughters were high serum thyrotropin concentrationsand normal serum free T4 index, free T4, and free T3 values.Both parents had slightly increased serum thyrotropin concentrationsand normal serum T4 and T3 concentrations. Discontinuation ofT4 treatment in the three girls resulted in an increase in serumthyrotropin concentrations, though the magnitude of the increasevaried. Three and six months after the discontinuation of T4treatment, serum T4 and free T4 index values were lower thanthose measured during therapy and, in two of the three girls,serum T3 concentrations were higher. At one year, the serumT4, T3, and free T4 index values equaled those measured duringT4 treatment. The girls' growth continued to be normal.
The results of administering two doses of T3 to the eldest daughterare shown in Table 2. The fractional decrease in the serum thyrotropinconcentration and the changes in serum sex hormone–bindingglobulin, alkaline phosphatase, cholesterol, and creatine kinaseconcentrations were normal, indicating normal sensitivity ofthe pituitary thyrotrophs and peripheral tissues to thyroidhormone. Furthermore, the decrease in serum thyrotropin wasaccompanied by a corresponding decline in serum T4 and freeT4 values, indicating that the secretion of thyroid hormonewas dependent on thyrotropin.
Table 2. Responses to the Administration of T3 in the Eldest Daughter (Daughter 1) in a Family with Resistance to Thyrotropin and in Nine Normal Subjects.
The coding region from 10 clones of the thyrotropin gene isolatedfrom the eldest daughter had normal sequences. This result indicatedthat the defect did not involve the subunit of thyrotropin,which confers the biologic activity of the hormone, and thereforethat the abnormality was most likely in a step mediating theaction of thyrotropin.
The thyrotropin-receptor gene of the eldest daughter was thensequenced in its entirety. Different nucleotide substitutionswere detected in each of the two alleles (Figure 1), indicatingthe presence of compound heterozygosity. Both mutations werelocated in exon 6, which encodes the midportion of the extracellulardomain of the thyrotropin receptor. In one allele the normalthymine at position 599 was replaced by an adenine, resultingin the replacement of isoleucine by asparagine at position 167.In the other allele, the normal cytosine at position 583 wasreplaced by a guanine, resulting in the replacement of prolineby alanine at position 162. The latter allele also containeda previously described polymorphic variant in exon 1 (threonine[ACC] instead of proline [CCC] at position 52).11
Figure 1. Sequencing Gel Showing the Mutations in Exon 6 of the Thyrotropin Receptor in the Eldest Daughter of a Family with Resistance to Thyrotropin.
G denotes guanine, A adenine, T thymine, and C cytosine. The substituted nucleotides (G for C and A for T) are circled in black.
We confirmed the presence of the same nucleotide substitutionsin all three girls. Furthermore, we traced each of the two mutantalleles to the corresponding parent (Figure 2). The paternalallele contained adenine at position 599, and the maternal alleleguanine at position 583. The heterozygous state of each parentwas confirmed by the presence of one normal allele (Figure 2).
Figure 2. Confirmation of the Mutations in the Thyrotropin-Receptor Gene in Members of the Study Family.
Genomic DNA from peripheral-blood leukocytes was amplified in separate PCR reactions with the use of the same antisense primer (5'-actggtaatactcacAGTGTCA3') and with two degenerated sense primers: 5'ACAGACAACCCTTACATGACTTTAA3', which produces a Dra1 restriction site in the presence of adenine at position 599, and 5'ctcttgcagTGAAATTGCAGAC3', which produces a MwoI restriction site in the presence of guanine at position 583 (the degenerated nucleotides are underlined, and intronic sequences are lowercase). The upper gel shows that the father and his three daughters all have a mutant allele containing adenine at position 599 that is digested with DraI (D2), producing a 63-bp fragment of DNA, and an allele resistant to digestion with DraI (D1) containing the thymine normally found at position 599. The lower gel shows the mutant allele containing guanine at position 583 found in the mother and her three daughters that is digested with MwoI to produce a 79-bp fragment of DNA (M2) as well as an allele containing the cytosine normally found at position 583 that resists digestion (M1). The pedigree above the gels shows the pattern of inheritance of the mutant thyrotropin-receptor alleles. The DNA size marker () was digestedwith HaeIII.
The functional activities of the mutant thyrotropin receptorsand the wild-type receptor are shown in Figure 3A and Figure 3B.In cells transfected with the wild-type thyrotropin receptor,the maximal luciferase activity induced by thyrotropin was 20times the basal level. Approximately 10 times more thyrotropinwas required for an equal effect in cells transfected with maternalmutant thyrotropin receptor (Thr52-Ala162). The thyrotropinresponses of cells containing the thyrotropin receptor withAla162 and the usual proline at position 52 (Pro52-Ala162) weresimilar to those of the maternal mutant thyrotropin receptor(Thr52-Ala162). Cells containing the paternal mutant thyrotropinreceptor (Asn167) had almost no thyrotropin-inducible activity(Figure 3A). Cotransfection of the wild-type thyrotropin receptorwith each of the mutant thyrotropin receptors, to simulate theheterozygous state of the parents, resulted in responses tolow thyrotropin concentrations indistinguishable from thoseof cells expressing the wild-type thyrotropin receptor aloneand a slightly reduced response at high thyrotropin concentrations.In contrast, in cells transfected with equal amounts of mutantmaternal and paternal thyrotropin receptors, to simulate thecompound heterozygous state of the three daughters, almost 20times more thyrotropin was required to produce the same effectas in cells transfected with the wild-type thyrotropin receptoralone (Figure 3B).
Figure 3. Biologic Function of the Mutant Thyrotropin Receptors and the Wild-Type Thyrotropin Receptor.
Thyrotropin receptors, cloned into a pSVL expression vector, were cotransfected with a cyclic AMP–responsive reporter vector into Cos-7 cells. The mean (± range) responses to thyrotropin are expressed as multiples of the base-line level of cyclic AMP–dependent luciferase activity. Panel A shows the thyrotropin-inducible activity of the vector expressing the wild-type thyrotropin receptor (Wild type), the vector expressing alanine at position 162 (Ala162), the vector expressing threonine at position 52 and alanine at position 162 (Maternal), and the vector expressing asparagine at position 167 (Paternal). Panel B shows the thyrotropin-inducible activity of the wild-type thyrotropin receptor coexpressed with each of the mutant thyrotropin receptors to simulate the heterozygous state of the parents (Mother and Father) and coexpression of equal amounts of the maternal and paternal mutant thyrotropin receptors to simulate the compound heterozygous state of their three daughters. Note that thyrotropin responsiveness is nearly normal in the conditions simulating the heterozygous state of the parents and that almost 20 times more thyrotropin was required in the presence of both mutant thyrotropin receptors, as found in the daughters, to produce the effect mediated by the wild-type thyrotropin receptor alone.
Discussion
Thyrotropin exerts its biologic action by binding to the extracellulardomain of the thyrotropin receptor located on the plasma membraneof thyroid follicular cells. This interaction is believed tocause a structural change in the intracellular domain of thereceptor. The main effect of the latter is activation of thes subunit of the G protein, which stimulates the activity ofadenylate cyclase and leads to the generation of cyclic AMP,which mediates virtually all the biologic effects of thyrotropin.16,17The thyrotropin receptor is encoded by a single gene locatedon chromosome 14.16 Recently, somatic18,19 and germ-line20 mutationshave been reported in the thyrotropin-receptor gene (Figure 4)as well as in the G-protein gene2,21 that conferred constitutiveactivation of adenylate cyclase, resulting in autonomous hyperthyroidism.
Figure 4. Structure of the Thyrotropin Receptor and Location of Known Mutations.
The amino acids are indicated by the single-letter code and numbered consecutively starting with the transcription-initiation codon. The Y on asparagine residues (N) identifies potential sites of glycosylation. The vertical lines indicate exon boundaries.
In the family we studied, all three siblings had high serumthyrotropin concentrations and normal T4 concentrations. Theabnormality was demonstrated at birth in two of the three siblings.The persistence of the high serum thyrotropin concentrationswas not compatible with transient infantile hyperthyrotropinemia.22The normal growth and development of the eldest girl (Daughter1), who did not receive thyroid hormone until the age of fiveyears, suggested that her increased thyrotropin secretion wasnot due to primary hypothyroidism. The persistent hyperthyrotropinemiain the three siblings suggested that the disorder was inherited.The borderline elevation of serum thyrotropin concentrationsin the parents indicated that the inheritance was recessive.Nevertheless, there was no history of consanguinity, a contentionsupported by the different ethnic origins of the parents (aGerman father and an Italian–Bohemian mother).
Among the possible defects, that involving the G protein, ashas been described in pseudohypoparathyroidism,2 was least likely,since the abnormality was confined to the thyroid. Short-termadministration of T3 demonstrated intact regulation of thyrotropinsecretion and normal responses of peripheral tissues, rulingout abnormalities of the thyroid hormone receptor. Furthermore,thyroid secretion was thyrotropin-dependent. Thus, a variantthyrotropin molecule with reduced biologic activity or a defectivethyrotropin receptor was the most likely cause of the abnormalityin this family. An abnormality in the subunit of thyrotropinwas unlikely because of its normal concentration in serum aswell as because of the normal serum luteinizing hormone andfollicle-stimulating hormone concentrations. Gene sequencingrevealed a normal thyrotropin coding sequence.
Complete sequencing of the thyrotropin-receptor gene revealeda different point mutation in each of the two alleles in thethree girls, one allele derived from each parent. This findingestablished the compound heterozygous inheritance of the defectand the recessive manifestation of the phenotype. The likelihoodthat both mutant alleles would be transmitted to each of thethree daughters is (1/4)3, or 1.6 percent. The two mutationsare five amino acids apart in exon 6, which encodes the midportionof the extracellular domain of the thyrotropin receptor (Figure 4).
Important areas of thyrotropin binding and signal transductionof the thyrotropin receptor have been mapped in the extracellular,transmembrane, and intracellular domains of the molecule.17,23,24,25,26Although the functional importance of the region encoded byexon 6 of the thyrotropin receptor has not been studied in detail,the substitution of leucine for the normal proline at position162 slightly decreased the responsiveness to thyrotropin.27In this family, functional assays demonstrated that the paternalmutant thyrotropin receptor had almost no thyrotropin-inducibleactivity and that the maternal mutant thyrotropin receptor had1/10 the normal activity. Replacement of the polymorphic variantthreonine at position 52 in the maternal mutant thyrotropinreceptor with the more common proline did not alter the defect.Cells transfected with equal amounts of wild-type and mutantpaternal or maternal thyrotropin receptors, to simulate thecondition of the heterozygous parents, had normal responsesto low thyrotropin concentrations and slightly reduced responsesto high concentrations. These findings are compatible with thepresence of slightly elevated serum thyrotropin concentrationsin the parents. Cells cotransfected with the mutant maternaland paternal thyrotropin receptors, as inherited in the threedaughters, required almost 20 times more thyrotropin to producethe level of activity observed in cells transfected with wild-typethyrotropin receptor alone.
These observations explain the 20-fold elevation in serum thyrotropinconcentrations in the three daughters that was necessary tomaintain normal thyroid hormone secretion. However, the precisemechanisms responsible for the impaired signal transductionand maintenance of a high serum thyrotropin concentration remainunknown. Since the mutations are located in the extracellulardomain of the thyrotropin receptor, they may reduce the bindingaffinity for thyrotropin, a hypothesis we were unable to verifybecause of a low level of thyrotropin-receptor expression inthe transient expression system. It is also possible that thesubstituted amino acids could alter signal transduction withoutaffecting thyrotropin binding.24 The mechanism enabling thesesubjects to maintain high serum thyrotropin concentrations despitetheir normal serum thyroid hormone concentrations is a matterof speculation, but possibilities include mild, subclinicalhypothyroidism, increased frequency of pulses of thyrotropinsecretion, and a resetting of the threshold for thyroid hormone–inducedsuppression of thyrotropin secretion.28
Supported in part by grants from the National Institutes ofHealth (DK-15070) and the Public Health Service (RR-00055).
We are indebted to Professor Gilbert Vassart for providing thewild-type thyrotropin-receptor cDNA expression vector and toDr. J. Larry Jameson for providing the -846 -Luc reporter vector.
Source Information
From the Departments of Medicine (T.S., Y.H., S.R.) and Pediatrics (S.R.) and the J.P. Kennedy, Jr., Mental Retardation Research Center (S.R.), University of Chicago, and the Department of Pediatrics, Loyola University (M.E.G.) — all in Chicago. Presented in part at the 76th annual meeting of the Endocrine Society, Anaheim, Calif., June 15–18, 1994.
Address reprint requests to Dr. Refetoff at the University of Chicago, MC 3090, 5841 S. Maryland Ave., Chicago, IL 60637.
References
Refetoff S, Weiss RE, Usala SJ. The syndromes of resistance to thyroid hormone. Endocr Rev 1993;14:348-399. [Free Full Text]
Weinstein LS, Shenker A. G protein mutations in human disease. Clin Biochem 1993;26:333-338. [CrossRef][Medline]
Rosenfeld RG, Rosenbloom AL, Guevara-Aguirre J. Growth hormone (GH) insensitivity due to primary GH receptor deficiency. Endocr Rev 1994;15:369-390. [Free Full Text]
Stanbury JB, Rocmans P, Buhler UK, Ochi Y. Congenital hypothyroidism with impaired thyroid response to thyrotropin. N Engl J Med 1968;279:1132-1136.
Medeiros-Neto GA, Knobel M, Bronstein MD, Simonetti J, Filho FF, Mattar E. Impaired cyclic-AMP response to thyrotropin in congenital hypothyroidism with thyroglobulin deficiency. Acta Endocrinol (Copenh) 1979;92:62-72. [Free Full Text]
Codaccioni JL, Carayon P, Michel-Bechet M, Foucault F, Lefort G, Pierron H. Congenital hypothyroidism associated with thyrotropin unresponsiveness and thyroid cell membrane alterations. J Clin Endocrinol Metab 1980;50:932-937. [Free Full Text]
Takamatsu J, Nishikawa M, Horimoto M, Ohsawa N. Familial unresponsiveness to thyrotropin by autosomal recessive inheritance. J Clin Endocrinol Metab 1993;77:1569-1573. [Abstract]
Takeshita A, Nagayama Y, Yokoyama N, et al. Analysis of thyrotropin receptor gene mutation in congenital primary hypothyroidism associated with thyrotropin unresponsiveness. Thyroid 1993;3:T-91.abstract
Refetoff S, Hagen SR, Selenkow HA. Estimation of the T 4 binding capacity of serum TBG and TBPA by a single T 4 load ion exchange resin method. J Nucl Med 1972;13:2-12. [Free Full Text]
Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156-159. [Medline]
Sunthornthepvarakul T, Hayashi Y, Refetoff S. Polymorphism of a variant human thyrotropin receptor (hTSHR) gene. Thyroid 1994;4:147-149. [Medline]
Weiss RE, Weinberg M, Refetoff S. Identical mutations in unrelated families with generalized resistance to thyroid hormone occur in cytosine-guanine-rich areas of the thyroid hormone receptor beta gene: analysis of 15 families. J Clin Invest 1993;91:2408-2415.
Libert F, Lefort A, Gerard C, et al. Cloning, sequencing and expression of the human thyrotropin (TSH) receptor: evidence for binding of autoantibodies. Biochem Biophys Res Commun 1989;165:1250-1255. [CrossRef][Medline]
Jameson JL, Powers AC, Gallagher GD, Habener JF. Enhancer and promoter element interactions dictate cyclic adenosine monophosphate mediated and cell-specific expression of the glycoprotein hormone -gene. Mol Endocrinol 1989;3:763-772. [Free Full Text]
Graham FL, van der Eb AJ. A new technique for the assay of infectivity of human adenovirus 5 DNA. Virology 1973;52:456-467. [CrossRef][Medline]
Vassart G, Dumont JE. The thyrotropin receptor and the regulation of thyrocyte function and growth. Endocr Rev 1992;13:596-611. [Free Full Text]
Nagayama Y, Rapoport B. The thyrotropin receptor 25 years after its discovery: new insight after its molecular cloning. Mol Endocrinol 1992;6:145-156. [Free Full Text]
Parma J, Duprez L, Van Sande J, et al. Somatic mutations in the thyrotropin receptor gene cause hyperfunctioning thyroid adenomas. Nature 1993;365:649-651. [CrossRef][Medline]
Porcellini A, Ciullo I, Laviola L, Amabile G, Fenzi G, Avvedimento VE. Novel mutations of thyrotropin receptor gene in thyroid hyperfunctioning adenomas: rapid identification by fine needle aspiration biopsy. J Clin Endocrinol Metab 1994;79:657-661. [Abstract]
Duprez L, Parma K, van Sande J, et al. Germline mutations in the thyrotropin receptor gene cause non-autoimmune autosomal dominant hyperthyroidism. Nat Genet 1994;7:396-401. [CrossRef][Medline]
O'Sullivan C, Barton CM, Staddon SL, Brown CL, Lemoine NR. Activating point mutations of the gsp oncogene in human thyroid adenomas. Mol Carcinog 1991;4:345-349. [Medline]
Miyai K, Harada T, Nose O, et al. Transient infantile hyperthyrotropinemia. In: Stockigt JR, Nagataki S, eds. Thyroid research VII: proceedings of the Eighth International Thyroid Congress, Sydney, Australia, 3–8 February, 1980. Oxford, England: Pergamon Press, 1980:33-6.
Nagayama Y, Nagataki S. The thyrotropin receptor: its gene expression and structure-function relationships. Thyroid Today 1994;17(2):1-9.
Nagayama Y, Rapoport B. Role of the carboxyl-terminal half of the extracellular domain of the human thyrotropin receptor in signal transduction. Endocrinology 1992;131:548-552. [Free Full Text]
Kosugi S, Okajima F, Ban T, Hidaka A, Shenker A, Kohn LD. Substitutions of different regions of the third cytoplasmic loop of the thyrotropin (TSH) receptor have selective effects on constitutive, TSH-, and TSH receptor autoantibody-stimulated phosphoinositide and 3',5'-cyclic adenosine monophosphate signal generation. Mol Endocrinol 1993;7:1009-1020. [Free Full Text]
Mori T, Sugawa H, Piraphatdist T, Inoue D, Enomoto T, Imura H. A synthetic oligopeptide derived from human thyrotropin receptor sequence binds to Graves' immunoglobulin and inhibits thyroid stimulating antibody activity but lacks interactions with TSH. Biochem Biophys Res Commun 1991;178:165-172. [CrossRef][Medline]
Nagayama Y, Rapoport B. Thyroid stimulating autoantibodies in different patients with autoimmune thyroid disease do not all recognize the same components of the human thyrotropin receptor: selective role of receptor amino acids Ser25 -Glu30 . J Clin Endocrinol Metab 1992;75:1425-1430. [Abstract]
Lewis GF, Alessi CA, Imperial JG, Refetoff S. Low serum free thyroxine index in ambulating elderly is due to a resetting of the threshold of thyrotropin feedback suppression. J Clin Endocrinol Metab 1991;73:843-849. [Free Full Text]
Nicoletti, A., Bal, M., De Marco, G., Baldazzi, L., Agretti, P., Menabo, S., Ballarini, E., Cicognani, A., Tonacchera, M., Cassio, A.
(2009). Thyrotropin-Stimulating Hormone Receptor Gene Analysis in Pediatric Patients with Non-Autoimmune Subclinical Hypothyroidism. J. Clin. Endocrinol. Metab.
94: 4187-4194
[Abstract][Full Text]
Ribault, V., Castanet, M., Bertrand, A.-M., Guibourdenche, J., Vuillard, E., Luton, D., Polak, M., the French Fetal Goiter Study Group,
(2009). Experience with Intraamniotic Thyroxine Treatment in Nonimmune Fetal Goitrous Hypothyroidism in 12 Cases. J. Clin. Endocrinol. Metab.
94: 3731-3739
[Abstract][Full Text]
Nunez Miguel, R, Sanders, J, Chirgadze, D Y, Furmaniak, J, Rees Smith, B
(2009). Thyroid stimulating autoantibody M22 mimics TSH binding to the TSH receptor leucine rich domain: a comparative structural study of protein-protein interactions. J Mol Endocrinol
42: 381-395
[Abstract][Full Text]
Tenenbaum-Rakover, Y., Grasberger, H., Mamanasiri, S., Ringkananont, U., Montanelli, L., Barkoff, M. S., Dahood, A. M.-H., Refetoff, S.
(2009). Loss-of-Function Mutations in the Thyrotropin Receptor Gene as a Major Determinant of Hyperthyrotropinemia in a Consanguineous Community. J. Clin. Endocrinol. Metab.
94: 1706-1712
[Abstract][Full Text]
Narumi, S., Muroya, K., Abe, Y., Yasui, M., Asakura, Y., Adachi, M., Hasegawa, T.
(2009). TSHR Mutations as a Cause of Congenital Hypothyroidism in Japan: A Population-Based Genetic Epidemiology Study. J. Clin. Endocrinol. Metab.
94: 1317-1323
[Abstract][Full Text]
Sura-Trueba, S., Aumas, C., Carre, A., Durif, S., Leger, J., Polak, M., de Roux, N.
(2009). An Inactivating Mutation within the First Extracellular Loop of the Thyrotropin Receptor Impedes Normal Posttranslational Maturation of the Extracellular Domain. Endocrinology
150: 1043-1050
[Abstract][Full Text]
Nunez Miguel, R, Sanders, J, Chirgadze, D Y, Blundell, T L, Furmaniak, J, Rees Smith, B
(2008). FSH and TSH binding to their respective receptors: similarities, differences and implication for glycoprotein hormone specificity. J Mol Endocrinol
41: 145-164
[Abstract][Full Text]
Peeters, R. P, van der Deure, W. M, Visser, T. J
(2006). Genetic variation in thyroid hormone pathway genes; polymorphisms in the TSH receptor and the iodothyronine deiodinases.. Eur J Endocrinol
155: 655-662
[Abstract][Full Text]
Varela, V., Rivolta, C. M., Esperante, S. A., Gruneiro-Papendieck, L., Chiesa, A., Targovnik, H. M.
(2006). Three Mutations (p.Q36H, p.G418fsX482, and g.IVS19-2A>C) in the Dual Oxidase 2 Gene Responsible for Congenital Goiter and Iodide Organification Defect. Clin. Chem.
52: 182-191
[Abstract][Full Text]
Amendola, E., De Luca, P., Macchia, P. E., Terracciano, D., Rosica, A., Chiappetta, G., Kimura, S., Mansouri, A., Affuso, A., Arra, C., Macchia, V., Di Lauro, R., De Felice, M.
(2005). A Mouse Model Demonstrates a Multigenic Origin of Congenital Hypothyroidism. Endocrinology
146: 5038-5047
[Abstract][Full Text]
Calebiro, D., de Filippis, T., Lucchi, S., Covino, C., Panigone, S., Beck-Peccoz, P., Dunlap, D., Persani, L.
(2005). Intracellular entrapment of wild-type TSH receptor by oligomerization with mutants linked to dominant TSH resistance. Hum Mol Genet
14: 2991-3002
[Abstract][Full Text]
Grasberger, H., Mimouni-Bloch, A., Vantyghem, M.-C., van Vliet, G., Abramowicz, M., Metzger, D. L., Abdullatif, H., Rydlewski, C., Macchia, P. E., Scherberg, N. H., van Sande, J., Mimouni, M., Weiss, R. E., Vassart, G., Refetoff, S.
(2005). Autosomal Dominant Resistance to Thyrotropin as a Distinct Entity in Five Multigenerational Kindreds: Clinical Characterization and Exclusion of Candidate Loci. J. Clin. Endocrinol. Metab.
90: 4025-4034
[Abstract][Full Text]
Park, S M, Chatterjee, V K K
(2005). Genetics of congenital hypothyroidism. J. Med. Genet.
42: 379-389
[Abstract][Full Text]
Schoen, E. J., Clapp, W., To, T. T., Fireman, B. H.
(2004). The Key Role of Newborn Thyroid Scintigraphy With Isotopic Iodide (123I) in Defining and Managing Congenital Hypothyroidism. Pediatrics
114: e683-e688
[Abstract][Full Text]
Tonacchera, M., Perri, A., De Marco, G., Agretti, P., Banco, M. E., Di Cosmo, C., Grasso, L., Vitti, P., Chiovato, L., Pinchera, A.
(2004). Low Prevalence of Thyrotropin Receptor Mutations in a Large Series of Subjects with Sporadic and Familial Nonautoimmune Subclinical Hypothyroidism. J. Clin. Endocrinol. Metab.
89: 5787-5793
[Abstract][Full Text]
De Felice, M., Di Lauro, R.
(2004). Thyroid Development and Its Disorders: Genetics and Molecular Mechanisms. Endocr. Rev.
25: 722-746
[Abstract][Full Text]
Gutnisky, V. J., Moya, C. M., Rivolta, C. M., Domene, S., Varela, V., Toniolo, J. V., Medeiros-Neto, G., Targovnik, H. M.
(2004). Two Distinct Compound Heterozygous Constellations (R277X/IVS34-1G>C and R277X/R1511X) in the Thyroglobulin (TG) Gene in Affected Individuals of a Brazilian Kindred with Congenital Goiter and Defective TG Synthesis. J. Clin. Endocrinol. Metab.
89: 646-657
[Abstract][Full Text]
Jordan, N., Williams, N., Gregory, J. W., Evans, C., Owen, M., Ludgate, M.
(2003). The W546X Mutation of the Thyrotropin Receptor Gene: Potential Major Contributor to Thyroid Dysfunction in a Caucasian Population. J. Clin. Endocrinol. Metab.
88: 1002-1005
[Abstract][Full Text]
Dohan, O., De la Vieja, A., Paroder, V., Riedel, C., Artani, M., Reed, M., Ginter, C. S., Carrasco, N.
(2003). The Sodium/Iodide Symporter (NIS): Characterization, Regulation, and Medical Significance. Endocr. Rev.
24: 48-77
[Abstract][Full Text]
Marians, R. C., Ng, L., Blair, H. C., Unger, P., Graves, P. N., Davies, T. F.
(2002). Defining thyrotropin-dependent and -independent steps of thyroid hormone synthesis by using thyrotropin receptor-null mice. Proc. Natl. Acad. Sci. USA
99: 15776-15781
[Abstract][Full Text]
Dohan, O., Gavrielides, M. V., Ginter, C., Amzel, L. M., Carrasco, N.
(2002). Na+/I- Symporter Activity Requires a Small and Uncharged Amino Acid Residue at Position 395. Mol. Endocrinol.
16: 1893-1902
[Abstract][Full Text]
Alberti, L., Proverbio, M. C., Costagliola, S., Romoli, R., Boldrighini, B., Vigone, M. C., Weber, G., Chiumello, G., Beck-Peccoz, P., Persani, L.
(2002). Germline Mutations of TSH Receptor Gene as Cause of Nonautoimmune Subclinical Hypothyroidism. J. Clin. Endocrinol. Metab.
87: 2549-2555
[Abstract][Full Text]
Kopp, P.
(2002). Perspective: Genetic Defects in the Etiology of Congenital Hypothyroidism. Endocrinology
143: 2019-2024
[Abstract][Full Text]
Tonacchera, M., Agretti, P., De Marco, G., Perri, A., Pinchera, A., Vitti, P., Chiovato, L.
(2001). Thyroid Resistance to TSH Complicated by Autoimmune Thyroiditis. J. Clin. Endocrinol. Metab.
86: 4543-4546
[Abstract][Full Text]
Garcia, S. I., Porto, P. I., Dieuzeide, G., Landa, M. S., Kirszner, T., Plotquin, Y., Gonzalez, C., Pirola, C. J.
(2001). Thyrotropin-Releasing Hormone Receptor (TRHR) Gene Is Associated With Essential Hypertension. Hypertension
38: 683-687
[Abstract][Full Text]
Winter, W. E., Signorino, M. R.
(2001). Molecular Thyroidology. Annals of Clinical & Laboratory Science
31: 221-244
[Abstract][Full Text]
Russo, D., Betterle, C., Arturi, F., Chiefari, E., Girelli, M. E., Filetti, S.
(2000). A Novel Mutation in the Thyrotropin (TSH) Receptor Gene Causing Loss of TSH Binding But Constitutive Receptor Activation in a Family with Resistance to TSH. J. Clin. Endocrinol. Metab.
85: 4238-4242
[Abstract][Full Text]
De la Vieja, A., Dohan, O., Levy, O., Carrasco, N.
(2000). Molecular Analysis of the Sodium/Iodide Symporter: Impact on Thyroid and Extrathyroid Pathophysiology. Physiol. Rev.
80: 1083-1105
[Abstract][Full Text]
Jan de Beur, S. M., Ding, C.-L., LaBuda, M. C., Usdin, T. B., Levine, M. A.
(2000). Pseudohypoparathyroidism 1b: Exclusion of Parathyroid Hormone and Its Receptors as Candidate Disease Genes. J. Clin. Endocrinol. Metab.
85: 2239-2246
[Abstract][Full Text]
Tonacchera, M., Agretti, P., Pinchera, A., Rosellini, V., Perri, A., Collecchi, P., Vitti, P., Chiovato, L.
(2000). Congenital Hypothyroidism with Impaired Thyroid Response to Thyrotropin (TSH) and Absent Circulating Thyroglobulin: Evidence for a New Inactivating Mutation of the TSH Receptor Gene. J. Clin. Endocrinol. Metab.
85: 1001-1008
[Abstract][Full Text]
Pralong, F. P., Gomez, F., Castillo, E., Cotecchia, S., Abuin, L., Aubert, M. L., Portmann, L., Gaillard, R. C.
(1999). Complete Hypogonadotropic Hypogonadism Associated with a Novel Inactivating Mutation of the Gonadotropin-Releasing Hormone Receptor. J. Clin. Endocrinol. Metab.
84: 3811-3816
[Abstract][Full Text]
Bogardus, S. T. Jr, Concato, J., Feinstein, A. R.
(1999). Clinical Epidemiological Quality in Molecular Genetic Research: The Need for Methodological Standards. JAMA
281: 1919-1926
[Abstract][Full Text]
Caron, P., Chauvin, S., Christin-Maitre, S., Bennet, A., Lahlou, N., Counis, R., Bouchard, P., Kottler, M.-L.
(1999). Resistance of Hypogonadic Patients with Mutated GnRH Receptor Genes to Pulsatile GnRH Administration. J. Clin. Endocrinol. Metab.
84: 990-996
[Abstract][Full Text]
Rapoport, B., Chazenbalk, G. D., Jaume, J. C., McLachlan, S. M.
(1998). The Thyrotropin (TSH)-Releasing Hormone Receptor: Interaction with TSH and Autoantibodies. Endocr. Rev.
19: 673-716
[Abstract][Full Text]
Biebermann, H., Schöneberg, T., Schulz, A., Krause, G., Grüters, A., Schultz, G., Gudermann, T.
(1998). A conserved tyrosine residue (Y601) in transmembrane domain 5 of the human thyrotropin receptor serves as a molecular switch to determine G-protein coupling. FASEB J.
12: 1461-1471
[Abstract][Full Text]
Carvalho, G. A., Weiss, R. E., Refetoff, S.
(1998). Complete Thyroxine-Binding Globulin (TBG) Deficiency Produced by a Mutation in Acceptor Splice Site Causing Frameshift and Early Termination of Translation (TBG-Kankakee). J. Clin. Endocrinol. Metab.
83: 3604-3608
[Abstract][Full Text]
Gagné, N., Parma, J., Deal, C., Vassart, G., Van Vliet, G.
(1998). Apparent Congenital Athyreosis Contrasting with Normal Plasma Thyroglobulin Levels and Associated with Inactivating Mutations in the Thyrotropin Receptor Gene: Are Athyreosis and Ectopic Thyroid Distinct Entities?. J. Clin. Endocrinol. Metab.
83: 1771-1775
[Abstract][Full Text]
Clayton, P. E, Tillmann, V.
(1998). Advances in endocrinology. Arch. Dis. Child.
78: 278-284
[Full Text]
Costagliola, S., Rodien, P., Many, M.-C., Ludgate, M., Vassart, G.
(1998). Genetic Immunization Against the Human Thyrotropin Receptor Causes Thyroiditis and Allows Production of Monoclonal Antibodies Recognizing the Native Receptor. J. Immunol.
160: 1458-1465
[Abstract][Full Text]
Sher, E. S., Xiao Ming Xu, , Adams, P. M., Craft, C. M., Stein, S. A.
(1998). The Effects of Thyroid Hormone Level and Action in Developing Brain: Are These Targets for the Actions of Polychlorinated Biphenyls and Dioxins?. Toxicol Ind Health
14: 121-158
[Abstract]
Paschke, R., Ludgate, M.
(1997). The Thyrotropin Receptor in Thyroid Diseases. NEJM
337: 1675-1681
[Full Text]
Simoni, M., Gromoll, J., Nieschlag, E.
(1997). The Follicle-Stimulating Hormone Receptor: Biochemistry, Molecular Biology, Physiology, and Pathophysiology. Endocr. Rev.
18: 739-773
[Abstract][Full Text]
Levine, M. A., Ringel, M. D.
(1997). Resistance to TSH in Patients with Normal TSH Receptors--Where Do We Turn When "Sutton's Law" Proves False?. J. Clin. Endocrinol. Metab.
82: 3930-3932
[Full Text]
Xie, J., Pannain, S., Pohlenz, J., Weiss, R. E., Moltz, K., Morlot, M., Asteria, C., Persani, L., Beck-Peccoz, P., Parma, J., Vassart, G., Refetoff, S.
(1997). Resistance to Thyrotropin (TSH) in Three Families Is not Associated with Mutations in the TSH Receptor or TSH. J. Clin. Endocrinol. Metab.
82: 3933-3940
[Abstract][Full Text]
de Roux, N., Young, J., Misrahi, M., Genet, R., Chanson, P., Schaison, G., Milgrom, E.
(1997). A Family with Hypogonadotropic Hypogonadism and Mutations in the Gonadotropin-Releasing Hormone Receptor. NEJM
337: 1597-1603
[Full Text]
Biebermann, H., Schoneberg, T., Krude, H., Schultz, G., Gudermann, T., Gruters, A.
(1997). Mutations of the Human Thyrotropin Receptor Gene Causing Thyroid Hypoplasia and Persistent Congenital Hypothyroidism. J. Clin. Endocrinol. Metab.
82: 3471-3480
[Abstract][Full Text]
Biebermann, H., Gruters, A., Schoneberg, T., Gudermann, T.
(1997). Congenital Hypothyroidism Caused by Mutations in the Thyrotropin-Receptor Gene. NEJM
336: 1390-1391
[Full Text]
Clifton-Bligh, R. J., Gregory, J. W., Ludgate, M., John, R., Persani, L., Asteria, C., Beck-Peccoz, P., Chatterjee, V. K. K.
(1997). Two Novel Mutations in the Thyrotropin (TSH) Receptor Gene in a Child with Resistance to TSH. J. Clin. Endocrinol. Metab.
82: 1094-1100
[Abstract][Full Text]
Beau, I., Misrahi, M., Gross, B., Vannier, B., Loosfelt, H., Hai, M. T. V., Pichon, C., Milgrom, E.
(1997). Basolateral Localization and Transcytosis of Gonadotropin and Thyrotropin Receptors Expressed in Madin-Darby Canine Kidney Cells. J. Biol. Chem.
272: 5241-5248
[Abstract][Full Text]
Utiger, R. D.
(1995). Thyrotropin-Receptor Mutations and Thyroid Dysfunction. NEJM
332: 183-185
[Full Text]
gene cause resistance to thyroid hormone, which is characterized by elevated serum thyroid hormone concentrations with few or no clinical and biochemical manifestations of thyroid hormone excess and, most notably, normal or slightly increased thyrotropin secretion.1 Mutations that inactivate the thyrotropin receptor or the G (guanine nucleotide–binding) protein that couples the receptor to adenylate cyclase should cause thyrotropin resistance, resulting in either hypothyroidism or euthyroidism with increased thyrotropin secretion, depending on the completeness of the defect. There have been several reports of patients with congenital hypothyroidism,4,5,6 including some with familial hypothyroidism,7 and an apparent resistance to the action of thyrotropin. However, sequencing of the thyrotropin and thyrotropin-receptor genes in these patients revealed no abnormalities.8 
-subunit concentration of 0.6 µg per liter (normal, <1.0) and no serum antithyrotropin antibodies, as determined by the binding of radiolabeled thyrotropin to serum immunoglobulins. Her serum thyrotropin concentration increased from 66 mU per liter to a peak of 338 mU per liter 15 minutes after the intravenous administration of 400 µg of thyrotropin-releasing hormone. Serum calcium, parathyroid hormone, luteinizing hormone, and follicle-stimulating hormone concentrations were all normal. The child's bone age was 14 years at a chronologic age of 12.3 years. The parents consented to these studies. 
Previous
) was digestedwith HaeIII.
