FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 332:228-232 January 26, 1995 Number 4 Next

PDF Letters Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

Although disease develops within 10 years in most persons infected with human immunodeficiency virus type 1 (HIV-1), some remain symptom-free for prolonged periods.^1,2 Most long-term asymptomatic survivors of HIV-1 infection still have evidence of disease progression in the form of declining CD4+ lymphocyte concentrations. However, some rare persons not only are asymptomatic but also maintain stable levels of CD4+ lymphocytes in the normal or near-normal range. Although the definition of nonprogression may vary, approximately 5 percent of seropositive persons have shown no HIV-related disease or declines in CD4+ cell counts despite 10 or more years of documented HIV-1 infection.² Studying persons with long-term nonprogressive infection may help us to understand the mechanisms by which HIV-1 can be controlled.

Viral factors, host factors, or both may account for the absence of progression, at least in some persons. Host factors may include the inherent susceptibility of a person's cells to HIV-1 replication³ or an HLA-determined ability to mount an adequate immune response.^4,5 Since most HIV-1 infections appear to result from only one or a few infectious viral particles,^6,7 we reasoned that a partially defective or attenuated strain of HIV-1 may be all that is transmitted in some cases. We focused our initial studies on the HIV-1 auxiliary gene called nef. This gene is not required for viral replication in cell culture, but nef is required in simian immunodeficiency virus (SIV) for the development of acquired immunodeficiency syndrome (AIDS) in rhesus monkeys.⁸ The function of nef has not been clearly defined.

We amplified HIV-1 nef sequences from five patients with long-term nonprogressive HIV-1 infection. In one patient all 34 positive reactions from blood samples obtained over a decade yielded only defective forms of nef. The clinical and virologic characteristics of the HIV-1 infection in this man are strikingly similar to the characteristics of infection in rhesus monkeys with a strain of SIV missing nef. These results indicate that infection with attenuated forms of HIV-1 contributes to the absence of disease progression in some persons. They also provide further justification for considering the use of HIV-1 mutants with deletions as live attenuated vaccines.

Methods

DNA Analysis

We amplified HIV-1 DNA sequences spanning nef with the polymerase chain reaction (PCR), using nested primers as described elsewhere,⁹ except that HIV-1–specific primers were used. The oligonucleotides used as primers were selected on the basis of their high level of sequence homology with most HIV-1 isolates in the Los Alamos data base.¹⁰ The first round of amplification involved primers corresponding to nucleotides 8675 through 8698 and 9530 through 9507 of NL43¹⁰ (5'GCAGTAGCTGAGGGGACAGATAGG3' and 5'CCAGTACAGGCAAAAAGCAGCTGC3'). For the second round of amplification, 5 µl of the 100-µl reaction mixture was used with primers corresponding to nucleotides 8748 through 8762 and 9451 through 9439 (5'GCACAGAATTCGAAGAATAAGACAGG3' and 5'CCAGGCGAATTCTCCCTGGAAAGTCCC3').

The sequences presented in this report have been submitted to GenBank (accession numbers U17438 to U17472).

Patients

Blood samples were obtained from patients followed by the New England Area Comprehensive Hemophilia Center at the Medical Center of Central Massachusetts, Memorial Hospital, Worcester. This cohort has been monitored since 1983 as part of a prospective study of immunoregulatory defects in hemophilia.¹¹ All participants have given informed consent. Most are seropositive for HIV-1 and were infected before 1983 through infusions with contaminated factor VIII concentrates. Lymphocyte subgroups were counted during 1991 and 1992 to determine whether there was disease progression in patients followed since 1984 or earlier. Patients were considered to have nonprogressive HIV-1 infection if they remained asymptomatic without ever having received antiretroviral therapy and if they had a CD4+ lymphocyte count of more than 400 per cubic millimeter and more than 30 percent of total T cells or a count of more than 600 per cubic millimeter irrespective of the percentage of CD4+ lymphocytes. Seven patients met these criteria. Patients were considered to have progressive infection if they had a CD4+ lymphocyte count of less than 200 per cubic millimeter and less than 20 percent of total T cells or of less than 100 per cubic millimeter irrespective of the percentage of CD4+ lymphocytes. Seventy-two patients met these criteria; patients who had died of HIV-related causes were also included in this category. Forty patients who did not meet the criteria for either of these categories were considered to have slowly progressive infection.

Case Report

Patient 1 is a 44-year-old man with severe hemophilia A. He was exposed to HIV-1 through infusion of contaminated factor VIII concentrates before 1983 and has been consistently HIV-1–positive on Western blotting since first being tested in 1983. He has used recombinant factor VIII (Kogenate, Miles, West Haven, Conn.) twice a week since August 1988. The most recent physical examination was notable only for hemophilic arthropathy. Serologic tests are positive for hepatitis B surface antibody, cytomegalovirus antibodies, and hepatitis C antibodies. Aspartate aminotransferase and alanine aminotransferase levels have been elevated intermittently, but other chemical and hematologic laboratory values have remained unremarkable. Lymphocyte surface markers have been evaluated annually. CD4+ lymphocyte counts have remained stable and are only slightly below the mean values in the HIV-1–seronegative members of this group of patients with hemophilia (Figure 1).

View larger version (5K): [in this window] [in a new window]   Figure 1. Mean (±SE) CD4+ Lymphocyte Counts in a Cohort of Patients with Hemophilia According to Their HIV-1 Status andRate of Disease Progression. The CD4+ lymphocyte counts for Patient 1 are shown separately.

 
Results

DNA was prepared from peripheral-blood mononuclear cells (PBMC) obtained in 1993 from five of the patients with nonprogressive HIV-1 infection, and sequences spanning the nef gene were amplified by PCR. Full-length nef sequences overwhelmingly predominated in four of the five patients. All positive PCR amplifications (33 of 33) from these four patients yielded a full-length fragment corresponding to the wild-type strain by gel analysis, and 23 of 26 DNA sequences from these 33 positive reactions had an intact nef open reading frame; 3 had deletions of a single base pair (bp) (data not shown). Others have previously shown that full-length nef genes predominate in HIV-1–infected persons with evidence of disease progression.^12,13 In contrast, only forms of nef with deletions were detected in PBMC obtained from Patient 1 in 1993 (Figure 2 and Figure 3).

View larger version (18K): [in this window] [in a new window]   Figure 2. Analysis of nef Sequences in PBMC Obtained from Patient 1 in 1983, 1986, 1989, and 1993. DNA fragments derived by PCR were separated by electrophoresis through 1.5 percent agarose gels. Lane 1 shows the PCR product of PBMC DNA from another patient with long-term nonprogressive HIV-1 infection, which was used as a control (C); lane 2 shows the size marker (M), a 1-kb ladder (GIBCO BRL); and lanes 3 through 17 show the products of individual PCR amplifications of DNA from PBMC obtained from Patient 1. The arrows indicate the position of the full-sized nef fragment.

 

View larger version (15K): [in this window] [in a new window]   Figure 3. Location of nef-Sequence Deletions in PBMC Obtained from Patient 1 in 1983, 1986, 1989, and 1993. The nucleotide numbers refer to those of the NL43 clone of HIV-1.10 In the diagram the arrows indicate the locations of oligonucleotides used to amplify viral DNA. The asterisk indicates that one PCR produced two separate clones(F1 and F2) of different sizes.

 
Frozen PBMC that had been obtained from Patient 1 in 1983, 1986, and 1989 were used to prepare additional DNA samples for PCR amplification; 78 PCR amplifications were performed with PBMC obtained in 1983, 1986, 1989, and 1993. Despite the use of a sensitive, nested PCR procedure,⁹ only 34 of 78 PCR amplifications yielded viral DNA when 2.5 µg of PBMC DNA was used per reaction tube. This result suggests that Patient 1 has a very low viral DNA burden. Measurement of HIV-1 gag DNA in PBMC by a different quantitative method¹⁴ indicated the presence of approximately 1 viral DNA copy per 100,000 PBMC. This level was 10 to 3500 times lower than the level in PBMC from five of six patients with progressive or slowly progressive HIV-1 infection, which were evaluated by the same procedure around the same time. All 34 of the positive PCR results from Patient 1 yielded fragments shorter than that of full-length nef (Figure 2).

DNA sequences were derived from clones obtained from the 34 positive PCR amplifications (Figure 3). A single DNA fragment was observed by gel analysis in 33 of the positive reactions, and a single clone from each of these was used for sequencing. One of the reactions with the sample obtained in 1986 yielded two fragments (Figure 2), and single clones representing each of the two sizes were used for sequencing (86F1 and 86F2 in Figure 3). A variety of deletions were observed among the different clones (Figure 3). The predominant deletion was 118 bp in length and was located in the nef-unique portion from nucleotides 8887 to 9004. This deletion removes a highly conserved acidic domain and a highly conserved (Pxx)₄ motif and places downstream sequences out of frame. Although a number of deletions were present in the region of nef that overlaps U3 in the long terminal repeat, none of the deletions affected cis-acting sequences known to be critical for viral replication — specifically, the polypurine tract, U3 terminal sequences, TATAA box, and NFB and Sp-1 binding sites (Figure 3). Long deletions in U3 seemed to accumulate over time in Patient 1 only after 1983 (Figure 3).

Attempts to recover HIV-1 from blood samples from Patient 1 have been repeatedly unsuccessful. Isolation attempts have included the use of serial dilutions of PBMC, whole blood, and plasma and bulk cultures of 5 million to 10 million PBMC cultivated with phytohemagglutinin-stimulated donor PBMC. Antigen-capture assays for p24 in plasma with immune-complex dissociation (Coulter Immunology, Hialeah, Fla.) have all been negative. Serum samples obtained in 1985 and plasma samples obtained in 1994 were negative for antibodies to HIV-1 nef protein by Western blotting at all dilutions tested (1:100 to 1:100,000); a pool of HIV-1–positive serum was positive for antibodies to nef protein in the same assay to a dilution of 1:10,000. Serum from five other patients with progressive HIV-1 infection was also examined, and all five were found to have antibodies reactive to nef. Gag-specific cytotoxic T lymphocytes, measured by limiting dilution assays as described previously,⁵ were present at frequencies of 69 to 166 per million PBMC in freshly isolated, unstimulated samples obtained from Patient 1 at three points between November 1991 and March 1994. Env (IIIB)–specific cytotoxic T lymphocytes have also been demonstrated at similar levels. Cytotoxic T-lymphocyte precursors specific for nef were not demonstrable in an assay in which gag and env cytotoxic T-lymphocyte precursors were measured at frequencies of approximately 300 per million PBMC with nonspecific stimulation in vitro.⁵ The persistence of antibodies and cytotoxic T-lymphocyte activity and the accumulation of additional deletions with time in the region of nef that overlaps U3 argue for the continued presence of replication-competent HIV-1, albeit at very low levels, in Patient 1.

Discussion

Rhesus monkeys inoculated with a derivative of the pathogenic SIVmac239 clone containing a 182-bp deletion in nef became infected and persistently antibody-positive. However, they had extremely low viral burdens, normal CD4+ lymphocyte concentrations, and no signs of disease progression.^8,9,15 These characteristics are strikingly similar to the course of infection in Patient 1. In these monkeys, additional deletions accumulate over time in the region of nef that overlaps U3, without affecting the critical cis-acting sequences.⁹ This is also remarkably similar to the pattern described for Patient 1 and illustrated in Figure 3. The nef sequences that overlap U3 are apparently not advantageous to the virus in the absence of an intact nef gene and are selectively lost.

Most HIV-1–positive persons with hemophilia became infected in the early 1980s, before the advent of effective blood screening. Since Patient 1 was HIV-1–positive when first tested in 1983, we cannot be certain that he was infected initially with only nef-defective HIV-1. However, the marked disadvantage of SIV and HIV variants with nef mutations in vivo in animal models strongly suggests that this is the case. Strains of SIV with mutated forms of nef are strongly selected against in infected monkeys.⁸ In addition, HIV-1 variants with mutations in nef are at a disadvantage as compared with the wild-type strain in mice with severe combined immunodeficiency that have been given human lymphoid cells¹⁶ and in experimentally infected chimpanzees (unpublished data). At the very least, defective forms of nef with deletions have vastly predominated in Patient 1 since 1983, and he has had no disease progression. It is possible that there are additional defects elsewhere in the HIV-1 genome in this patient that could contribute to the attenuated phenotype. Our observations should stimulate additional investigations into the extent to which infection with partially defective viruses may correlate with the absence of disease progression.

In this report, we describe a particular HIV-1–gene defect associated with the absence of disease progression in a single patient. Our results, and those of Huang et al.,¹⁷ suggest that deletions in nef may not be a common explanation for the absence of progression and that different factors are likely to contribute in other patients. Viral factors that could contribute include different types of mutations in a wide variety of viral genetic elements. Viral and host factors cannot be dissociated from each other, since an effective immune response is an essential feature of nonprogression. Disease outcome is likely to be determined by a delicate balance between the ability of the virus to replicate and the host's ability to mount an adequate immune response.

Rhesus monkeys infected with SIV with nef deletions are strongly protected against challenge with wild-type, pathogenic SIV,¹⁵ and it has been suggested that derivatives of HIV-1 with multiple deletions should be considered for use as live attenuated vaccines.^15,18,19 Concern for safety is the key factor limiting further development of this promising approach. However, it should be remembered that disease progression is not an inevitable outcome of lentivirus infections. African green monkeys and sooty mangabey monkeys harboring their own SIV remain infected apparently for life, but do not seem to have active disease. Strains of SIV from these species are certainly capable of causing disease, because they do so in other hosts. Similarly, chimpanzees infected with wild-type HIV-1 and macaques infected with mutant strains of SIV remain infected but asymptomatic.^8,20,21 The immunologic responses of these species appear to be sufficient to control these lentiviral infections. By deleting portions of nef or other genetic elements, the balance of power may simply shift in favor of the host's immune response. The finding of only HIV-1 variants with nef deletions in a healthy man with long-term nonprogressive HIV-1 infection provides additional impetus for consideration of this vaccine approach.

Supported by grants from the Public Health Service (HL42257, AI26507, AI25328, and RR00168), a contract with the Public Health Service (HL67022), and a fellowship from the German Bundesministerium für Forschung und Technologie AIDS Program (to Dr. Kirchhoff).

We are indebted to K. Byron, D. Crognale, B. Blais, F. Brewster, and L. Lambrecht for technical assistance; to A. Forsberg and R. Shopnick for helping coordinate the collaboration; to Paul Johnson for helpful comments; and to Patient 1 for his interest and enthusiasm.

Source Information

From the New England Regional Primate Research Center, Harvard Medical School, Southborough, Mass. (F.K., R.C.D.); the Department of Pediatrics and Medicine, Program in Molecular Medicine, University of Massachusetts Medical School, Worcester (T.C.G., J.L.S.); and the Medical Center of Central Massachusetts, Memorial Hospital, Worcester (D.B.B.).

Address reprint requests to Dr. Desrosiers at the New England Regional Primate Research Center, Harvard Medical School, 1 Pine Hill Dr., Box 9102, Southborough, MA 01772-9102.

References

1. Rutherford GW, Lifson AR, Hessol NA, et al. Course of HIV-1 infection in a cohort of homosexual and bisexual men: an 11 year follow up study. BMJ 1990;301:1183-1188. 
2. Buchbinder SP, Katz MH, Hessol NA, O'Malley PM, Holmberg SD. Long-term HIV-1 infection without immunologic progression. AIDS 1994;8:1123-1128. [Medline]
3. Williams LM, Cloyd MW. Polymorphic human gene(s) determines differential susceptibility of CD4 lymphocytes to infection by certain HIV-1 isolates. Virology 1991;184:723-728. [CrossRef][Medline]
4. Hill AVS, Elvin J, Willis AC, et al. Molecular analysis of the association of HLA-B53 and resistance to severe malaria. Nature 1992;360:434-439. [CrossRef][Medline]
5. Greenough TC, Somasundaran M, Brettler DB, et al. Normal immune function and inability to isolate virus in culture in an individual with long-term human immunodeficiency virus type 1 infection. AIDS Res Hum Retroviruses 1994;10:395-403. [Medline]
6. Zhang LQ, MacKenzie P, Cleland A, Holmes EC, Leigh Brown AJ, Simmonds P. Selection for specific sequences in the external envelope protein of human immunodeficiency virus type 1 upon primary infection. J Virol 1993;67:3345-3356. [Free Full Text]
7. Zhu T, Mo H, Wang N, et al. Genotypic and phenotypic characterization of HIV-1 in patients with primary infection. Science 1993;261:1179-1181.
8. Kestler HW III, Ringler DJ, Mori K, et al. Importance of the nef gene for maintenance of high virus loads and for development of AIDS. Cell 1991;65:651-662. [CrossRef][Medline]
9. Kirchhoff F, Kestler HW III, Desrosiers RC. Upstream U3 sequences in simian immunodeficiency virus are selectively deleted in vivo in the absence of an intact nef gene. J Virol 1994;68:2031-2037. [Free Full Text]
10. Myers G, Wain-Hobson S, Korber B, Smith RF, Pavlakis GN. Human retroviruses and AIDS 1993 I–II: a compilation and analysis of nucleic acid and amino acid sequences. Los Alamos, N.M.: Los Alamos National Laboratory, 1993.
11. Sullivan JL, Brewster FE, Brettler DB, et al. Hemophiliac immunodeficiency: influence of exposure to factor VIII concentrate, LAV/HTLV-III, and herpesviruses. J Pediatr 1986;108:504-510. [Erratum, J Pediatr 1986;109:1075.] [Medline]
12. Shugars DC, Smith MS, Glueck DH, Nantermet PV, Seillier-Moiseiwitsch F, Swanstrom R. Analysis of human immunodeficiency virus type 1 nef gene sequences present in vivo. J Virol 1993;67:4639-4650. [Free Full Text]
13. Blumberg BM, Epstein LG, Saito Y, Chen D, Sharer LR, Anand R. Human immunodeficiency virus type 1 nef quasispecies in pathological tissue. J Virol 1992;66:5256-5264. [Free Full Text]
14. Brettler DB, Somasundaran M, Forsberg AF, Krause E, Sullivan JL. Silent human immunodeficiency virus type 1 infection: a rare occurrence in a high-risk heterosexual population. Blood 1992;80:2396-2400. [Free Full Text]
15. Daniel MD, Kirchhoff F, Czajak SC, Sehgal PK, Desrosiers RC. Protective effects of a live attenuated SIV vaccine with a deletion in the nef gene. Science 1992;258:1938-1941. [Free Full Text]
16. Jamieson BD, Aldrovandi GM, Planelles V, et al. Requirement of HIV nef for in vivo replication and pathogenicity. J Virol 1994;68:3478-3485. [Free Full Text]
17. Huang Y, Zhang L, Ho DD. Characterization of nef sequences in long-term survivors of human immunodeficiency virus type 1 infection. J Virol 1995;69:93-100. [Abstract]
18. Desrosiers RC. HIV with multiple gene deletions as a live attenuated vaccine for AIDS. AIDS Res Hum Retroviruses 1992;8:411-421. [Medline]
19. World Health Organization Working Group. Feasibility of developing live attenuated HIV vaccines: conclusions and recommendations. AIDS Res Hum Retroviruses 1994;10:221-222. [Medline]
20. Johnson BK, Stone GA, Godec MS, Asher DM, Gajdusek DC, Gibbs CJ Jr. Long-term observations of human immunodeficiency virus-infected chimpanzees. AIDS Res Hum Retroviruses 1993;9:375-378. [Medline]
21. Eichberg JW, Zarling JM, Alter HJ, et al. T-cell responses to human immunodeficiency virus (HIV) and its recombinant antigens in HIV-infected chimpanzees. J Virol 1987;61:3804-3808. [Free Full Text]
22. . 2S

PDF Letters Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

Related Letters:

Declining CD4 T-Cell Counts in a Person Infected with nef-Deleted HIV-1
Greenough T. C., Sullivan J. L., Desrosiers R. C.
Extract | Full Text  
N Engl J Med 1999; 340:236-237, Jan 21, 1999. Correspondence

This article has been cited by other articles:

• Rudolph, J. M., Eickel, N., Haller, C., Schindler, M., Fackler, O. T. (2009). Inhibition of T-Cell Receptor-Induced Actin Remodeling and Relocalization of Lck Are Evolutionarily Conserved Activities of Lentiviral Nef Proteins. J. Virol. 83: 11528-11539 [Abstract] [Full Text]  
• Park, I.-W., He, J. J. (2009). HIV-1 Nef-mediated inhibition of T cell migration and its molecular determinants. J. Leukoc. Biol. 86: 1171-1178 [Abstract] [Full Text]  
• Kyei, G. B., Dinkins, C., Davis, A. S., Roberts, E., Singh, S. B., Dong, C., Wu, L., Kominami, E., Ueno, T., Yamamoto, A., Federico, M., Panganiban, A., Vergne, I., Deretic, V. (2009). Autophagy pathway intersects with HIV-1 biosynthesis and regulates viral yields in macrophages. JCB 186: 255-268 [Abstract] [Full Text]  
• Nou, E., Zhou, Y., Nou, D. D., Blankson, J. N. (2009). Effective Downregulation of HLA-A*2 and HLA-B*57 by Primary Human Immunodeficiency Virus Type 1 Isolates Cultured from Elite Suppressors. J. Virol. 83: 6941-6946 [Abstract] [Full Text]  
• daSilva, L. L. P., Sougrat, R., Burgos, P. V., Janvier, K., Mattera, R., Bonifacino, J. S. (2009). Human Immunodeficiency Virus Type 1 Nef Protein Targets CD4 to the Multivesicular Body Pathway. J. Virol. 83: 6578-6590 [Abstract] [Full Text]  
• Abraha, A., Nankya, I. L., Gibson, R., Demers, K., Tebit, D. M., Johnston, E., Katzenstein, D., Siddiqui, A., Herrera, C., Fischetti, L., Shattock, R. J., Arts, E. J. (2009). CCR5- and CXCR4-Tropic Subtype C Human Immunodeficiency Virus Type 1 Isolates Have a Lower Level of Pathogenic Fitness than Other Dominant Group M Subtypes: Implications for the Epidemic. J. Virol. 83: 5592-5605 [Abstract] [Full Text]  
• Wick, W. D., Gilbert, P. B., Yang, O. O. (2009). Predicting the Impact of Blocking Human Immunodeficiency Virus Type 1 Nef In Vivo. J. Virol. 83: 2349-2356 [Abstract] [Full Text]  
• Laguette, N., Benichou, S., Basmaciogullari, S. (2009). Human Immunodeficiency Virus Type 1 Nef Incorporation into Virions Does Not Increase Infectivity. J. Virol. 83: 1093-1104 [Abstract] [Full Text]  
• Hatano, H., Delwart, E. L., Norris, P. J., Lee, T.-H., Dunn-Williams, J., Hunt, P. W., Hoh, R., Stramer, S. L., Linnen, J. M., McCune, J. M., Martin, J. N., Busch, M. P., Deeks, S. G. (2009). Evidence for Persistent Low-Level Viremia in Individuals Who Control Human Immunodeficiency Virus in the Absence of Antiretroviral Therapy. J. Virol. 83: 329-335 [Abstract] [Full Text]  
• Witte, V., Laffert, B., Gintschel, P., Krautkramer, E., Blume, K., Fackler, O. T., Baur, A. S. (2008). Induction of HIV Transcription by Nef Involves Lck Activation and Protein Kinase C{theta} Raft Recruitment Leading to Activation of ERK1/2 but Not NF{kappa}B. J. Immunol. 181: 8425-8432 [Abstract] [Full Text]  
• Muthumani, K., Choo, A. Y., Shedlock, D. J., Laddy, D. J., Sundaram, S. G., Hirao, L., Wu, L., Thieu, K. P., Chung, C. W., Lankaraman, K. M., Tebas, P., Silvestri, G., Weiner, D. B. (2008). Human Immunodeficiency Virus Type 1 Nef Induces Programmed Death 1 Expression through a p38 Mitogen-Activated Protein Kinase-Dependent Mechanism. J. Virol. 82: 11536-11544 [Abstract] [Full Text]  
• Pizzato, M., Popova, E., Gottlinger, H. G. (2008). Nef Can Enhance the Infectivity of Receptor-Pseudotyped Human Immunodeficiency Virus Type 1 Particles. J. Virol. 82: 10811-10819 [Abstract] [Full Text]  
• Miura, T., Brockman, M. A., Brumme, C. J., Brumme, Z. L., Carlson, J. M., Pereyra, F., Trocha, A., Addo, M. M., Block, B. L., Rothchild, A. C., Baker, B. M., Flynn, T., Schneidewind, A., Li, B., Wang, Y. E., Heckerman, D., Allen, T. M., Walker, B. D. (2008). Genetic Characterization of Human Immunodeficiency Virus Type 1 in Elite Controllers: Lack of Gross Genetic Defects or Common Amino Acid Changes. J. Virol. 82: 8422-8430 [Abstract] [Full Text]  
• Bailey, J. R., O'Connell, K., Yang, H.-C., Han, Y., Xu, J., Jilek, B., Williams, T. M., Ray, S. C., Siliciano, R. F., Blankson, J. N. (2008). Transmission of Human Immunodeficiency Virus Type 1 from a Patient Who Developed AIDS to an Elite Suppressor. J. Virol. 82: 7395-7410 [Abstract] [Full Text]  
• Jin, Y.-J., Cai, C. Y., Zhang, X., Burakoff, S. J. (2008). Lysine 144, a Ubiquitin Attachment Site in HIV-1 Nef, Is Required for Nef-Mediated CD4 Down-Regulation. J. Immunol. 180: 7878-7886 [Abstract] [Full Text]  
• Lu, T.-c., He, J. C., Wang, Z.-h., Feng, X., Fukumi-Tominaga, T., Chen, N., Xu, J., Iyengar, R., Klotman, P. E. (2008). HIV-1 Nef Disrupts the Podocyte Actin Cytoskeleton by Interacting with Diaphanous Interacting Protein. J. Biol. Chem. 283: 8173-8182 [Abstract] [Full Text]  
• Rauch, S., Pulkkinen, K., Saksela, K., Fackler, O. T. (2008). Human Immunodeficiency Virus Type 1 Nef Recruits the Guanine Exchange Factor Vav1 via an Unexpected Interface into Plasma Membrane Microdomains for Association with p21-Activated Kinase 2 Activity. J. Virol. 82: 2918-2929 [Abstract] [Full Text]  
• Lewis, M. J., Balamurugan, A., Ohno, A., Kilpatrick, S., Ng, H. L., Yang, O. O. (2008). Functional Adaptation of Nef to the Immune Milieu of HIV-1 Infection In Vivo. J. Immunol. 180: 4075-4081 [Abstract] [Full Text]  
• Hoffmann, D., Seebach, J., Cosma, A., Goebel, F. D., Strimmer, K., Schatzl, H. M., Erfle, V. (2008). Therapeutic vaccination reduces HIV sequence variability. FASEB J. 22: 437-444 [Abstract] [Full Text]  
• Ueno, T., Motozono, C., Dohki, S., Mwimanzi, P., Rauch, S., Fackler, O. T., Oka, S., Takiguchi, M. (2008). CTL-Mediated Selective Pressure Influences Dynamic Evolution and Pathogenic Functions of HIV-1 Nef. J. Immunol. 180: 1107-1116 [Abstract] [Full Text]  
• Hiyoshi, M., Suzu, S., Yoshidomi, Y., Hassan, R., Harada, H., Sakashita, N., Akari, H., Motoyoshi, K., Okada, S. (2008). Interaction between Hck and HIV-1 Nef negatively regulates cell surface expression of M-CSF receptor. Blood 111: 243-250 [Abstract] [Full Text]  
• Potter, S. J., Lacabaratz, C., Lambotte, O., Perez-Patrigeon, S., Vingert, B., Sinet, M., Colle, J.-H., Urrutia, A., Scott-Algara, D., Boufassa, F., Delfraissy, J.-F., Theze, J., Venet, A., Chakrabarti, L. A. (2007). Preserved Central Memory and Activated Effector Memory CD4+ T-Cell Subsets in Human Immunodeficiency Virus Controllers: an ANRS EP36 Study. J. Virol. 81: 13904-13915 [Abstract] [Full Text]  
• Munch, J., Rajan, D., Schindler, M., Specht, A., Rucker, E., Novembre, F. J., Nerrienet, E., Muller-Trutwin, M. C., Peeters, M., Hahn, B. H., Kirchhoff, F. (2007). Nef-Mediated Enhancement of Virion Infectivity and Stimulation of Viral Replication Are Fundamental Properties of Primate Lentiviruses. J. Virol. 81: 13852-13864 [Abstract] [Full Text]  
• Schindler, M., Rajan, D., Specht, A., Ritter, C., Pulkkinen, K., Saksela, K., Kirchhoff, F. (2007). Association of Nef with p21-Activated Kinase 2 Is Dispensable for Efficient Human Immunodeficiency Virus Type 1 Replication and Cytopathicity in Ex Vivo-Infected Human Lymphoid Tissue. J. Virol. 81: 13005-13014 [Abstract] [Full Text]  
• Giolo, G., Neri, F., Casartelli, N., Potesta, M., Belleudi, F., Torrisi, M. R., Doria, M. (2007). Internalization and intracellular retention of CD4 are two separate functions of the human immunodeficiency virus type 1 Nef protein. J. Gen. Virol. 88: 3133-3138 [Abstract] [Full Text]  
• Sacha, J. B., Chung, C., Reed, J., Jonas, A. K., Bean, A. T., Spencer, S. P., Lee, W., Vojnov, L., Rudersdorf, R., Friedrich, T. C., Wilson, N. A., Lifson, J. D., Watkins, D. I. (2007). Pol-Specific CD8+ T Cells Recognize Simian Immunodeficiency Virus-Infected Cells Prior to Nef-Mediated Major Histocompatibility Complex Class I Downregulation. J. Virol. 81: 11703-11712 [Abstract] [Full Text]  
• Das, A. T., Klaver, B., Harwig, A., Vink, M., Ooms, M., Centlivre, M., Berkhout, B. (2007). Construction of a Doxycycline-Dependent Simian Immunodeficiency Virus Reveals a Nontranscriptional Function of Tat in Viral Replication. J. Virol. 81: 11159-11169 [Abstract] [Full Text]  
• Priceputu, E., Hanna, Z., Hu, C., Simard, M.-C., Vincent, P., Wildum, S., Schindler, M., Kirchhoff, F., Jolicoeur, P. (2007). Primary Human Immunodeficiency Virus Type 1 Nef Alleles Show Major Differences in Pathogenicity in Transgenic Mice. J. Virol. 81: 4677-4693 [Abstract] [Full Text]  
• Koenen, P. G. F., Hofhuis, F. M., Oosterwegel, M. A., Tesselaar, K. (2007). T Cell Activation and Proliferation Characteristic for HIV-Nef Transgenic Mice Is Lymphopenia Induced. J. Immunol. 178: 5762-5768 [Abstract] [Full Text]  
• Chaudhuri, R., Lindwasser, O. W., Smith, W. J., Hurley, J. H., Bonifacino, J. S. (2007). Downregulation of CD4 by Human Immunodeficiency Virus Type 1 Nef Is Dependent on Clathrin and Involves Direct Interaction of Nef with the AP2 Clathrin Adaptor. J. Virol. 81: 3877-3890 [Abstract] [Full Text]  
• Mangino, G., Percario, Z. A., Fiorucci, G., Vaccari, G., Manrique, S., Romeo, G., Federico, M., Geyer, M., Affabris, E. (2007). In Vitro Treatment of Human Monocytes/Macrophages with Myristoylated Recombinant Nef of Human Immunodeficiency Virus Type 1 Leads to the Activation of Mitogen-Activated Protein Kinases, I{kappa}B Kinases, and Interferon Regulatory Factor 3 and to the Release of Beta Interferon. J. Virol. 81: 2777-2791 [Abstract] [Full Text]  
• Blankson, J. N., Bailey, J. R., Thayil, S., Yang, H.-C., Lassen, K., Lai, J., Gandhi, S. K., Siliciano, J. D., Williams, T. M., Siliciano, R. F. (2007). Isolation and Characterization of Replication-Competent Human Immunodeficiency Virus Type 1 from a Subset of Elite Suppressors. J. Virol. 81: 2508-2518 [Abstract] [Full Text]  
• Wang, J.-H., Janas, A. M., Olson, W. J., KewalRamani, V. N., Wu, L. (2007). CD4 Coexpression Regulates DC-SIGN-Mediated Transmission of Human Immunodeficiency Virus Type 1. J. Virol. 81: 2497-2507 [Abstract] [Full Text]  
• Cerboni, C., Neri, F., Casartelli, N., Zingoni, A., Cosman, D., Rossi, P., Santoni, A., Doria, M. (2007). Human immunodeficiency virus 1 Nef protein downmodulates the ligands of the activating receptor NKG2D and inhibits natural killer cell-mediated cytotoxicity. J. Gen. Virol. 88: 242-250 [Abstract] [Full Text]  
• Calugi, G., Montella, F., Favalli, C., Benedetto, A. (2006). Entire Genome of a Strain of Human Immunodeficiency Virus Type 1 with a Deletion of nef That Was Recovered 20 Years after Primary Infection: Large Pool of Proviruses with Deletions of env. J. Virol. 80: 11892-11896 [Abstract] [Full Text]  
• Venzke, S., Michel, N., Allespach, I., Fackler, O. T., Keppler, O. T. (2006). Expression of Nef Downregulates CXCR4, the Major Coreceptor of Human Immunodeficiency Virus, from the Surfaces of Target Cells and Thereby Enhances Resistance to Superinfection. J. Virol. 80: 11141-11152 [Abstract] [Full Text]  
• Crotti, A., Neri, F., Corti, D., Ghezzi, S., Heltai, S., Baur, A., Poli, G., Santagostino, E., Vicenzi, E. (2006). Nef Alleles from Human Immunodeficiency Virus Type 1-Infected Long-Term-Nonprogressor Hemophiliacs with or without Late Disease Progression Are Defective in Enhancing Virus Replication and CD4 Down-Regulation. J. Virol. 80: 10663-10674 [Abstract] [Full Text]  
• Trible, R. P., Emert-Sedlak, L., Smithgall, T. E. (2006). HIV-1 Nef Selectively Activates Src Family Kinases Hck, Lyn, and c-Src through Direct SH3 Domain Interaction. J. Biol. Chem. 281: 27029-27038 [Abstract] [Full Text]  
• O'Neill, E., Baugh, L. L., Novitsky, V. A., Essex, M. E., Garcia, J. V. (2006). Intra- and intersubtype alternative pak2-activating structural motifs of human immunodeficiency virus type 1 nef.. J. Virol. 80: 8824-8829 [Abstract] [Full Text]  
• Marecki, J. C., Cool, C. D., Parr, J. E., Beckey, V. E., Luciw, P. A., Tarantal, A. F., Carville, A., Shannon, R. P., Cota-Gomez, A., Tuder, R. M., Voelkel, N. F., Flores, S. C. (2006). HIV-1 Nef Is Associated with Complex Pulmonary Vascular Lesions in SHIV-nef-infected Macaques. Am. J. Respir. Crit. Care Med. 174: 437-445 [Abstract] [Full Text]  
• Casartelli, N., Giolo, G., Neri, F., Haller, C., Potesta, M., Rossi, P., Fackler, O. T., Doria, M. (2006). The Pro78 residue regulates the capacity of the human immunodeficiency virus type 1 Nef protein to inhibit recycling of major histocompatibility complex class I molecules in an SH3-independent manner.. J. Gen. Virol. 87: 2291-2296 [Abstract] [Full Text]  
• Haller, C., Rauch, S., Michel, N., Hannemann, S., Lehmann, M. J., Keppler, O. T., Fackler, O. T. (2006). The HIV-1 Pathogenicity Factor Nef Interferes with Maturation of Stimulatory T-lymphocyte Contacts by Modulation of N-Wasp Activity. J. Biol. Chem. 281: 19618-19630 [Abstract] [Full Text]  
• Bailey, J. R., Williams, T. M., Siliciano, R. F., Blankson, J. N. (2006). Maintenance of viral suppression in HIV-1-infected HLA-B*57+ elite suppressors despite CTL escape mutations. JEM 203: 1357-1369 [Abstract] [Full Text]  
• Brenner, M., Munch, J., Schindler, M., Wildum, S., Stolte, N., Stahl-Hennig, C., Fuchs, D., Matz-Rensing, K., Franz, M., Heeney, J., Ten Haaft, P., Swigut, T., Hrecka, K., Skowronski, J., Kirchhoff, F. (2006). Importance of the N-Distal AP-2 Binding Element in Nef for Simian Immunodeficiency Virus Replication and Pathogenicity in Rhesus Macaques. J. Virol. 80: 4469-4481 [Abstract] [Full Text]  
• Vincent, P., Priceputu, E., Kay, D., Saksela, K., Jolicoeur, P., Hanna, Z. (2006). Activation of p21-activated Kinase 2 and Its Association with Nef Are Conserved in Murine Cells but Are Not Sufficient to Induce an AIDS-like Disease in CD4C/HIV Transgenic Mice. J. Biol. Chem. 281: 6940-6954 [Abstract] [Full Text]  
• Agopian, K., Wei, B. L., Garcia, J. V., Gabuzda, D. (2006). A Hydrophobic Binding Surface on the Human Immunodeficiency Virus Type 1 Nef Core Is Critical for Association with p21-Activated Kinase 2. J. Virol. 80: 3050-3061 [Abstract] [Full Text]  
• Keppler, O. T., Tibroni, N., Venzke, S., Rauch, S., Fackler, O. T. (2006). Modulation of specific surface receptors and activation sensitization in primary resting CD4+ T lymphocytes by the Nef protein of HIV-1. J. Leukoc. Biol. 79: 616-627 [Abstract] [Full Text]  
• Churchill, M. J., Rhodes, D. I., Learmont, J. C., Sullivan, J. S., Wesselingh, S. L., Cooke, I. R. C., Deacon, N. J., Gorry, P. R. (2006). Longitudinal Analysis of Human Immunodeficiency Virus Type 1 nef/Long Terminal Repeat Sequences in a Cohort of Long-Term Survivors Infected from a Single Source. J. Virol. 80: 1047-1052 [Abstract] [Full Text]  
• Kim, M.-O., Suh, H.-S., Si, Q., Terman, B. I., Lee, S. C. (2006). Anti-CD45RO Suppresses Human Immunodeficiency Virus Type 1 Replication in Microglia: Role of Hck Tyrosine Kinase and Implications for AIDS Dementia. J. Virol. 80: 62-72 [Abstract] [Full Text]  
• Raney, A., Kuo, L. S., Baugh, L. L., Foster, J. L., Garcia, J. V. (2005). Reconstitution and Molecular Analysis of an Active Human Immunodeficiency Virus Type 1 Nef/p21-Activated Kinase 2 Complex. J. Virol. 79: 12732-12741 [Abstract] [Full Text]  
• Brown, A., Gartner, S., Kawano, T., Benoit, N., Cheng-Mayer, C. (2005). HLA-A2 down-regulation on primary human macrophages infected with an M-tropic EGFP-tagged HIV-1 reporter virus. J. Leukoc. Biol. 78: 675-685 [Abstract] [Full Text]  
• Hrecka, K., Swigut, T., Schindler, M., Kirchhoff, F., Skowronski, J. (2005). Nef Proteins from Diverse Groups of Primate Lentiviruses Downmodulate CXCR4 To Inhibit Migration to the Chemokine Stromal Derived Factor 1. J. Virol. 79: 10650-10659 [Abstract] [Full Text]  
• Troyer, R. M., Collins, K. R., Abraha, A., Fraundorf, E., Moore, D. M., Krizan, R. W., Toossi, Z., Colebunders, R. L., Jensen, M. A., Mullins, J. I., Vanham, G., Arts, E. J. (2005). Changes in Human Immunodeficiency Virus Type 1 Fitness and Genetic Diversity during Disease Progression. J. Virol. 79: 9006-9018 [Abstract] [Full Text]  
• Cluet, D., Bertsch, C., Beyer, C., Gloeckler, L., Erhardt, M., Gut, J.-P., Galzi, J.-L., Aubertin, A.-M. (2005). Detection of Human Immunodeficiency Virus Type 1 Nef and CD4 Physical Interaction in Living Human Cells by Using Bioluminescence Resonance Energy Transfer. J. Virol. 79: 8629-8636 [Abstract] [Full Text]  
• Schindler, M., Munch, J., Kirchhoff, F. (2005). Human Immunodeficiency Virus Type 1 Inhibits DNA Damage-Triggered Apoptosis by a Nef-Independent Mechanism. J. Virol. 79: 5489-5498 [Abstract] [Full Text]  
• Lee, S. B., Park, J., Jung, J. U., Chung, J. (2005). Nef induces apoptosis by activating JNK signaling pathway and inhibits NF-{kappa}B-dependent immune responses in Drosophila. J. Cell Sci. 118: 1851-1859 [Abstract] [Full Text]  
• Suzu, S., Harada, H., Matsumoto, T., Okada, S. (2005). HIV-1 Nef interferes with M-CSF receptor signaling through Hck activation and inhibits M-CSF bioactivities. Blood 105: 3230-3237 [Abstract] [Full Text]  
• Omoto, S., Fujii, Y. R. (2005). Regulation of human immunodeficiency virus 1 transcription by nef microRNA. J. Gen. Virol. 86: 751-755 [Abstract] [Full Text]  
• Keppler, O. T., Allespach, I., Schuller, L., Fenard, D., Greene, W. C., Fackler, O. T. (2005). Rodent Cells Support Key Functions of the Human Immunodeficiency Virus Type 1 Pathogenicity Factor Nef. J. Virol. 79: 1655-1665 [Abstract] [Full Text]  
• Choi, J., Walker, J., Boichuk, S., Kirkiles-Smith, N., Torpey, N., Pober, J. S., Alexander, L. (2005). Human Endothelial Cells Enhance Human Immunodeficiency Virus Type 1 Replication in CD4+ T Cells in a Nef-Dependent Manner In Vitro and In Vivo. J. Virol. 79: 264-276 [Abstract] [Full Text]  
• Choudhary, S. K., Choudhary, N. R., Kimbrell, K. C., Colasanti, J., Ziogas, A., Kwa, D., Schuitemaker, H., Camerini, D. (2005). R5 Human Immunodeficiency Virus Type 1 Infection of Fetal Thymic Organ Culture Induces Cytokine and CCR5 Expression. J. Virol. 79: 458-471 [Abstract] [Full Text]  
• Choi, H.-J., Smithgall, T. E. (2004). HIV-1 Nef Promotes Survival of TF-1 Macrophages by Inducing Bcl-XL Expression in an Extracellular Signal-regulated Kinase-dependent Manner. J. Biol. Chem. 279: 51688-51696 [Abstract] [Full Text]  
• Pulkkinen, K., Renkema, G. H., Kirchhoff, F., Saksela, K. (2004). Nef Associates with p21-Activated Kinase 2 in a p21-GTPase-Dependent Dynamic Activation Complex within Lipid Rafts. J. Virol. 78: 12773-12780 [Abstract] [Full Text]  
• Swigut, T., Alexander, L., Morgan, J., Lifson, J., Mansfield, K. G., Lang, S., Johnson, R. P., Skowronski, J., Desrosiers, R. (2004). Impact of Nef-Mediated Downregulation of Major Histocompatibility Complex Class I on Immune Response to Simian Immunodeficiency Virus. J. Virol. 78: 13335-13344 [Abstract] [Full Text]  
• Rucker, E., Grivel, J.-C., Munch, J., Kirchhoff, F., Margolis, L. (2004). Vpr and Vpu Are Important for Efficient Human Immunodeficiency Virus Type 1 Replication and CD4+ T-Cell Depletion in Human Lymphoid Tissue Ex Vivo. J. Virol. 78: 12689-12693 [Abstract] [Full Text]  
• Jin, Y.-J., Zhang, X., Boursiquot, J. G., Burakoff, S. J. (2004). CD4 Phosphorylation Partially Reverses Nef Down-Regulation of CD4. J. Immunol. 173: 5495-5500 [Abstract] [Full Text]  
• Huang, M.-B., Jin, L. L., James, C. O., Khan, M., Powell, M. D., Bond, V. C. (2004). Characterization of Nef-CXCR4 Interactions Important for Apoptosis Induction. J. Virol. 78: 11084-11096 [Abstract] [Full Text]  
• Schindler, M., Munch, J., Brenner, M., Stahl-Hennig, C., Skowronski, J., Kirchhoff, F. (2004). Comprehensive Analysis of Nef Functions Selected in Simian Immunodeficiency Virus-Infected Macaques. J. Virol. 78: 10588-10597 [Abstract] [Full Text]  
• Olszewski, A., Sato, K., Aron, Z. D., Cohen, F., Harris, A., McDougall, B. R., Robinson, W. E. Jr., Overman, L. E., Weiss, G. A. (2004). Guanidine alkaloid analogs as inhibitors of HIV-1 Nef interactions with p53, actin, and p56lck. Proc. Natl. Acad. Sci. USA 101: 14079-14084 [Abstract] [Full Text]  
• Kirchhoff, F., Schindler, M., Bailer, N., Renkema, G. H., Saksela, K., Knoop, V., Muller-Trutwin, M. C., Santiago, M. L., Bibollet-Ruche, F., Dittmar, M. T., Heeney, J. L., Hahn, B. H., Munch, J. (2004). Nef Proteins from Simian Immunodeficiency Virus-Infected Chimpanzees Interact with p21-Activated Kinase 2 and Modulate Cell Surface Expression of Various Human Receptors. J. Virol. 78: 6864-6874 [Abstract] [Full Text]  
• Lundquist, C. A., Zhou, J., Aiken, C. (2004). Nef Stimulates Human Immunodeficiency Virus Type 1 Replication in Primary T Cells by Enhancing Virion-Associated gp120 Levels: Coreceptor-Dependent Requirement for Nef in Viral Replication. J. Virol. 78: 6287-6296 [Abstract] [Full Text]  
• Na, Y.-S., Yoon, K., Nam, J.-G., Choi, B., Lee, J.-S., Kato, I., Kim, S. (2004). Nef from a primary isolate of human immunodeficiency virus type 1 lacking the EE155 region shows decreased ability to down-regulate CD4. J. Gen. Virol. 85: 1451-1461 [Abstract] [Full Text]  
• Brown, A., Moghaddam, S., Kawano, T., Cheng-Mayer, C. (2004). Multiple human immunodeficiency virus type 1 Nef functions contribute to efficient replication in primary human macrophages. J. Gen. Virol. 85: 1463-1469 [Abstract] [Full Text]  
• Weng, X., Priceputu, E., Chrobak, P., Poudrier, J., Kay, D. G., Hanna, Z., Mak, T. W., Jolicoeur, P. (2004). CD4+ T Cells from CD4C/HIVNef Transgenic Mice Show Enhanced Activation In Vivo with Impaired Proliferation In Vitro but Are Dispensable for the Development of a Severe AIDS-Like Organ Disease. J. Virol. 78: 5244-5257 [Abstract] [Full Text]  
• Costa, L. J., Zheng, Y.-H., Sabotic, J., Mak, J., Fackler, O. T., Peterlin, B. M. (2004). Nef Binds p6* in GagPol during Replication of Human Immunodeficiency Virus Type 1. J. Virol. 78: 5311-5323 [Abstract] [Full Text]  
• Huthoff, H., Das, A. T., Vink, M., Klaver, B., Zorgdrager, F., Cornelissen, M., Berkhout, B. (2004). A Human Immunodeficiency Virus Type 1-Infected Individual with Low Viral Load Harbors a Virus Variant That Exhibits an In Vitro RNA Dimerization Defect. J. Virol. 78: 4907-4913 [Abstract] [Full Text]  
• Krautkramer, E., Giese, S. I., Gasteier, J. E., Muranyi, W., Fackler, O. T. (2004). Human Immunodeficiency Virus Type 1 Nef Activates p21-Activated Kinase via Recruitment into Lipid Rafts. J. Virol. 78: 4085-4097 [Abstract] [Full Text]  
• Casartelli, N., Di Matteo, G., Potesta, M., Rossi, P., Doria, M. (2003). CD4 and Major Histocompatibility Complex Class I Downregulation by the Human Immunodeficiency Virus Type 1 Nef Protein in Pediatric AIDS Progression. J. Virol. 77: 11536-11545 [Abstract] [Full Text]  
• Stove, V., Naessens, E., Stove, C., Swigut, T., Plum, J., Verhasselt, B. (2003). Signaling but not trafficking function of HIV-1 protein Nef is essential for Nef-induced defects in human intrathymic T-cell development. Blood 102: 2925-2932 [Abstract] [Full Text]  
• Schindler, M., Wurfl, S., Benaroch, P., Greenough, T. C., Daniels, R., Easterbrook, P., Brenner, M., Munch, J., Kirchhoff, F. (2003). Down-Modulation of Mature Major Histocompatibility Complex Class II and Up-Regulation of Invariant Chain Cell Surface Expression Are Well-Conserved Functions of Human and Simian Immunodeficiency Virus nef Alleles. J. Virol. 77: 10548-10556 [Abstract] [Full Text]  
• Tobiume, M., Lineberger, J. E., Lundquist, C. A., Miller, M. D., Aiken, C. (2003). Nef Does Not Affect the Efficiency of Human Immunodeficiency Virus Type 1 Fusion with Target Cells. J. Virol. 77: 10645-10650 [Abstract] [Full Text]  
• Gould, S. J., Booth, A. M., Hildreth, J. E. K. (2003). The Trojan exosome hypothesis. Proc. Natl. Acad. Sci. USA 100: 10592-10597 [Abstract] [Full Text]  
• Arganaraz, E. R., Schindler, M., Kirchhoff, F., Cortes, M. J., Lama, J. (2003). Enhanced CD4 Down-modulation by Late Stage HIV-1 nef Alleles Is Associated with Increased Env Incorporation and Viral Replication. J. Biol. Chem. 278: 33912-33919 [Abstract] [Full Text]  
• Rangel, H. R., Weber, J., Chakraborty, B., Gutierrez, A., Marotta, M. L., Mirza, M., Kiser, P., Martinez, M. A., Este, J. A., Quinones-Mateu, M. E. (2003). Role of the Human Immunodeficiency Virus Type 1 Envelope Gene in Viral Fitness. J. Virol. 77: 9069-9073 [Abstract] [Full Text]  
• Alexander, L., Illyinskii, P. O., Lang, S. M., Means, R. E., Lifson, J., Mansfield, K., Desrosiers, R. C. (2003). Determinants of Increased Replicative Capacity of Serially Passaged Simian Immunodeficiency Virus with nef Deleted in Rhesus Monkeys. J. Virol. 77: 6823-6835 [Abstract] [Full Text]  
• Sugimoto, C., Tadakuma, K., Otani, I., Moritoyo, T., Akari, H., Ono, F., Yoshikawa, Y., Sata, T., Izumo, S., Mori, K. (2003). nef Gene Is Required for Robust Productive Infection by Simian Immunodeficiency Virus of T-Cell-Rich Paracortex in Lymph Nodes. J. Virol. 77: 4169-4180 [Abstract] [Full Text]  
• Forshey, B. M., Aiken, C. (2003). Disassembly of Human Immunodeficiency Virus Type 1 Cores In Vitro Reveals Association of Nef with the Subviral Ribonucleoprotein Complex. J. Virol. 77: 4409-4414 [Abstract] [Full Text]  
• Olivetta, E., Percario, Z., Fiorucci, G., Mattia, G., Schiavoni, I., Dennis, C., Jager, J., Harris, M., Romeo, G., Affabris, E., Federico, M. (2003). HIV-1 Nef Induces the Release of Inflammatory Factors from Human Monocyte/Macrophages: Involvement of Nef Endocytotic Signals and NF-{kappa}B Activation. J. Immunol. 170: 1716-1727 [Abstract] [Full Text]  
• Stoddart, C. A., Geleziunas, R., Ferrell, S., Linquist-Stepps, V., Moreno, M. E., Bare, C., Xu, W., Yonemoto, W., Bresnahan, P. A., McCune, J. M., Greene, W. C. (2003). Human Immunodeficiency Virus Type 1 Nef-Mediated Downregulation of CD4 Correlates with Nef Enhancement of Viral Pathogenesis. J. Virol. 77: 2124-2133 [Abstract] [Full Text]  
• Ball, S. C., Abraha, A., Collins, K. R., Marozsan, A. J., Baird, H., Quinones-Mateu, M. E., Penn-Nicholson, A., Murray, M., Richard, N., Lobritz, M., Zimmerman, P. A., Kawamura, T., Blauvelt, A., Arts, E. J. (2002). Comparing the Ex Vivo Fitness of CCR5-Tropic Human Immunodeficiency Virus Type 1 Isolates of Subtypes B and C. J. Virol. 77: 1021-1038 [Abstract] [Full Text]  
• Voss, G., Manson, K., Montefiori, D., Watkins, D. I., Heeney, J., Wyand, M., Cohen, J., Bruck, C. (2002). Prevention of Disease Induced by a Partially Heterologous AIDS Virus in Rhesus Monkeys by Using an Adjuvanted Multicomponent Protein Vaccine. J. Virol. 77: 1049-1058 [Abstract] [Full Text]  
• Chakrabarti, L. A., Metzner, K. J., Ivanovic, T., Cheng, H., Louis-Virelizier, J., Connor, R. I., Cheng-Mayer, C. (2002). A Truncated Form of Nef Selected during Pathogenic Reversion of Simian Immunodeficiency Virus SIVmac239{Delta}nef Increases Viral Replication. J. Virol. 77: 1245-1256 [Abstract] [Full Text]  
• Johnson, W. E., Lifson, J. D., Lang, S. M., Johnson, R. P., Desrosiers, R. C. (2002). Importance of B-Cell Responses for Immunological Control of Variant Strains of Simian Immunodeficiency Virus. J. Virol. 77: 375-381 [Abstract] [Full Text]  
• Munch, J., Janardhan, A., Stolte, N., Stahl-Hennig, C., ten Haaft, P., Heeney, J. L., Swigut, T., Kirchhoff, F., Skowronski, J. (2002). T-Cell Receptor:CD3 Down-Regulation Is a Selected In Vivo Function of Simian Immunodeficiency Virus Nef but Is Not Sufficient for Effective Viral Replication in Rhesus Macaques. J. Virol. 76: 12360-12364 [Abstract] [Full Text]  
• Vilhardt, F., Plastre, O., Sawada, M., Suzuki, K., Wiznerowicz, M., Kiyokawa, E., Trono, D., Krause, K.-H. (2002). The HIV-1 Nef Protein and Phagocyte NADPH Oxidase Activation. J. Biol. Chem. 277: 42136-42143 [Abstract] [Full Text]  
• Alexander, L., Aquino-DeJesus, M. J., Chan, M., Andiman, W. A. (2002). Inhibition of Human Immunodeficiency Virus Type 1 (HIV-1) Replication by a Two-Amino-Acid Insertion in HIV-1 Vif from a Nonprogressing Mother and Child. J. Virol. 76: 10533-10539 [Abstract] [Full Text]  
• Ignatius, R., Tenner-Racz, K., Messmer, D., Gettie, A., Blanchard, J., Luckay, A., Russo, C., Smith, S., Marx, P. A., Steinman, R. M., Racz, P., Pope, M. (2002). Increased Macrophage Infection upon Subcutaneous Inoculation of Rhesus Macaques with Simian Immunodeficiency Virus-Loaded Dendritic Cells or T Cells but Not with Cell-Free Virus. J. Virol. 76: 9787-9797 [Abstract] [Full Text]  
• Geyer, M., Yu, H., Mandic, R., Linnemann, T., Zheng, Y.-H., Fackler, O. T., Peterlin, B. M. (2002). Subunit H of the V-ATPase Binds to the Medium Chain of Adaptor Protein Complex 2 and Connects Nef to the Endocytic Machinery. J. Biol. Chem. 277: 28521-28529 [Abstract] [Full Text]