Although disease develops within 10 years in most persons infectedwith human immunodeficiency virus type 1 (HIV-1), some remainsymptom-free for prolonged periods.1,2 Most long-term asymptomaticsurvivors of HIV-1 infection still have evidence of diseaseprogression in the form of declining CD4+ lymphocyte concentrations.However, some rare persons not only are asymptomatic but alsomaintain stable levels of CD4+ lymphocytes in the normal ornear-normal range. Although the definition of nonprogressionmay vary, approximately 5 percent of seropositive persons haveshown no HIV-related disease or declines in CD4+ cell countsdespite 10 or more years of documented HIV-1 infection.2 Studyingpersons with long-term nonprogressive infection may help usto understand the mechanisms by which HIV-1 can be controlled.
Viral factors, host factors, or both may account for the absenceof progression, at least in some persons. Host factors may includethe inherent susceptibility of a person's cells to HIV-1 replication3or an HLA-determined ability to mount an adequate immune response.4,5Since most HIV-1 infections appear to result from only one ora few infectious viral particles,6,7 we reasoned that a partiallydefective or attenuated strain of HIV-1 may be all that is transmittedin some cases. We focused our initial studies on the HIV-1 auxiliarygene called nef. This gene is not required for viral replicationin cell culture, but nef is required in simian immunodeficiencyvirus (SIV) for the development of acquired immunodeficiencysyndrome (AIDS) in rhesus monkeys.8 The function of nef hasnot been clearly defined.
We amplified HIV-1 nef sequences from five patients with long-termnonprogressive HIV-1 infection. In one patient all 34 positivereactions from blood samples obtained over a decade yieldedonly defective forms of nef. The clinical and virologic characteristicsof the HIV-1 infection in this man are strikingly similar tothe characteristics of infection in rhesus monkeys with a strainof SIV missing nef. These results indicate that infection withattenuated forms of HIV-1 contributes to the absence of diseaseprogression in some persons. They also provide further justificationfor considering the use of HIV-1 mutants with deletions as liveattenuated vaccines.
Methods
DNA Analysis
We amplified HIV-1 DNA sequences spanning nef with the polymerasechain reaction (PCR), using nested primers as described elsewhere,9except that HIV-1specific primers were used. The oligonucleotidesused as primers were selected on the basis of their high levelof sequence homology with most HIV-1 isolates in the Los Alamosdata base.10 The first round of amplification involved primerscorresponding to nucleotides 8675 through 8698 and 9530 through9507 of NL4310 (5'GCAGTAGCTGAGGGGACAGATAGG3' and 5'CCAGTACAGGCAAAAAGCAGCTGC3').For the second round of amplification, 5 µl of the 100-µlreaction mixture was used with primers corresponding to nucleotides8748 through 8762 and 9451 through 9439 (5'GCACAGAATTCGAAGAATAAGACAGG3'and 5'CCAGGCGAATTCTCCCTGGAAAGTCCC3').
The sequences presented in this report have been submitted toGenBank (accession numbers U17438 to U17472).
Patients
Blood samples were obtained from patients followed by the NewEngland Area Comprehensive Hemophilia Center at the MedicalCenter of Central Massachusetts, Memorial Hospital, Worcester.This cohort has been monitored since 1983 as part of a prospectivestudy of immunoregulatory defects in hemophilia.11 All participantshave given informed consent. Most are seropositive for HIV-1and were infected before 1983 through infusions with contaminatedfactor VIII concentrates. Lymphocyte subgroups were countedduring 1991 and 1992 to determine whether there was diseaseprogression in patients followed since 1984 or earlier. Patientswere considered to have nonprogressive HIV-1 infection if theyremained asymptomatic without ever having received antiretroviraltherapy and if they had a CD4+ lymphocyte count of more than400 per cubic millimeter and more than 30 percent of total Tcells or a count of more than 600 per cubic millimeter irrespectiveof the percentage of CD4+ lymphocytes. Seven patients met thesecriteria. Patients were considered to have progressive infectionif they had a CD4+ lymphocyte count of less than 200 per cubicmillimeter and less than 20 percent of total T cells or of lessthan 100 per cubic millimeter irrespective of the percentageof CD4+ lymphocytes. Seventy-two patients met these criteria;patients who had died of HIV-related causes were also includedin this category. Forty patients who did not meet the criteriafor either of these categories were considered to have slowlyprogressive infection.
Case Report
Patient 1 is a 44-year-old man with severe hemophilia A. Hewas exposed to HIV-1 through infusion of contaminated factorVIII concentrates before 1983 and has been consistently HIV-1positiveon Western blotting since first being tested in 1983. He hasused recombinant factor VIII (Kogenate, Miles, West Haven, Conn.)twice a week since August 1988. The most recent physical examinationwas notable only for hemophilic arthropathy. Serologic testsare positive for hepatitis B surface antibody, cytomegalovirusantibodies, and hepatitis C antibodies. Aspartate aminotransferaseand alanine aminotransferase levels have been elevated intermittently,but other chemical and hematologic laboratory values have remainedunremarkable. Lymphocyte surface markers have been evaluatedannually. CD4+ lymphocyte counts have remained stable and areonly slightly below the mean values in the HIV-1seronegativemembers of this group of patients with hemophilia (Figure 1).
Figure 1. Mean (±SE) CD4+ Lymphocyte Counts in a Cohort of Patients with Hemophilia According to Their HIV-1 Status andRate of Disease Progression.
The CD4+ lymphocyte counts for Patient 1 are shown separately.
Results
DNA was prepared from peripheral-blood mononuclear cells (PBMC)obtained in 1993 from five of the patients with nonprogressiveHIV-1 infection, and sequences spanning the nef gene were amplifiedby PCR. Full-length nef sequences overwhelmingly predominatedin four of the five patients. All positive PCR amplifications(33 of 33) from these four patients yielded a full-length fragmentcorresponding to the wild-type strain by gel analysis, and 23of 26 DNA sequences from these 33 positive reactions had anintact nef open reading frame; 3 had deletions of a single basepair (bp) (data not shown). Others have previously shown thatfull-length nef genes predominate in HIV-1infected personswith evidence of disease progression.12,13 In contrast, onlyforms of nef with deletions were detected in PBMC obtained fromPatient 1 in 1993 (Figure 2 and Figure 3).
Figure 2. Analysis of nef Sequences in PBMC Obtained from Patient 1 in 1983, 1986, 1989, and 1993.
DNA fragments derived by PCR were separated by electrophoresis through 1.5 percent agarose gels. Lane 1 shows the PCR product of PBMC DNA from another patient with long-term nonprogressive HIV-1 infection, which was used as a control (C); lane 2 shows the size marker (M), a 1-kb ladder (GIBCO BRL); and lanes 3 through 17 show the products of individual PCR amplifications of DNA from PBMC obtained from Patient 1. The arrows indicate the position of the full-sized nef fragment.
Figure 3. Location of nef-Sequence Deletions in PBMC Obtained from Patient 1 in 1983, 1986, 1989, and 1993.
The nucleotide numbers refer to those of the NL43 clone of HIV-1.10 In the diagram the arrows indicate the locations of oligonucleotides used to amplify viral DNA. The asterisk indicates that one PCR produced two separate clones(F1 and F2) of different sizes.
Frozen PBMC that had been obtained from Patient 1 in 1983, 1986,and 1989 were used to prepare additional DNA samples for PCRamplification; 78 PCR amplifications were performed with PBMCobtained in 1983, 1986, 1989, and 1993. Despite the use of asensitive, nested PCR procedure,9 only 34 of 78 PCR amplificationsyielded viral DNA when 2.5 µg of PBMC DNA was used perreaction tube. This result suggests that Patient 1 has a verylow viral DNA burden. Measurement of HIV-1 gag DNA in PBMC bya different quantitative method14 indicated the presence ofapproximately 1 viral DNA copy per 100,000 PBMC. This levelwas 10 to 3500 times lower than the level in PBMC from fiveof six patients with progressive or slowly progressive HIV-1infection, which were evaluated by the same procedure aroundthe same time. All 34 of the positive PCR results from Patient1 yielded fragments shorter than that of full-length nef (Figure 2).
DNA sequences were derived from clones obtained from the 34positive PCR amplifications (Figure 3). A single DNA fragmentwas observed by gel analysis in 33 of the positive reactions,and a single clone from each of these was used for sequencing.One of the reactions with the sample obtained in 1986 yieldedtwo fragments (Figure 2), and single clones representing eachof the two sizes were used for sequencing (86F1 and 86F2 inFigure 3). A variety of deletions were observed among the differentclones (Figure 3). The predominant deletion was 118 bp in lengthand was located in the nef-unique portion from nucleotides 8887to 9004. This deletion removes a highly conserved acidic domainand a highly conserved (Pxx)4 motif and places downstream sequencesout of frame. Although a number of deletions were present inthe region of nef that overlaps U3 in the long terminal repeat,none of the deletions affected cis-acting sequences known tobe critical for viral replication specifically, thepolypurine tract, U3 terminal sequences, TATAA box, and NFBand Sp-1 binding sites (Figure 3). Long deletions in U3 seemedto accumulate over time in Patient 1 only after 1983 (Figure 3).
Attempts to recover HIV-1 from blood samples from Patient 1have been repeatedly unsuccessful. Isolation attempts have includedthe use of serial dilutions of PBMC, whole blood, and plasmaand bulk cultures of 5 million to 10 million PBMC cultivatedwith phytohemagglutinin-stimulated donor PBMC. Antigen-captureassays for p24 in plasma with immune-complex dissociation (CoulterImmunology, Hialeah, Fla.) have all been negative. Serum samplesobtained in 1985 and plasma samples obtained in 1994 were negativefor antibodies to HIV-1 nef protein by Western blotting at alldilutions tested (1:100 to 1:100,000); a pool of HIV-1positiveserum was positive for antibodies to nef protein in the sameassay to a dilution of 1:10,000. Serum from five other patientswith progressive HIV-1 infection was also examined, and allfive were found to have antibodies reactive to nef. Gag-specificcytotoxic T lymphocytes, measured by limiting dilution assaysas described previously,5 were present at frequencies of 69to 166 per million PBMC in freshly isolated, unstimulated samplesobtained from Patient 1 at three points between November 1991and March 1994. Env (IIIB)specific cytotoxic T lymphocyteshave also been demonstrated at similar levels. Cytotoxic T-lymphocyteprecursors specific for nef were not demonstrable in an assayin which gag and env cytotoxic T-lymphocyte precursors weremeasured at frequencies of approximately 300 per million PBMCwith nonspecific stimulation in vitro.5 The persistence of antibodiesand cytotoxic T-lymphocyte activity and the accumulation ofadditional deletions with time in the region of nef that overlapsU3 argue for the continued presence of replication-competentHIV-1, albeit at very low levels, in Patient 1.
Discussion
Rhesus monkeys inoculated with a derivative of the pathogenicSIVmac239 clone containing a 182-bp deletion in nef became infectedand persistently antibody-positive. However, they had extremelylow viral burdens, normal CD4+ lymphocyte concentrations, andno signs of disease progression.8,9,15 These characteristicsare strikingly similar to the course of infection in Patient1. In these monkeys, additional deletions accumulate over timein the region of nef that overlaps U3, without affecting thecritical cis-acting sequences.9 This is also remarkably similarto the pattern described for Patient 1 and illustrated in Figure 3.The nef sequences that overlap U3 are apparently not advantageousto the virus in the absence of an intact nef gene and are selectivelylost.
Most HIV-1positive persons with hemophilia became infectedin the early 1980s, before the advent of effective blood screening.Since Patient 1 was HIV-1positive when first tested in1983, we cannot be certain that he was infected initially withonly nef-defective HIV-1. However, the marked disadvantage ofSIV and HIV variants with nef mutations in vivo in animal modelsstrongly suggests that this is the case. Strains of SIV withmutated forms of nef are strongly selected against in infectedmonkeys.8 In addition, HIV-1 variants with mutations in nefare at a disadvantage as compared with the wild-type strainin mice with severe combined immunodeficiency that have beengiven human lymphoid cells16 and in experimentally infectedchimpanzees (unpublished data). At the very least, defectiveforms of nef with deletions have vastly predominated in Patient1 since 1983, and he has had no disease progression. It is possiblethat there are additional defects elsewhere in the HIV-1 genomein this patient that could contribute to the attenuated phenotype.Our observations should stimulate additional investigationsinto the extent to which infection with partially defectiveviruses may correlate with the absence of disease progression.
In this report, we describe a particular HIV-1gene defectassociated with the absence of disease progression in a singlepatient. Our results, and those of Huang et al.,17 suggest thatdeletions in nef may not be a common explanation for the absenceof progression and that different factors are likely to contributein other patients. Viral factors that could contribute includedifferent types of mutations in a wide variety of viral geneticelements. Viral and host factors cannot be dissociated fromeach other, since an effective immune response is an essentialfeature of nonprogression. Disease outcome is likely to be determinedby a delicate balance between the ability of the virus to replicateand the host's ability to mount an adequate immune response.
Rhesus monkeys infected with SIV with nef deletions are stronglyprotected against challenge with wild-type, pathogenic SIV,15and it has been suggested that derivatives of HIV-1 with multipledeletions should be considered for use as live attenuated vaccines.15,18,19Concern for safety is the key factor limiting further developmentof this promising approach. However, it should be rememberedthat disease progression is not an inevitable outcome of lentivirusinfections. African green monkeys and sooty mangabey monkeysharboring their own SIV remain infected apparently for life,but do not seem to have active disease. Strains of SIV fromthese species are certainly capable of causing disease, becausethey do so in other hosts. Similarly, chimpanzees infected withwild-type HIV-1 and macaques infected with mutant strains ofSIV remain infected but asymptomatic.8,20,21 The immunologicresponses of these species appear to be sufficient to controlthese lentiviral infections. By deleting portions of nef orother genetic elements, the balance of power may simply shiftin favor of the host's immune response. The finding of onlyHIV-1 variants with nef deletions in a healthy man with long-termnonprogressive HIV-1 infection provides additional impetus forconsideration of this vaccine approach.
Supported by grants from the Public Health Service (HL42257,AI26507, AI25328, and RR00168), a contract with the Public HealthService (HL67022), and a fellowship from the German Bundesministeriumfür Forschung und Technologie AIDS Program (to Dr. Kirchhoff).
We are indebted to K. Byron, D. Crognale, B. Blais, F. Brewster,and L. Lambrecht for technical assistance; to A. Forsberg andR. Shopnick for helping coordinate the collaboration; to PaulJohnson for helpful comments; and to Patient 1 for his interestand enthusiasm.
Source Information
From the New England Regional Primate Research Center, Harvard Medical School, Southborough, Mass. (F.K., R.C.D.); the Department of Pediatrics and Medicine, Program in Molecular Medicine, University of Massachusetts Medical School, Worcester (T.C.G., J.L.S.); and the Medical Center of Central Massachusetts, Memorial Hospital, Worcester (D.B.B.).
Address reprint requests to Dr. Desrosiers at the New England Regional Primate Research Center, Harvard Medical School, 1 Pine Hill Dr., Box 9102, Southborough, MA 01772-9102.
References
Rutherford GW, Lifson AR, Hessol NA, et al. Course of HIV-1 infection in a cohort of homosexual and bisexual men: an 11 year follow up study. BMJ 1990;301:1183-1188.
Buchbinder SP, Katz MH, Hessol NA, O'Malley PM, Holmberg SD. Long-term HIV-1 infection without immunologic progression. AIDS 1994;8:1123-1128. [Medline]
Williams LM, Cloyd MW. Polymorphic human gene(s) determines differential susceptibility of CD4 lymphocytes to infection by certain HIV-1 isolates. Virology 1991;184:723-728. [CrossRef][Medline]
Hill AVS, Elvin J, Willis AC, et al. Molecular analysis of the association of HLA-B53 and resistance to severe malaria. Nature 1992;360:434-439. [CrossRef][Medline]
Greenough TC, Somasundaran M, Brettler DB, et al. Normal immune function and inability to isolate virus in culture in an individual with long-term human immunodeficiency virus type 1 infection. AIDS Res Hum Retroviruses 1994;10:395-403. [Medline]
Zhang LQ, MacKenzie P, Cleland A, Holmes EC, Leigh Brown AJ, Simmonds P. Selection for specific sequences in the external envelope protein of human immunodeficiency virus type 1 upon primary infection. J Virol 1993;67:3345-3356. [Free Full Text]
Zhu T, Mo H, Wang N, et al. Genotypic and phenotypic characterization of HIV-1 in patients with primary infection. Science 1993;261:1179-1181.
Kestler HW III, Ringler DJ, Mori K, et al. Importance of the nef gene for maintenance of high virus loads and for development of AIDS. Cell 1991;65:651-662. [CrossRef][Medline]
Kirchhoff F, Kestler HW III, Desrosiers RC. Upstream U3 sequences in simian immunodeficiency virus are selectively deleted in vivo in the absence of an intact nef gene. J Virol 1994;68:2031-2037. [Free Full Text]
Myers G, Wain-Hobson S, Korber B, Smith RF, Pavlakis GN. Human retroviruses and AIDS 1993 III: a compilation and analysis of nucleic acid and amino acid sequences. Los Alamos, N.M.: Los Alamos National Laboratory, 1993.
Sullivan JL, Brewster FE, Brettler DB, et al. Hemophiliac immunodeficiency: influence of exposure to factor VIII concentrate, LAV/HTLV-III, and herpesviruses. J Pediatr 1986;108:504-510. [Erratum, J Pediatr 1986;109:1075.] [Medline]
Shugars DC, Smith MS, Glueck DH, Nantermet PV, Seillier-Moiseiwitsch F, Swanstrom R. Analysis of human immunodeficiency virus type 1 nef gene sequences present in vivo. J Virol 1993;67:4639-4650. [Free Full Text]
Blumberg BM, Epstein LG, Saito Y, Chen D, Sharer LR, Anand R. Human immunodeficiency virus type 1 nef quasispecies in pathological tissue. J Virol 1992;66:5256-5264. [Free Full Text]
Brettler DB, Somasundaran M, Forsberg AF, Krause E, Sullivan JL. Silent human immunodeficiency virus type 1 infection: a rare occurrence in a high-risk heterosexual population. Blood 1992;80:2396-2400. [Free Full Text]
Daniel MD, Kirchhoff F, Czajak SC, Sehgal PK, Desrosiers RC. Protective effects of a live attenuated SIV vaccine with a deletion in the nef gene. Science 1992;258:1938-1941. [Free Full Text]
Jamieson BD, Aldrovandi GM, Planelles V, et al. Requirement of HIV nef for in vivo replication and pathogenicity. J Virol 1994;68:3478-3485. [Free Full Text]
Huang Y, Zhang L, Ho DD. Characterization of nef sequences in long-term survivors of human immunodeficiency virus type 1 infection. J Virol 1995;69:93-100. [Abstract]
Desrosiers RC. HIV with multiple gene deletions as a live attenuated vaccine for AIDS. AIDS Res Hum Retroviruses 1992;8:411-421. [Medline]
World Health Organization Working Group. Feasibility of developing live attenuated HIV vaccines: conclusions and recommendations. AIDS Res Hum Retroviruses 1994;10:221-222. [Medline]
Johnson BK, Stone GA, Godec MS, Asher DM, Gajdusek DC, Gibbs CJ Jr. Long-term observations of human immunodeficiency virus-infected chimpanzees. AIDS Res Hum Retroviruses 1993;9:375-378. [Medline]
Eichberg JW, Zarling JM, Alter HJ, et al. T-cell responses to human immunodeficiency virus (HIV) and its recombinant antigens in HIV-infected chimpanzees. J Virol 1987;61:3804-3808. [Free Full Text]
Nou, E., Zhou, Y., Nou, D. D., Blankson, J. N.
(2009). Effective Downregulation of HLA-A*2 and HLA-B*57 by Primary Human Immunodeficiency Virus Type 1 Isolates Cultured from Elite Suppressors. J. Virol.
83: 6941-6946
[Abstract][Full Text]
daSilva, L. L. P., Sougrat, R., Burgos, P. V., Janvier, K., Mattera, R., Bonifacino, J. S.
(2009). Human Immunodeficiency Virus Type 1 Nef Protein Targets CD4 to the Multivesicular Body Pathway. J. Virol.
83: 6578-6590
[Abstract][Full Text]
Abraha, A., Nankya, I. L., Gibson, R., Demers, K., Tebit, D. M., Johnston, E., Katzenstein, D., Siddiqui, A., Herrera, C., Fischetti, L., Shattock, R. J., Arts, E. J.
(2009). CCR5- and CXCR4-Tropic Subtype C Human Immunodeficiency Virus Type 1 Isolates Have a Lower Level of Pathogenic Fitness than Other Dominant Group M Subtypes: Implications for the Epidemic. J. Virol.
83: 5592-5605
[Abstract][Full Text]
Wick, W. D., Gilbert, P. B., Yang, O. O.
(2009). Predicting the Impact of Blocking Human Immunodeficiency Virus Type 1 Nef In Vivo. J. Virol.
83: 2349-2356
[Abstract][Full Text]
Laguette, N., Benichou, S., Basmaciogullari, S.
(2009). Human Immunodeficiency Virus Type 1 Nef Incorporation into Virions Does Not Increase Infectivity. J. Virol.
83: 1093-1104
[Abstract][Full Text]
Hatano, H., Delwart, E. L., Norris, P. J., Lee, T.-H., Dunn-Williams, J., Hunt, P. W., Hoh, R., Stramer, S. L., Linnen, J. M., McCune, J. M., Martin, J. N., Busch, M. P., Deeks, S. G.
(2009). Evidence for Persistent Low-Level Viremia in Individuals Who Control Human Immunodeficiency Virus in the Absence of Antiretroviral Therapy. J. Virol.
83: 329-335
[Abstract][Full Text]
Witte, V., Laffert, B., Gintschel, P., Krautkramer, E., Blume, K., Fackler, O. T., Baur, A. S.
(2008). Induction of HIV Transcription by Nef Involves Lck Activation and Protein Kinase C{theta} Raft Recruitment Leading to Activation of ERK1/2 but Not NF{kappa}B. J. Immunol.
181: 8425-8432
[Abstract][Full Text]
Muthumani, K., Choo, A. Y., Shedlock, D. J., Laddy, D. J., Sundaram, S. G., Hirao, L., Wu, L., Thieu, K. P., Chung, C. W., Lankaraman, K. M., Tebas, P., Silvestri, G., Weiner, D. B.
(2008). Human Immunodeficiency Virus Type 1 Nef Induces Programmed Death 1 Expression through a p38 Mitogen-Activated Protein Kinase-Dependent Mechanism. J. Virol.
82: 11536-11544
[Abstract][Full Text]
Pizzato, M., Popova, E., Gottlinger, H. G.
(2008). Nef Can Enhance the Infectivity of Receptor-Pseudotyped Human Immunodeficiency Virus Type 1 Particles. J. Virol.
82: 10811-10819
[Abstract][Full Text]
Miura, T., Brockman, M. A., Brumme, C. J., Brumme, Z. L., Carlson, J. M., Pereyra, F., Trocha, A., Addo, M. M., Block, B. L., Rothchild, A. C., Baker, B. M., Flynn, T., Schneidewind, A., Li, B., Wang, Y. E., Heckerman, D., Allen, T. M., Walker, B. D.
(2008). Genetic Characterization of Human Immunodeficiency Virus Type 1 in Elite Controllers: Lack of Gross Genetic Defects or Common Amino Acid Changes. J. Virol.
82: 8422-8430
[Abstract][Full Text]
Bailey, J. R., O'Connell, K., Yang, H.-C., Han, Y., Xu, J., Jilek, B., Williams, T. M., Ray, S. C., Siliciano, R. F., Blankson, J. N.
(2008). Transmission of Human Immunodeficiency Virus Type 1 from a Patient Who Developed AIDS to an Elite Suppressor. J. Virol.
82: 7395-7410
[Abstract][Full Text]
Jin, Y.-J., Cai, C. Y., Zhang, X., Burakoff, S. J.
(2008). Lysine 144, a Ubiquitin Attachment Site in HIV-1 Nef, Is Required for Nef-Mediated CD4 Down-Regulation. J. Immunol.
180: 7878-7886
[Abstract][Full Text]
Lu, T.-c., He, J. C., Wang, Z.-h., Feng, X., Fukumi-Tominaga, T., Chen, N., Xu, J., Iyengar, R., Klotman, P. E.
(2008). HIV-1 Nef Disrupts the Podocyte Actin Cytoskeleton by Interacting with Diaphanous Interacting Protein. J. Biol. Chem.
283: 8173-8182
[Abstract][Full Text]
Rauch, S., Pulkkinen, K., Saksela, K., Fackler, O. T.
(2008). Human Immunodeficiency Virus Type 1 Nef Recruits the Guanine Exchange Factor Vav1 via an Unexpected Interface into Plasma Membrane Microdomains for Association with p21-Activated Kinase 2 Activity. J. Virol.
82: 2918-2929
[Abstract][Full Text]
Lewis, M. J., Balamurugan, A., Ohno, A., Kilpatrick, S., Ng, H. L., Yang, O. O.
(2008). Functional Adaptation of Nef to the Immune Milieu of HIV-1 Infection In Vivo. J. Immunol.
180: 4075-4081
[Abstract][Full Text]
Hoffmann, D., Seebach, J., Cosma, A., Goebel, F. D., Strimmer, K., Schatzl, H. M., Erfle, V.
(2008). Therapeutic vaccination reduces HIV sequence variability. FASEB J.
22: 437-444
[Abstract][Full Text]
Ueno, T., Motozono, C., Dohki, S., Mwimanzi, P., Rauch, S., Fackler, O. T., Oka, S., Takiguchi, M.
(2008). CTL-Mediated Selective Pressure Influences Dynamic Evolution and Pathogenic Functions of HIV-1 Nef. J. Immunol.
180: 1107-1116
[Abstract][Full Text]
Hiyoshi, M., Suzu, S., Yoshidomi, Y., Hassan, R., Harada, H., Sakashita, N., Akari, H., Motoyoshi, K., Okada, S.
(2008). Interaction between Hck and HIV-1 Nef negatively regulates cell surface expression of M-CSF receptor. Blood
111: 243-250
[Abstract][Full Text]
Potter, S. J., Lacabaratz, C., Lambotte, O., Perez-Patrigeon, S., Vingert, B., Sinet, M., Colle, J.-H., Urrutia, A., Scott-Algara, D., Boufassa, F., Delfraissy, J.-F., Theze, J., Venet, A., Chakrabarti, L. A.
(2007). Preserved Central Memory and Activated Effector Memory CD4+ T-Cell Subsets in Human Immunodeficiency Virus Controllers: an ANRS EP36 Study. J. Virol.
81: 13904-13915
[Abstract][Full Text]
Munch, J., Rajan, D., Schindler, M., Specht, A., Rucker, E., Novembre, F. J., Nerrienet, E., Muller-Trutwin, M. C., Peeters, M., Hahn, B. H., Kirchhoff, F.
(2007). Nef-Mediated Enhancement of Virion Infectivity and Stimulation of Viral Replication Are Fundamental Properties of Primate Lentiviruses. J. Virol.
81: 13852-13864
[Abstract][Full Text]
Schindler, M., Rajan, D., Specht, A., Ritter, C., Pulkkinen, K., Saksela, K., Kirchhoff, F.
(2007). Association of Nef with p21-Activated Kinase 2 Is Dispensable for Efficient Human Immunodeficiency Virus Type 1 Replication and Cytopathicity in Ex Vivo-Infected Human Lymphoid Tissue. J. Virol.
81: 13005-13014
[Abstract][Full Text]
Giolo, G., Neri, F., Casartelli, N., Potesta, M., Belleudi, F., Torrisi, M. R., Doria, M.
(2007). Internalization and intracellular retention of CD4 are two separate functions of the human immunodeficiency virus type 1 Nef protein. J. Gen. Virol.
88: 3133-3138
[Abstract][Full Text]
Sacha, J. B., Chung, C., Reed, J., Jonas, A. K., Bean, A. T., Spencer, S. P., Lee, W., Vojnov, L., Rudersdorf, R., Friedrich, T. C., Wilson, N. A., Lifson, J. D., Watkins, D. I.
(2007). Pol-Specific CD8+ T Cells Recognize Simian Immunodeficiency Virus-Infected Cells Prior to Nef-Mediated Major Histocompatibility Complex Class I Downregulation. J. Virol.
81: 11703-11712
[Abstract][Full Text]
Das, A. T., Klaver, B., Harwig, A., Vink, M., Ooms, M., Centlivre, M., Berkhout, B.
(2007). Construction of a Doxycycline-Dependent Simian Immunodeficiency Virus Reveals a Nontranscriptional Function of Tat in Viral Replication. J. Virol.
81: 11159-11169
[Abstract][Full Text]
Priceputu, E., Hanna, Z., Hu, C., Simard, M.-C., Vincent, P., Wildum, S., Schindler, M., Kirchhoff, F., Jolicoeur, P.
(2007). Primary Human Immunodeficiency Virus Type 1 Nef Alleles Show Major Differences in Pathogenicity in Transgenic Mice. J. Virol.
81: 4677-4693
[Abstract][Full Text]
Koenen, P. G. F., Hofhuis, F. M., Oosterwegel, M. A., Tesselaar, K.
(2007). T Cell Activation and Proliferation Characteristic for HIV-Nef Transgenic Mice Is Lymphopenia Induced. J. Immunol.
178: 5762-5768
[Abstract][Full Text]
Chaudhuri, R., Lindwasser, O. W., Smith, W. J., Hurley, J. H., Bonifacino, J. S.
(2007). Downregulation of CD4 by Human Immunodeficiency Virus Type 1 Nef Is Dependent on Clathrin and Involves Direct Interaction of Nef with the AP2 Clathrin Adaptor. J. Virol.
81: 3877-3890
[Abstract][Full Text]
Mangino, G., Percario, Z. A., Fiorucci, G., Vaccari, G., Manrique, S., Romeo, G., Federico, M., Geyer, M., Affabris, E.
(2007). In Vitro Treatment of Human Monocytes/Macrophages with Myristoylated Recombinant Nef of Human Immunodeficiency Virus Type 1 Leads to the Activation of Mitogen-Activated Protein Kinases, I{kappa}B Kinases, and Interferon Regulatory Factor 3 and to the Release of Beta Interferon. J. Virol.
81: 2777-2791
[Abstract][Full Text]
Blankson, J. N., Bailey, J. R., Thayil, S., Yang, H.-C., Lassen, K., Lai, J., Gandhi, S. K., Siliciano, J. D., Williams, T. M., Siliciano, R. F.
(2007). Isolation and Characterization of Replication-Competent Human Immunodeficiency Virus Type 1 from a Subset of Elite Suppressors. J. Virol.
81: 2508-2518
[Abstract][Full Text]
Wang, J.-H., Janas, A. M., Olson, W. J., KewalRamani, V. N., Wu, L.
(2007). CD4 Coexpression Regulates DC-SIGN-Mediated Transmission of Human Immunodeficiency Virus Type 1. J. Virol.
81: 2497-2507
[Abstract][Full Text]
Cerboni, C., Neri, F., Casartelli, N., Zingoni, A., Cosman, D., Rossi, P., Santoni, A., Doria, M.
(2007). Human immunodeficiency virus 1 Nef protein downmodulates the ligands of the activating receptor NKG2D and inhibits natural killer cell-mediated cytotoxicity. J. Gen. Virol.
88: 242-250
[Abstract][Full Text]
Calugi, G., Montella, F., Favalli, C., Benedetto, A.
(2006). Entire Genome of a Strain of Human Immunodeficiency Virus Type 1 with a Deletion of nef That Was Recovered 20 Years after Primary Infection: Large Pool of Proviruses with Deletions of env. J. Virol.
80: 11892-11896
[Abstract][Full Text]
Venzke, S., Michel, N., Allespach, I., Fackler, O. T., Keppler, O. T.
(2006). Expression of Nef Downregulates CXCR4, the Major Coreceptor of Human Immunodeficiency Virus, from the Surfaces of Target Cells and Thereby Enhances Resistance to Superinfection. J. Virol.
80: 11141-11152
[Abstract][Full Text]
Crotti, A., Neri, F., Corti, D., Ghezzi, S., Heltai, S., Baur, A., Poli, G., Santagostino, E., Vicenzi, E.
(2006). Nef Alleles from Human Immunodeficiency Virus Type 1-Infected Long-Term-Nonprogressor Hemophiliacs with or without Late Disease Progression Are Defective in Enhancing Virus Replication and CD4 Down-Regulation. J. Virol.
80: 10663-10674
[Abstract][Full Text]
Trible, R. P., Emert-Sedlak, L., Smithgall, T. E.
(2006). HIV-1 Nef Selectively Activates Src Family Kinases Hck, Lyn, and c-Src through Direct SH3 Domain Interaction. J. Biol. Chem.
281: 27029-27038
[Abstract][Full Text]
O'Neill, E., Baugh, L. L., Novitsky, V. A., Essex, M. E., Garcia, J. V.
(2006). Intra- and intersubtype alternative pak2-activating structural motifs of human immunodeficiency virus type 1 nef.. J. Virol.
80: 8824-8829
[Abstract][Full Text]
Marecki, J. C., Cool, C. D., Parr, J. E., Beckey, V. E., Luciw, P. A., Tarantal, A. F., Carville, A., Shannon, R. P., Cota-Gomez, A., Tuder, R. M., Voelkel, N. F., Flores, S. C.
(2006). HIV-1 Nef Is Associated with Complex Pulmonary Vascular Lesions in SHIV-nef-infected Macaques. Am. J. Respir. Crit. Care Med.
174: 437-445
[Abstract][Full Text]
Casartelli, N., Giolo, G., Neri, F., Haller, C., Potesta, M., Rossi, P., Fackler, O. T., Doria, M.
(2006). The Pro78 residue regulates the capacity of the human immunodeficiency virus type 1 Nef protein to inhibit recycling of major histocompatibility complex class I molecules in an SH3-independent manner.. J. Gen. Virol.
87: 2291-2296
[Abstract][Full Text]
Haller, C., Rauch, S., Michel, N., Hannemann, S., Lehmann, M. J., Keppler, O. T., Fackler, O. T.
(2006). The HIV-1 Pathogenicity Factor Nef Interferes with Maturation of Stimulatory T-lymphocyte Contacts by Modulation of N-Wasp Activity. J. Biol. Chem.
281: 19618-19630
[Abstract][Full Text]
Bailey, J. R., Williams, T. M., Siliciano, R. F., Blankson, J. N.
(2006). Maintenance of viral suppression in HIV-1-infected HLA-B*57+ elite suppressors despite CTL escape mutations. JEM
203: 1357-1369
[Abstract][Full Text]
Brenner, M., Munch, J., Schindler, M., Wildum, S., Stolte, N., Stahl-Hennig, C., Fuchs, D., Matz-Rensing, K., Franz, M., Heeney, J., Ten Haaft, P., Swigut, T., Hrecka, K., Skowronski, J., Kirchhoff, F.
(2006). Importance of the N-Distal AP-2 Binding Element in Nef for Simian Immunodeficiency Virus Replication and Pathogenicity in Rhesus Macaques. J. Virol.
80: 4469-4481
[Abstract][Full Text]
Vincent, P., Priceputu, E., Kay, D., Saksela, K., Jolicoeur, P., Hanna, Z.
(2006). Activation of p21-activated Kinase 2 and Its Association with Nef Are Conserved in Murine Cells but Are Not Sufficient to Induce an AIDS-like Disease in CD4C/HIV Transgenic Mice. J. Biol. Chem.
281: 6940-6954
[Abstract][Full Text]
Agopian, K., Wei, B. L., Garcia, J. V., Gabuzda, D.
(2006). A Hydrophobic Binding Surface on the Human Immunodeficiency Virus Type 1 Nef Core Is Critical for Association with p21-Activated Kinase 2. J. Virol.
80: 3050-3061
[Abstract][Full Text]
Keppler, O. T., Tibroni, N., Venzke, S., Rauch, S., Fackler, O. T.
(2006). Modulation of specific surface receptors and activation sensitization in primary resting CD4+ T lymphocytes by the Nef protein of HIV-1. J. Leukoc. Biol.
79: 616-627
[Abstract][Full Text]
Churchill, M. J., Rhodes, D. I., Learmont, J. C., Sullivan, J. S., Wesselingh, S. L., Cooke, I. R. C., Deacon, N. J., Gorry, P. R.
(2006). Longitudinal Analysis of Human Immunodeficiency Virus Type 1 nef/Long Terminal Repeat Sequences in a Cohort of Long-Term Survivors Infected from a Single Source. J. Virol.
80: 1047-1052
[Abstract][Full Text]
Kim, M.-O., Suh, H.-S., Si, Q., Terman, B. I., Lee, S. C.
(2006). Anti-CD45RO Suppresses Human Immunodeficiency Virus Type 1 Replication in Microglia: Role of Hck Tyrosine Kinase and Implications for AIDS Dementia. J. Virol.
80: 62-72
[Abstract][Full Text]
Raney, A., Kuo, L. S., Baugh, L. L., Foster, J. L., Garcia, J. V.
(2005). Reconstitution and Molecular Analysis of an Active Human Immunodeficiency Virus Type 1 Nef/p21-Activated Kinase 2 Complex. J. Virol.
79: 12732-12741
[Abstract][Full Text]
Brown, A., Gartner, S., Kawano, T., Benoit, N., Cheng-Mayer, C.
(2005). HLA-A2 down-regulation on primary human macrophages infected with an M-tropic EGFP-tagged HIV-1 reporter virus. J. Leukoc. Biol.
78: 675-685
[Abstract][Full Text]
Hrecka, K., Swigut, T., Schindler, M., Kirchhoff, F., Skowronski, J.
(2005). Nef Proteins from Diverse Groups of Primate Lentiviruses Downmodulate CXCR4 To Inhibit Migration to the Chemokine Stromal Derived Factor 1. J. Virol.
79: 10650-10659
[Abstract][Full Text]
Troyer, R. M., Collins, K. R., Abraha, A., Fraundorf, E., Moore, D. M., Krizan, R. W., Toossi, Z., Colebunders, R. L., Jensen, M. A., Mullins, J. I., Vanham, G., Arts, E. J.
(2005). Changes in Human Immunodeficiency Virus Type 1 Fitness and Genetic Diversity during Disease Progression. J. Virol.
79: 9006-9018
[Abstract][Full Text]
Cluet, D., Bertsch, C., Beyer, C., Gloeckler, L., Erhardt, M., Gut, J.-P., Galzi, J.-L., Aubertin, A.-M.
(2005). Detection of Human Immunodeficiency Virus Type 1 Nef and CD4 Physical Interaction in Living Human Cells by Using Bioluminescence Resonance Energy Transfer. J. Virol.
79: 8629-8636
[Abstract][Full Text]
Schindler, M., Munch, J., Kirchhoff, F.
(2005). Human Immunodeficiency Virus Type 1 Inhibits DNA Damage-Triggered Apoptosis by a Nef-Independent Mechanism. J. Virol.
79: 5489-5498
[Abstract][Full Text]
Lee, S. B., Park, J., Jung, J. U., Chung, J.
(2005). Nef induces apoptosis by activating JNK signaling pathway and inhibits NF-{kappa}B-dependent immune responses in Drosophila. J. Cell Sci.
118: 1851-1859
[Abstract][Full Text]
Suzu, S., Harada, H., Matsumoto, T., Okada, S.
(2005). HIV-1 Nef interferes with M-CSF receptor signaling through Hck activation and inhibits M-CSF bioactivities. Blood
105: 3230-3237
[Abstract][Full Text]
Omoto, S., Fujii, Y. R.
(2005). Regulation of human immunodeficiency virus 1 transcription by nef microRNA. J. Gen. Virol.
86: 751-755
[Abstract][Full Text]
Keppler, O. T., Allespach, I., Schuller, L., Fenard, D., Greene, W. C., Fackler, O. T.
(2005). Rodent Cells Support Key Functions of the Human Immunodeficiency Virus Type 1 Pathogenicity Factor Nef. J. Virol.
79: 1655-1665
[Abstract][Full Text]
Choi, J., Walker, J., Boichuk, S., Kirkiles-Smith, N., Torpey, N., Pober, J. S., Alexander, L.
(2005). Human Endothelial Cells Enhance Human Immunodeficiency Virus Type 1 Replication in CD4+ T Cells in a Nef-Dependent Manner In Vitro and In Vivo. J. Virol.
79: 264-276
[Abstract][Full Text]
Choudhary, S. K., Choudhary, N. R., Kimbrell, K. C., Colasanti, J., Ziogas, A., Kwa, D., Schuitemaker, H., Camerini, D.
(2005). R5 Human Immunodeficiency Virus Type 1 Infection of Fetal Thymic Organ Culture Induces Cytokine and CCR5 Expression. J. Virol.
79: 458-471
[Abstract][Full Text]
Choi, H.-J., Smithgall, T. E.
(2004). HIV-1 Nef Promotes Survival of TF-1 Macrophages by Inducing Bcl-XL Expression in an Extracellular Signal-regulated Kinase-dependent Manner. J. Biol. Chem.
279: 51688-51696
[Abstract][Full Text]
Pulkkinen, K., Renkema, G. H., Kirchhoff, F., Saksela, K.
(2004). Nef Associates with p21-Activated Kinase 2 in a p21-GTPase-Dependent Dynamic Activation Complex within Lipid Rafts. J. Virol.
78: 12773-12780
[Abstract][Full Text]
Swigut, T., Alexander, L., Morgan, J., Lifson, J., Mansfield, K. G., Lang, S., Johnson, R. P., Skowronski, J., Desrosiers, R.
(2004). Impact of Nef-Mediated Downregulation of Major Histocompatibility Complex Class I on Immune Response to Simian Immunodeficiency Virus. J. Virol.
78: 13335-13344
[Abstract][Full Text]
Rucker, E., Grivel, J.-C., Munch, J., Kirchhoff, F., Margolis, L.
(2004). Vpr and Vpu Are Important for Efficient Human Immunodeficiency Virus Type 1 Replication and CD4+ T-Cell Depletion in Human Lymphoid Tissue Ex Vivo. J. Virol.
78: 12689-12693
[Abstract][Full Text]
Jin, Y.-J., Zhang, X., Boursiquot, J. G., Burakoff, S. J.
(2004). CD4 Phosphorylation Partially Reverses Nef Down-Regulation of CD4. J. Immunol.
173: 5495-5500
[Abstract][Full Text]
Huang, M.-B., Jin, L. L., James, C. O., Khan, M., Powell, M. D., Bond, V. C.
(2004). Characterization of Nef-CXCR4 Interactions Important for Apoptosis Induction. J. Virol.
78: 11084-11096
[Abstract][Full Text]
Schindler, M., Munch, J., Brenner, M., Stahl-Hennig, C., Skowronski, J., Kirchhoff, F.
(2004). Comprehensive Analysis of Nef Functions Selected in Simian Immunodeficiency Virus-Infected Macaques. J. Virol.
78: 10588-10597
[Abstract][Full Text]
Olszewski, A., Sato, K., Aron, Z. D., Cohen, F., Harris, A., McDougall, B. R., Robinson, W. E. Jr., Overman, L. E., Weiss, G. A.
(2004). Guanidine alkaloid analogs as inhibitors of HIV-1 Nef interactions with p53, actin, and p56lck. Proc. Natl. Acad. Sci. USA
101: 14079-14084
[Abstract][Full Text]
Kirchhoff, F., Schindler, M., Bailer, N., Renkema, G. H., Saksela, K., Knoop, V., Muller-Trutwin, M. C., Santiago, M. L., Bibollet-Ruche, F., Dittmar, M. T., Heeney, J. L., Hahn, B. H., Munch, J.
(2004). Nef Proteins from Simian Immunodeficiency Virus-Infected Chimpanzees Interact with p21-Activated Kinase 2 and Modulate Cell Surface Expression of Various Human Receptors. J. Virol.
78: 6864-6874
[Abstract][Full Text]
Lundquist, C. A., Zhou, J., Aiken, C.
(2004). Nef Stimulates Human Immunodeficiency Virus Type 1 Replication in Primary T Cells by Enhancing Virion-Associated gp120 Levels: Coreceptor-Dependent Requirement for Nef in Viral Replication. J. Virol.
78: 6287-6296
[Abstract][Full Text]
Na, Y.-S., Yoon, K., Nam, J.-G., Choi, B., Lee, J.-S., Kato, I., Kim, S.
(2004). Nef from a primary isolate of human immunodeficiency virus type 1 lacking the EE155 region shows decreased ability to down-regulate CD4. J. Gen. Virol.
85: 1451-1461
[Abstract][Full Text]
Brown, A., Moghaddam, S., Kawano, T., Cheng-Mayer, C.
(2004). Multiple human immunodeficiency virus type 1 Nef functions contribute to efficient replication in primary human macrophages. J. Gen. Virol.
85: 1463-1469
[Abstract][Full Text]
Weng, X., Priceputu, E., Chrobak, P., Poudrier, J., Kay, D. G., Hanna, Z., Mak, T. W., Jolicoeur, P.
(2004). CD4+ T Cells from CD4C/HIVNef Transgenic Mice Show Enhanced Activation In Vivo with Impaired Proliferation In Vitro but Are Dispensable for the Development of a Severe AIDS-Like Organ Disease. J. Virol.
78: 5244-5257
[Abstract][Full Text]
Costa, L. J., Zheng, Y.-H., Sabotic, J., Mak, J., Fackler, O. T., Peterlin, B. M.
(2004). Nef Binds p6* in GagPol during Replication of Human Immunodeficiency Virus Type 1. J. Virol.
78: 5311-5323
[Abstract][Full Text]
Huthoff, H., Das, A. T., Vink, M., Klaver, B., Zorgdrager, F., Cornelissen, M., Berkhout, B.
(2004). A Human Immunodeficiency Virus Type 1-Infected Individual with Low Viral Load Harbors a Virus Variant That Exhibits an In Vitro RNA Dimerization Defect. J. Virol.
78: 4907-4913
[Abstract][Full Text]
Krautkramer, E., Giese, S. I., Gasteier, J. E., Muranyi, W., Fackler, O. T.
(2004). Human Immunodeficiency Virus Type 1 Nef Activates p21-Activated Kinase via Recruitment into Lipid Rafts. J. Virol.
78: 4085-4097
[Abstract][Full Text]
Casartelli, N., Di Matteo, G., Potesta, M., Rossi, P., Doria, M.
(2003). CD4 and Major Histocompatibility Complex Class I Downregulation by the Human Immunodeficiency Virus Type 1 Nef Protein in Pediatric AIDS Progression. J. Virol.
77: 11536-11545
[Abstract][Full Text]
Stove, V., Naessens, E., Stove, C., Swigut, T., Plum, J., Verhasselt, B.
(2003). Signaling but not trafficking function of HIV-1 protein Nef is essential for Nef-induced defects in human intrathymic T-cell development. Blood
102: 2925-2932
[Abstract][Full Text]
Schindler, M., Wurfl, S., Benaroch, P., Greenough, T. C., Daniels, R., Easterbrook, P., Brenner, M., Munch, J., Kirchhoff, F.
(2003). Down-Modulation of Mature Major Histocompatibility Complex Class II and Up-Regulation of Invariant Chain Cell Surface Expression Are Well-Conserved Functions of Human and Simian Immunodeficiency Virus nef Alleles. J. Virol.
77: 10548-10556
[Abstract][Full Text]
Tobiume, M., Lineberger, J. E., Lundquist, C. A., Miller, M. D., Aiken, C.
(2003). Nef Does Not Affect the Efficiency of Human Immunodeficiency Virus Type 1 Fusion with Target Cells. J. Virol.
77: 10645-10650
[Abstract][Full Text]
Gould, S. J., Booth, A. M., Hildreth, J. E. K.
(2003). The Trojan exosome hypothesis. Proc. Natl. Acad. Sci. USA
100: 10592-10597
[Abstract][Full Text]
Arganaraz, E. R., Schindler, M., Kirchhoff, F., Cortes, M. J., Lama, J.
(2003). Enhanced CD4 Down-modulation by Late Stage HIV-1 nef Alleles Is Associated with Increased Env Incorporation and Viral Replication. J. Biol. Chem.
278: 33912-33919
[Abstract][Full Text]
Rangel, H. R., Weber, J., Chakraborty, B., Gutierrez, A., Marotta, M. L., Mirza, M., Kiser, P., Martinez, M. A., Este, J. A., Quinones-Mateu, M. E.
(2003). Role of the Human Immunodeficiency Virus Type 1 Envelope Gene in Viral Fitness. J. Virol.
77: 9069-9073
[Abstract][Full Text]
Alexander, L., Illyinskii, P. O., Lang, S. M., Means, R. E., Lifson, J., Mansfield, K., Desrosiers, R. C.
(2003). Determinants of Increased Replicative Capacity of Serially Passaged Simian Immunodeficiency Virus with nef Deleted in Rhesus Monkeys. J. Virol.
77: 6823-6835
[Abstract][Full Text]
Sugimoto, C., Tadakuma, K., Otani, I., Moritoyo, T., Akari, H., Ono, F., Yoshikawa, Y., Sata, T., Izumo, S., Mori, K.
(2003). nef Gene Is Required for Robust Productive Infection by Simian Immunodeficiency Virus of T-Cell-Rich Paracortex in Lymph Nodes. J. Virol.
77: 4169-4180
[Abstract][Full Text]
Forshey, B. M., Aiken, C.
(2003). Disassembly of Human Immunodeficiency Virus Type 1 Cores In Vitro Reveals Association of Nef with the Subviral Ribonucleoprotein Complex. J. Virol.
77: 4409-4414
[Abstract][Full Text]
Olivetta, E., Percario, Z., Fiorucci, G., Mattia, G., Schiavoni, I., Dennis, C., Jager, J., Harris, M., Romeo, G., Affabris, E., Federico, M.
(2003). HIV-1 Nef Induces the Release of Inflammatory Factors from Human Monocyte/Macrophages: Involvement of Nef Endocytotic Signals and NF-{kappa}B Activation. J. Immunol.
170: 1716-1727
[Abstract][Full Text]
Stoddart, C. A., Geleziunas, R., Ferrell, S., Linquist-Stepps, V., Moreno, M. E., Bare, C., Xu, W., Yonemoto, W., Bresnahan, P. A., McCune, J. M., Greene, W. C.
(2003). Human Immunodeficiency Virus Type 1 Nef-Mediated Downregulation of CD4 Correlates with Nef Enhancement of Viral Pathogenesis. J. Virol.
77: 2124-2133
[Abstract][Full Text]
Ball, S. C., Abraha, A., Collins, K. R., Marozsan, A. J., Baird, H., Quinones-Mateu, M. E., Penn-Nicholson, A., Murray, M., Richard, N., Lobritz, M., Zimmerman, P. A., Kawamura, T., Blauvelt, A., Arts, E. J.
(2002). Comparing the Ex Vivo Fitness of CCR5-Tropic Human Immunodeficiency Virus Type 1 Isolates of Subtypes B and C. J. Virol.
77: 1021-1038
[Abstract][Full Text]
Voss, G., Manson, K., Montefiori, D., Watkins, D. I., Heeney, J., Wyand, M., Cohen, J., Bruck, C.
(2002). Prevention of Disease Induced by a Partially Heterologous AIDS Virus in Rhesus Monkeys by Using an Adjuvanted Multicomponent Protein Vaccine. J. Virol.
77: 1049-1058
[Abstract][Full Text]
Chakrabarti, L. A., Metzner, K. J., Ivanovic, T., Cheng, H., Louis-Virelizier, J., Connor, R. I., Cheng-Mayer, C.
(2002). A Truncated Form of Nef Selected during Pathogenic Reversion of Simian Immunodeficiency Virus SIVmac239{Delta}nef Increases Viral Replication. J. Virol.
77: 1245-1256
[Abstract][Full Text]
Johnson, W. E., Lifson, J. D., Lang, S. M., Johnson, R. P., Desrosiers, R. C.
(2002). Importance of B-Cell Responses for Immunological Control of Variant Strains of Simian Immunodeficiency Virus. J. Virol.
77: 375-381
[Abstract][Full Text]
Munch, J., Janardhan, A., Stolte, N., Stahl-Hennig, C., ten Haaft, P., Heeney, J. L., Swigut, T., Kirchhoff, F., Skowronski, J.
(2002). T-Cell Receptor:CD3 Down-Regulation Is a Selected In Vivo Function of Simian Immunodeficiency Virus Nef but Is Not Sufficient for Effective Viral Replication in Rhesus Macaques. J. Virol.
76: 12360-12364
[Abstract][Full Text]
Vilhardt, F., Plastre, O., Sawada, M., Suzuki, K., Wiznerowicz, M., Kiyokawa, E., Trono, D., Krause, K.-H.
(2002). The HIV-1 Nef Protein and Phagocyte NADPH Oxidase Activation. J. Biol. Chem.
277: 42136-42143
[Abstract][Full Text]
Alexander, L., Aquino-DeJesus, M. J., Chan, M., Andiman, W. A.
(2002). Inhibition of Human Immunodeficiency Virus Type 1 (HIV-1) Replication by a Two-Amino-Acid Insertion in HIV-1 Vif from a Nonprogressing Mother and Child. J. Virol.
76: 10533-10539
[Abstract][Full Text]
Ignatius, R., Tenner-Racz, K., Messmer, D., Gettie, A., Blanchard, J., Luckay, A., Russo, C., Smith, S., Marx, P. A., Steinman, R. M., Racz, P., Pope, M.
(2002). Increased Macrophage Infection upon Subcutaneous Inoculation of Rhesus Macaques with Simian Immunodeficiency Virus-Loaded Dendritic Cells or T Cells but Not with Cell-Free Virus. J. Virol.
76: 9787-9797
[Abstract][Full Text]
Geyer, M., Yu, H., Mandic, R., Linnemann, T., Zheng, Y.-H., Fackler, O. T., Peterlin, B. M.
(2002). Subunit H of the V-ATPase Binds to the Medium Chain of Adaptor Protein Complex 2 and Connects Nef to the Endocytic Machinery. J. Biol. Chem.
277: 28521-28529
[Abstract][Full Text]
Papkalla, A., Munch, J., Otto, C., Kirchhoff, F.
(2002). Nef Enhances Human Immunodeficiency Virus Type 1 Infectivity and Replication Independently of Viral Coreceptor Tropism. J. Virol.
76: 8455-8459
[Abstract][Full Text]
Somasundaran, M., Sharkey, M., Brichacek, B., Luzuriaga, K., Emerman, M., Sullivan, J. L., Stevenson, M.
(2002). Evidence for a cytopathogenicity determinant in HIV-1 Vpr. Proc. Natl. Acad. Sci. USA
99: 9503-9508
[Abstract][Full Text]
Kay, D. G., Yue, P., Hanna, Z., Jothy, S., Tremblay, E., Jolicoeur, P.
(2002). Cardiac Disease in Transgenic Mice Expressing Human Immunodeficiency Virus-1 Nef in Cells of the Immune System. Am. J. Pathol.
161: 321-335
[Abstract][Full Text]
Jekle, A., Schramm, B., Jayakumar, P., Trautner, V., Schols, D., De Clercq, E., Mills, J., Crowe, S. M., Goldsmith, M. A.
(2002). Coreceptor Phenotype of Natural Human Immunodeficiency Virus with Nef Deleted Evolves In Vivo, Leading to Increased Virulence. J. Virol.
76: 6966-6973
[Abstract][Full Text]