FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 332:419-423 February 16, 1995 Number 7 Next

Abstract PDF Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

ABSTRACT

Background Bartonella (Rochalimaea) quintana is the agent of trench fever and is transmitted by the body louse. We searched for this organism in three alcoholic homeless men with endocarditis.

Methods Blood samples were cultured on a human endothelial cell line and on blood agar. Bacteria were identified by sequencing the amplified 16S ribosomal RNA gene. The presence of bartonella in tissue was assessed by Gram's staining, immunostaining, and polymerase-chain-reaction amplification. Serologic studies for antibodies to bartonella species were performed by indirect immunofluorescence and Western immunoblotting.

Results B. quintana was isolated from one patient in the blood-agar culture and from the other two patients in the endothelial-cell culture. The organism was also identified by both immunostaining and molecular techniques in the valvular vegetations from the three patients and in a cervical lymph node from one patient. The 16S ribosomal RNA gene sequences of the three isolates were almost identical to that of the prototype strain of B. quintana. High titers of antibodies to B. quintana were detected in all three patients, but so were cross-reacting antibodies to chlamydia species. In all three patients studies were repeatedly negative for antibodies to the human immunodeficiency virus.

Conclusions B. quintana is a cause of endocarditis in homeless patients and may be serologically misdiagnosed as a chlamydial infection.

Case Reports

Patient 1

Patient 1 was a 47-year-old man who presented with fatigue, fever, a weight loss of 12 kg, and purpura of the lower limbs. His medical history included a heart murmur and chronic alcoholism. He had been homeless for one year and had been in contact with a dog but reported no dog bites or scratches. The weight loss, fatigue, and fever had started six months before admission.

At the time of admission, physical examination revealed a temperature of 38.5°C, bilateral epistaxis, and purpura of the lower limbs. The pulse was 110 beats per minute and the blood pressure was 105/60 mm Hg, with a grade 4/6 systolic murmur of mitral regurgitation and a gallop rhythm. An echocardiogram showed severe mitral regurgitation, perforation of the mitral valve with ruptured chordae, and an echogenic mass on the mitral valve. There was also an echogenic mass on the posterior cusp of the aortic valve and moderate aortic regurgitation.

Pertinent laboratory data are presented in Table 1. Eight sets of blood cultures were performed. Enzyme-linked immunosorbent assays and Western blot immunoassays for HIV-1 antibody, performed at the time of admission and repeated two months later, were negative.

View this table: [in this window] [in a new window]   Table 1. Demographic, Clinical, and Serologic Characteristics of Three Men with B. quintana Endocarditis.

 
Therapy was begun with a continuous intravenous infusion of amoxicillin (12 g per day) and gentamicin (180 mg per day). The mitral insufficiency became more marked, and on day 4 the patient underwent mitral-valve replacement with a Starr prosthesis. Pathological examination of the excised valve disclosed fibrin vegetation. Numerous minute coccobacillary organisms were observed after Gram's staining, but the culture of tissue from the valve remained sterile.

The same antibiotic treatment was continued for six weeks. The patient reported dysphonia, and an enlarged cervical lymph node was excised for diagnostic purposes. Five of the eight blood cultures grew a gram-negative bacillus subsequently identified as B. quintana, and the patient's serum had high titers of antibody to B. quintana (Table 2). The patient remained well 10 months after surgery.

View this table: [in this window] [in a new window]   Table 2. IgG Antibodies against B. quintana Grown on 5 Percent Sheep-Blood Agar (Agar) and Human Endothelial Cells (Cells), B. henselae, C. pneumoniae, C. psittaci, and C. trachomatis in the Three Patients with B. quintana Endocarditis.

 
Patient 2

Patient 2 was a 41-year-old man who presented with a temperature of 38.5°C and an erythematous lesion of the right foot. He was homeless and lived in close contact with two dogs, a cat, kittens, and a goat. He had a history of alcoholism and cigarette smoking. Aortic insufficiency was diagnosed clinically at the time of admission, and echocardiography revealed abnormal aortic cusps with one vegetation and dilatation of the left ventricle. The cutaneous lesions were clinically diagnosed as septic emboli but were not examined by biopsy. Blood cultures performed according to routine procedures were negative.

The patient was treated for three weeks with intravenous vancomycin combined with ofloxacin and netilmicin, followed by oral rifampin plus ofloxacin and pristinamycin for three additional weeks. The patient, then afebrile, was admitted to the Hôpital Louis Pradel (Lyons, France) for aortic-valve replacement. Pertinent laboratory data are shown in Table 1. Enzyme-linked immunosorbent assays and Western blot immunoassays, performed at the time of surgery and repeated three months later, were negative for HIV-1 antibody. Examination of the aortic valve at the time of surgery revealed numerous perforations of the cusps and multiple vegetations of the aortic ring. The valve was excised, and a mechanical prosthetic valve was implanted. Histologic examination of the valve showed vegetations consisting of fibrin and platelets. The patient received intravenous antibiotic treatment with vancomycin plus ofloxacin for two weeks after surgery, followed by doxycycline for four weeks. He was well six months after surgery.

Patient 3

Patient 3 was a 43-year-old man who presented with congestive heart failure and fever. He was a former soldier in the French Foreign Legion, had been back in France for 10 years, and was living in poor sanitary conditions in a seedy hotel close to the harbor in Marseilles. He had no contact with animals. He was an alcoholic and a cigarette smoker. His medical history was unremarkable with the exception of an episode of undiagnosed microscopic hematuria in 1983. Progressive dyspnea and cough developed one month before his hospitalization.

Clinical examination at the time of admission disclosed a 15-kg weight loss, a rectal temperature of 38.5°C, jaundice, cough, peripheral edema, hepatomegaly, splenomegaly, and loud systolic aortic and mitral murmurs. A chest radiograph showed marked cardiomegaly and a diffuse interstitial infiltrate. Pertinent laboratory results are shown in Table 1. Enzyme-linked immunosorbent assays and Western-blot tests for the presence of HIV-1 antibodies, performed at the time of admission and repeated 40 days later, were negative. Six blood cultures were performed, and empirical treatment with intravenous ceftazidime (3 g per day) plus ofloxacin (400 mg per day) was prescribed. Transthoracic echocardiography disclosed an aortic vegetation and a left ventricular ejection fraction of 30 percent. A diagnosis of infectious endocarditis with severe cardiac failure was made. The fever resolved after two days of antibiotic therapy. Netilmicin (300 mg per day) was added to the regimen when infection with B. quintana was suspected.

The aortic and mitral valves were excised five weeks after admission and replaced by a Carpentier-type bioprosthesis and a Hancock II–type bioprosthesis, respectively. Antibiotic therapy was continued for three weeks. Vegetations were observed on both valves, and microscopical examination confirmed the presence of infectious endocarditis. All microbiologic studies were negative, with the exception of serologic tests for chlamydia and bartonella species (Table 2). The patient died four months after surgery; no autopsy was performed.

Methods

Bacterial Strains

The following bacterial strains were obtained from the American Type Culture Collection (ATCC, Rockville, Md.): B. quintana (Fuller strain, ATCC VR358), B. henselae (Houston, ATCC 49882), Chlamydia pneumoniae (ATCC VR1310), C. psittaci (ATCC VR601), and C. trachomatis (ATCC VR878). B. quintana, Oklahoma strain, was provided by D.F. Welch; B. quintana, Toulouse strain, is a local isolate.⁶

Isolation Procedures

The blood samples, obtained in Bactec blood-culture bottles, and the excised cardiac valves were plated on 5 percent sheep-blood agar incubated at 37°C in an atmosphere of 5 percent carbon dioxide and on human endothelial-cell-line ECV 304,⁸ cultivated as previously described.³

Identification of the Isolates

For the antigenic characterization, the isolates were allowed to react with serial dilutions of polyclonal mouse anti–B. quintana serum and with a monoclonal antibody specific for B. henselae, with the use of an indirect immunofluorescence technique described previously.⁶ Analysis of cell-wall fatty acids was carried out as previously reported⁹ in the first isolate only. Restriction-fragment–length polymorphisms (RFLPs) were analyzed in a portion of the citrate–synthase gene amplified by the polymerase chain reaction (PCR).¹⁰ 16S ribosomal RNA (rRNA) gene sequencing was performed on amplified products with the use of the direct, solid-phase method.¹¹ For PCR amplifications, quick DNA extractions were performed with bacteria grown in agar (the first isolate) or cell culture (the second and third isolates), with the use of the Chelex 100 method.¹² A fragment of the 16S rRNA gene (approximately 1400 base pairs [bp]) was amplified by PCR with the f D1 primer described by Weisburg et al.,¹³ with 5' biotin labeling and primer roc4 (5'CACCCCAGTCGCTGACCCTA3'). After immobilization of the biotinylated amplicon with streptavidin-coupled magnetic beads (Dynabeads M-280, Dynal, Oslo, Norway) and alkaline denaturation, the immobilized products were sequenced with an automatic sequencer (ALF DNA sequencer, Pharmacia Biotech, Uppsala, Sweden) and the Autoread sequencing kit supplied by the same manufacturer. 5'-Fluorescein–labeled primers roc1 (5'AGGCACGAAGTTAGCCGGGGC3'), roc2 (5'ATCGTTTACGGCGTGGACTAC3'), roc3 (5'GAGGGTTGCGCTCGTTGCGGG3'), and roc4 were used for sequencing the direct DNA strand. For each isolate, the sequence was determined four times. The sequences for the isolates were compared with those of B. quintana, B. henselae, B. elizabethae, and B. vinsonii in GenBank through Bisance,¹⁴ with the use of the Clustal package.¹⁵ The Fuller and Oklahoma strains of B. quintana were used as controls.

Detection of B. quintana in Tissues

A formalin-fixed, paraffin-embedded cervical lymph node from Patient 1 and formalin-fixed, paraffin-embedded cardiac valves from all three patients were examined after Gram's and Giménez staining.¹⁶ Immunofluorescent staining was performed with mouse polyclonal anti–B. quintana serum. The immunohistochemical analysis was a modification of that described by Dumler et al.¹⁷ Alkaline phosphatase and fast red were used to stain the tissue specimens after incubation with mouse polyclonal anti–B. quintana serum. PCR amplification of a portion of the bartonella citrate–synthase gene was also used to detect these organisms in the tissue specimens.¹⁰

Serologic Studies

Serum samples were reacted with two B. quintana, Oklahoma strain, antigen preparations. In one preparation, the bacteria were grown on 5 percent sheep-blood agar and resuspended in formaldehyde. In the other preparation, the bacteria were propagated on the ECV 304 cell line, purified by low-speed centrifugation of the cell-culture supernatant, and resuspended in formaldehyde. Antibodies were detected by a microimmunofluorescence technique.⁶ A Western blot immunoassay was performed as previously reported,⁶ with bacteria grown on 5 percent sheep-blood agar used as antigens, both boiled and not boiled. Mouse polyclonal anti–B. quintana serum was used as a positive control. The presence of IgG, IgA, and IgM antibodies against C. pneumoniae, C. trachomatis, and C. psittaci was determined by microimmunofluorescence. To detect cross-reactivity, one serum sample from Patient 1 was adsorbed with C. pneumoniae or blood-agar–grown B. quintana, Oklahoma strain, and tested against B. quintana and C. pneumoniae.

Results

Isolation of Bacteria

The first strain, isolated from a blood sample from Patient 1, was grown on sheep-blood agar after 27 days of incubation and was subsequently subcultured on sheep-blood agar and on endothelial cells (Table 1). The second and third isolates, obtained from blood samples from Patients 2 and 3, were grown only on endothelial cells after 20 and 15 days of incubation, respectively. Subsequent attempts to culture these organisms on sheep-blood agar were unsuccessful. Cultures of the excised valves remained sterile.

Identification of the Isolates

After Giménez staining, the three isolates appeared as thin bacilli or coccobacilli. They reacted with mouse polyclonal antibody against B. quintana but not with a monoclonal antibody directed against B. henselae. The fatty-acid composition of the cell wall was comparable to that previously reported for bartonella species.¹⁸ Insufficient material was available for phenotypic characterization of the second and third isolates. For all three isolates, PCR–RFLP analysis of the citrate synthase amplicons resulted in profiles identical to those reported for B. quintana.¹⁰ For each isolate, a total of 1300 nucleotide positions of the 16S rRNA gene were determined, representing 92 percent of the gene in B. quintana. In this overlapping region of 1300 nucleotides in the sequences for B. henselae, B. quintana, and the three clinical isolates, no difference was found between B. quintana and the three isolates at the 16 positions that differentiate B. quintana from B. henselae. However, one discrepancy was noted between the sequence in the Fuller strain of B. quintana from GenBank and the sequences in the three isolates and our Fuller and Oklahoma strains: a thymidine residue at position 1150 (Escherichia coli standard numbering system) appeared as a guanosine residue in the GenBank sequence.

Detection of B. quintana in Tissue

Immunofluorescence and immunohistochemical techniques demonstrated the presence of B. quintana in the cardiac valves from the three patients (Figure 1) and in the cervical lymph node from Patient 1. The first isolate was also demonstrated by Gram's staining of the valve. Immunohistochemical techniques gave the best results. Also, PCR amplification of a portion of the citrate synthase gene was positive in the cardiac valves and in the lymph node.

View larger version (15K): [in this window] [in a new window]   Figure 1. Immunofluorescence Staining of B. quintana in a Cardiac Valve from Patient 1 (x2000). The pathogens appear as bright bacilli (arrow) against the dark field of the valve tissue.

 
Serologic Studies

Five serum samples from Patient 1, four from Patient 2, and five from Patient 3 were tested for IgG, IgA, and IgM antibodies. All the samples had IgG titers >1:400 against agar-grown B. quintana antigen and IgG titers >1:1600 against endothelial-cell–grown antigen, with almost no detectable IgM or IgA (Table 2). Only one sample had anti–B. henselae antibody, but all the samples had IgG titers >1:256 against C. pneumoniae and IgG titers <1:64 against C. psittaci and C. trachomatis. Adsorption of the serum samples with C. pneumoniae antigen did not alter the antibody titer against B. quintana, whereas adsorption with agar-grown B. quintana antigen eliminated antibody against C. pneumoniae. When analyzed by Western immunoblotting, the samples from the three patients had a slight reaction against B. quintana crude antigen, whereas they exhibited numerous bands against boiled B. quintana antigen (Figure 2). There was a cross-reaction with C. pneumoniae, which decreased after adsorption of the serum with B. quintana antigen, with the persistence of one band (Figure 3). Proteinase K digestion of the antigens suppressed their reactivity.

View larger version (14K): [in this window] [in a new window]   Figure 2. Western Blot Immunoassay of Serum Samples from Three Patients with B. quintana Endocarditis. Lane 1 shows the results for Patient 1, lane 2 for Patient 2, lane 3 for Patient 3, and lane m for mouse anti–B. quintana serum (positive control). MW denotes molecular weight, A crude B. quintana antigen, and B boiled B. quintana antigen.

 

View larger version (18K): [in this window] [in a new window]   Figure 3. Western Blot Immunoassay with the Fourth Serum Sample from Patient 1. The upper panel shows the results without adsorption, and the lower panel the results after adsorption with agar-grown B. quintana. Lane A shows HeLa cells (control), lane B C. pneumoniae antigen, lane C proteinase K–digested C. pneumoniae antigen, lane D endothelial-cell-line ECV 304 (control), lane E ECV 304–grown B. quintana antigen, lane F ECV 304–grown B. quintana antigen digested with proteinase K, lane G boiled, agar-grown B. quintana antigen, and lane H agar-grown B. quintana antigen digested with proteinase K. MW denotes molecular weight. The arrow in each panel indicates the band that may provide evidence of cross-reactivity between B. quintana infection and C. pneumoniae infection.

 
Discussion

We report endocarditis due to B. quintana in three men who were not infected with HIV. All three were about 40 years old, had histories of chronic alcoholism and smoking, and were homeless.

Three isolates of B. quintana were identified on the basis of their antigenicity, RFLP analysis of the citrate synthase gene, the 16S rRNA gene sequence,¹⁹ and the cell-wall fatty-acid composition in one isolate. The sequence of the 16S rRNA gene was determined with the use of rapid DNA preparation and solid-phase, automatic DNA sequencing. Solid-phase, manual sequencing has previously been used to identify B. elizabethae.¹⁸ Analysis of the 16S rRNA sequence allowed us to identify the three isolates as B. quintana, although a discrepancy in one base was noted between our sequence and that of GenBank. Also, differences in isolation were noted: whereas one strain was isolated in the blood-agar culture, the other two were isolated only in cell culture and could not be subcultured on other mediums. Such differences in the ease of isolation have previously been noted for B. quintana.³ Isolation from the cardiac valves was unsuccessful, despite immunologic and molecular detection of B. quintana in these specimens, but there had been antibiotic treatment before excision of the valves.²⁰

Knowledge of the clinical spectrum of human pathogens belonging to the bacterial genus bartonella (previously known as rochalimaea) has expanded dramatically over the past three years. Earlier, B. quintana, the agent of trench fever,²¹ and B. vinsonii were the only known members of the genus, and the latter was not associated with disease in humans.²² A third species, B. henselae, was subsequently identified in immunocompetent and immunocompromised patients, including HIV-infected patients with bacillary angiomatosis, visceral bacillary peliosis, relapsing fever with bacteremia, encephalitis, and endocarditis.^2,10,23 More recently, B. elizabethae was isolated from an immunocompetent patient with endocarditis.¹⁸ A reclassification of these four species in the genus bartonella was proposed on the basis of their phenotypic and genotypic characteristics.²⁴

The body louse, Pediculus humanus, has been recognized as the vector of B. quintana causing trench fever. Although the American HIV-infected patients with B. quintana infection reported no contact with animals or arthropods, one of them had been treated for scabies eight months before the isolation of B. quintana,³ suggesting poor hygienic conditions. We isolated B. quintana, Toulouse strain, from a homeless patient with the acquired immunodeficiency syndrome and cutaneous bacillary angiomatosis.⁶ This suggests that ectoparasites, which are frequently associated with poor hygienic conditions, may be the vector of B. quintana. However, we also isolated two strains from patients who were not homeless.⁷

Several serologic methods have been proposed for the diagnosis of trench fever,^25,26,27 and serotyping of bartonella species in mice has been reported.²⁸ The serologic studies in our three patients were highly suggestive of infection due to B. quintana. Of 12,355 serum specimens tested in our laboratory for the presence of B. quintana antibodies over the past 17 months, 70 (0.57 percent) had IgG titers >1:100, and 31 serum samples (0.25 percent) from 11 patients, including those described here, had IgG titers >1:400. Thus, with the use of immunofluorescence and blood-agar–grown antigen, a cutoff value of 1:100 for the IgG titer allows detection of B. quintana infection. All tested samples had higher IgG titers when tested against endothelial-cell–grown antigen, which may be related to the endothelial-cell–associated expression of one or several antigens by B. quintana.

Our patients had substantial titers of IgG antibodies against C. pneumoniae, which may have been related either to dual infection with chlamydia species and B. quintana or to a serologic cross-reactivity between chlamydia species and B. quintana. To the best of our knowledge, there was no common source of exposure to chlamydia species and B. quintana, and there was no evidence of chlamydial infection in these patients, apart from the antibody titers. Therefore, the most likely explanation for the high titers of IgG antibodies against C. pneumoniae is cross-reactivity between B. quintana and chlamydia species. After adsorption of the serum samples by B. quintana antigen, the antibodies against C. pneumoniae disappeared, confirming a cross-reaction. A similar cross-reaction reported between B. bacilliformis and C. psittaci was attributed to a lipopolysaccharide epitope.²⁹

This cross-reactivity may be confusing, since both chlamydia and bartonella species are implicated in infective endocarditis.^30,31 Serologic studies can support a presumptive diagnosis of endocarditis caused by bartonella or chlamydia species, but a definitive diagnosis requires demonstration of the microorganism in blood or a cardiac valve. We reviewed a series of 10 cases of endocarditis associated with chlamydia species.³¹ Serum samples from nine of these patients were tested for B. quintana, and all had high level of antibodies.

The studies in the three patients described here add to the evidence that bartonella species, including B. quintana, B. henselae, and B. elizabethae, are etiologic agents of endocarditis. These organisms should be included in the differential diagnosis of culture-negative endocarditis.

Supported by a grant from the French Ministry of Health.

We are indebted to H. Tissot Dupont and J. Gouvernet for performing the sequence analysis and to T.J. Marrie for reviewing the manuscript.

Source Information

From the Unité des Rickettsies, Faculté de Médecine, Marseilles (M.D., A.C., D.R.); Laboratoire de Microbiologie Médicale (J.L.M., F.G., J.A.) and Service de Cardiologie (F.L.), Hôpital Saint-Joseph, Paris; Service des Maladies Tropicales et Infectieuses, Hôpital Félix Houphouet-Boigny, Marseilles (P.B.); and Laboratoire de Bactériologie, Hôpital Louis Pradel, Lyons (F.V., J.E.) — all in France. Supported by a grant from the French Ministry of Health.

Address reprint requests to Dr. Raoult at Unité des Rickettsies, Faculté de Médecine, Blvd. Jean Moulin, 13385 Marseilles CEDEX 5, France.

References

1. Vinson JW. In vitro cultivation of the rickettsial agent of trench fever. Bull World Health Organ 1966;35:155-164. [Medline]
2. Welch DF, Pickett DA, Slater LN, Steigerwalt AG, Brenner DJ. Rochalimaea henselae sp. nov., a cause of septicemia, bacillary angiomatosis, and parenchymal bacillary peliosis. J Clin Microbiol 1992;30:275-280. [Free Full Text]
3. Koehler JE, Quinn FD, Berger TG, LeBoit PE, Tappero JW. Isolation of rochalimaea species from cutaneous and osseous lesions of bacillary angiomatosis. N Engl J Med 1992;327:1625-1631. [Abstract]
4. Spach DH, Callis KP, Paauw DS, et al. Endocarditis caused by Rochalimaea quintana in a patient infected with human immunodeficiency virus. J Clin Microbiol 1993;31:692-694. [Free Full Text]
5. Larson AM, Dougherty MJ, Nowowiejski DJ, et al. Detection of Bartonella (Rochalimaea) quintana by routine acridine orange staining of broth blood cultures. J Clin Microbiol 1994;32:1492-1496. [Free Full Text]
6. Maurin M, Roux V, Stein A, Ferrier F, Viraben R, Raoult D. Isolation and characterization by immunofluorescence, sodium dodecyl sulfate-polyacrylamide gel electrophoresis, Western blot, restriction fragment length polymorphism-PCR, 16S rRNA gene sequencing, and pulsed-field gel electrophoresis of Rochalimaea quintana from a patient with bacillary angiomatosis. J Clin Microbiol 1994;32:1166-1171. [Free Full Text]
7. Raoult D, Drancourt M, Carta A, Gastaut JA. Bartonella (Rochalimaea) quintana isolation in patient with chronic adenopathy, lymphopenia, and a cat. Lancet 1994;343:977-977. [CrossRef][Medline]
8. Takahashi K, Sawasaki Y, Hata JI, Mukai K, Goto T. Spontaneous transformation and immortalization of human endothelial cells. In Vitro Cell Dev Biol 1990;26:265-274. [Medline]
9. Miller L, Berger T. Bacterial identification by gas chromatography of whole cell fatty acids. Avondale, Pa.: Hewlett–Packard, 1985. (Hewlett–Packard application note 228-41.)
10. Regnery RL, Anderson BE, Clarridge JE III, Rodriguez-Barradas MC, Jones DC, Carr JH. Characterization of a novel Rochalimaea species, R. henselae sp. nov., isolated from blood of a febrile, human immunodeficiency virus-positive patient. J Clin Microbiol 1992;30:265-274. [Free Full Text]
11. Hultman T, Stahl S, Hornes E, Uhlen M. Direct solid phase sequencing of genomic and plasmid DNA using magnetic beads as solid support. Nucleic Acids Res 1989;17:4937-4946. [Free Full Text]
12. Stein A, Raoult D. A simple method for amplification of DNA from paraffin-embedded tissues. Nucleic Acids Res 1992;20:5237-5238. [Free Full Text]
13. Weisburg WG, Barns SM, Pelletier DA, Lane DJ. 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 1991;173:697-703. [Free Full Text]
14. Dessen P, Fondrat C, Valencien C, Mugnier C. BISANCE: a French service for access to biomolecular sequence databases. Comput Appl Biosci 1990;6:355-356. [Free Full Text]
15. Higgins DG, Sharp PM. CLUSTAL: a package for performing multiple sequence alignment on a microcomputer. Gene 1988;73:237-244. [CrossRef][Medline]
16. Giménez DF. Staining rickettsiae in yolk-sac cultures. Stain Technol 1964;39:135-140. [Medline]
17. Dumler JS, Brouqui P, Aronson J, Taylor JP, Walker DH. Identification of ehrlichia in human tissue. N Engl J Med 1991;325:1109-1110. [Medline]
18. Daly JS, Worthington MG, Brenner DJ, et al. Rochalimaea elizabethae sp. nov. isolated from a patient with endocarditis. J Clin Microbiol 1993;31:872-881. [Free Full Text]
19. Relman DA, Loutit JS, Schmidt TM, Falkow S, Tompkins LS. The agent of bacillary angiomatosis -- an approach to the identification of uncultured pathogens. N Engl J Med 1990;323:1573-1580. [Abstract]
20. Maurin M, Raoult D. Antimicrobial susceptibility of Rochalimaea quintana, Rochalimaea vinsonii, and the newly recognized Rochalimaea henselae. J Antimicrob Chemother 1993;32:587-594. [Free Full Text]
21. Swift HF. Trench fever. Arch Intern Med 1920;26:76-98. [Free Full Text]
22. Baker JA. A rickettsial infection in Canadian voles. J Exp Med 1946;84:37-50. [Abstract]
23. Hadfield TL, Warren R, Kass M, Brun E, Levy C. Endocarditis caused by Rochalimaea henselae. Hum Pathol 1993;24:1140-1141. [CrossRef][Medline]
24. Brenner DJ, O'Connor SP, Winkler HH, Steigerwalt AG. Proposals to unify the genera Bartonella and Rochalimaea, with descriptions of Bartonella quintana comb. nov., Bartonella vinsonii comb. nov., Bartonella henselae comb. nov., and Bartonella elizabethae comb. nov., and to remove the family Bartonellaceae from the order Rickettsiales. Int J Syst Bacteriol 1993;43:777-786. [Free Full Text]
25. Kostrzewski J. The epidemiology of trench fever. Med Dosw Mikrobiol 1950;11:233-263. 
26. Myers WF, Wisseman CL Jr. Serologic studies of trench fever employing a microagglutination procedure. In: Proceedings of the International Symposium on the Control of Lice and Louse-borne Diseases. Washington, D.C.: Pan American Health Organization, 1973:79-81. (Scientific publication no. 263.)
27. Hollingdale MR, Herrmann JE, Vinson JW. Enzyme immunoassay of antibody to Rochalimaea quintana: diagnosis of trench fever and serologic cross-reactions among other rickettsiae. J Infect Dis 1978;137:578-582. [Medline]
28. Slater LN, Coody DW, Woolridge LK, Welch DF. Murine antibody responses distinguish Rochalimaea henselae from Rochalimaea quintana. J Clin Microbiol 1992;30:1722-1727. [Free Full Text]
29. Knobloch J, Bialek R, Müller G, Asmus P. Common surface epitope of Bartonella bacilliformis and Chlamydia psittaci. Am J Trop Med Hyg 1988;39:427-433.
30. Shapiro DS, Kenney SC, Johnson M, Davis CH, Knight ST, Wyrick PB. Chlamydia psittaci endocarditis diagnosed by blood culture. N Engl J Med 1992;326:1192-1195. [Medline]
31. Etienne J, Ory D, Thouvenot D, et al. Chlamydial endocarditis: a report on ten cases. Eur Heart J 1992;13:1422-1426. [Free Full Text]

Abstract PDF Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

This article has been cited by other articles:

• Raoult, D., Abbara, S., Jassal, D. S., Kradin, R. L. (2007). Case 5-2007 -- A 53-Year-Old Man with a Prosthetic Aortic Valve and Recent Onset of Fatigue, Dyspnea, Weight Loss, and Sweats. NEJM 356: 715-725 [Full Text]  
• Maggi, R. G., Duncan, A. W., Breitschwerdt, E. B. (2005). Novel Chemically Modified Liquid Medium That Will Support the Growth of Seven Bartonella Species. J. Clin. Microbiol. 43: 2651-2655 [Abstract] [Full Text]  
• Norris, W. M., Nielsen, E. L., Engelberg, R. A., Curtis, J. R. (2005). Treatment Preferences for Resuscitation and Critical Care Among Homeless Persons. Chest 127: 2180-2187 [Abstract] [Full Text]  
• Breitschwerdt, E. B., Hegarty, B. C., Maggi, R., Hawkins, E., Dyer, P. (2005). Bartonella Species as a Potential Cause of Epistaxis in Dogs. J. Clin. Microbiol. 43: 2529-2533 [Abstract] [Full Text]  
• ZNAZEN, A., ROLAIN, J.-M., HAMMAMI, N., KAMMOUN, S., HAMMAMI, A., RAOULT, D. (2005). HIGH PREVALENCE OF BARTONELLA QUINTANA ENDOCARDITIS IN SFAX, TUNISIA. Am J Trop Med Hyg 72: 503-507 [Abstract] [Full Text]  
• Breitkopf, C., Hammel, D., Scheld, H. H., Peters, G., Becker, K. (2005). Impact of a Molecular Approach to Improve the Microbiological Diagnosis of Infective Heart Valve Endocarditis. Circulation 111: 1415-1421 [Abstract] [Full Text]  
• Maggi, R. G., Breitschwerdt, E. B. (2005). Potential Limitations of the 16S-23S rRNA Intergenic Region for Molecular Detection of Bartonella Species. J. Clin. Microbiol. 43: 1171-1176 [Abstract] [Full Text]  
• Biddinger, P. D., Isselbacher, E. M., Fan, D., Shepard, J.-A. O. (2005). Case 5-2005 - A 53-Year-Old Man with Depression and Sudden Shortness of Breath. NEJM 352: 709-716 [Full Text]  
• Fenollar, F., Sire, S., Raoult, D. (2005). Bartonella vinsonii subsp. arupensis as an Agent of Blood Culture-Negative Endocarditis in a Human. J. Clin. Microbiol. 43: 945-947 [Abstract] [Full Text]  
• Foucault, C., La Scola, B., Lindroos, H., Andersson, S. G. E., Raoult, D. (2005). Multispacer Typing Technique for Sequence-Based Typing of Bartonella quintana. J. Clin. Microbiol. 43: 41-48 [Abstract] [Full Text]  
• Elliott, T. S. J., Foweraker, J., Gould, F. K., Perry, J. D., Sandoe, J. A. T. (2004). Guidelines for the antibiotic treatment of endocarditis in adults: report of the Working Party of the British Society for Antimicrobial Chemotherapy. J Antimicrob Chemother 54: 971-981 [Abstract] [Full Text]  
• Avidor, B., Graidy, M., Efrat, G., Leibowitz, C., Shapira, G., Schattner, A., Zimhony, O., Giladi, M. (2004). Bartonella koehlerae, a New Cat-Associated Agent of Culture-Negative Human Endocarditis. J. Clin. Microbiol. 42: 3462-3468 [Abstract] [Full Text]  
• Rolain, J. M., Brouqui, P., Koehler, J. E., Maguina, C., Dolan, M. J., Raoult, D. (2004). Recommendations for Treatment of Human Infections Caused by Bartonella Species. Antimicrob. Agents Chemother. 48: 1921-1933 [Full Text]  
• Rolain, J. M., Lecam, C., Raoult, D. (2003). Simplified Serological Diagnosis of Endocarditis Due to Coxiella burnetii and Bartonella. CVI 10: 1147-1148 [Abstract] [Full Text]  
• Chomel, B. B., Wey, A. C., Kasten, R. W. (2003). Isolation of Bartonella washoensis from a Dog with Mitral Valve Endocarditis. J. Clin. Microbiol. 41: 5327-5332 [Abstract] [Full Text]  
• Mann, P, Nye, F, Williams, G, Walker, A, Amadi, A (2003). From trench fever to endocarditis. Postgrad. Med. J. 79: 655-656 [Abstract] [Full Text]  
• Rovery, C., Rolain, J. M., Raoult, D., Brouqui, P. (2003). Shell Vial Culture as a Tool for Isolation of Brucella melitensis in Chronic Hepatic Abscess. J. Clin. Microbiol. 41: 4460-4461 [Abstract] [Full Text]  
• Foucault, C., Raoult, D., Brouqui, P. (2003). Randomized Open Trial of Gentamicin and Doxycycline for Eradication of Bartonella quintana from Blood in Patients with Chronic Bacteremia. Antimicrob. Agents Chemother. 47: 2204-2207 [Abstract] [Full Text]  
• Rolain, J. M., Gouriet, F., Enea, M., Aboud, M., Raoult, D. (2003). Detection by Immunofluorescence Assay of Bartonella henselae in Lymph Nodes from Patients with Cat Scratch Disease. CVI 10: 686-691 [Abstract] [Full Text]  
• Zeaiter, Z., Fournier, P.-E., Greub, G., Raoult, D. (2003). Diagnosis of Bartonella Endocarditis by a Real-Time Nested PCR Assay Using Serum. J. Clin. Microbiol. 41: 919-925 [Abstract] [Full Text]  
• Lamas, C C, Eykyn, S J (2003). Blood culture negative endocarditis: analysis of 63 cases presenting over 25 years. Heart 89: 258-262 [Abstract] [Full Text]  
• Rolain, J.-M., Maurin, M., Mallet, M.-N., Parzy, D., Raoult, D. (2003). Culture and Antibiotic Susceptibility of Bartonella quintana in Human Erythrocytes. Antimicrob. Agents Chemother. 47: 614-619 [Abstract] [Full Text]  
• Raoult, D., Fournier, P.-E., Vandenesch, F., Mainardi, J.-L., Eykyn, S. J., Nash, J., James, E., Benoit-Lemercier, C., Marrie, T. J. (2003). Outcome and Treatment of Bartonella Endocarditis. Arch Intern Med 163: 226-230 [Abstract] [Full Text]  
• Houpikian, P., Raoult, D. (2003). Western Immunoblotting for Bartonella Endocarditis. CVI 10: 95-102 [Abstract] [Full Text]  
• Maurin, M., Rolain, J. M., Raoult, D. (2002). Comparison of In-House and Commercial Slides for Detection by Immunofluorescence of Immunoglobulins G and M against Bartonella henselae and Bartonella quintana. CVI 9: 1004-1009 [Abstract] [Full Text]  
• Fournier, P.-E., Mainardi, J.-L., Raoult, D. (2002). Value of Microimmunofluorescence for Diagnosis and Follow-up of Bartonella Endocarditis. CVI 9: 795-801 [Abstract] [Full Text]  
• Jacomo, V., Kelly, P. J., Raoult, D. (2002). Natural History of Bartonella Infections (an Exception to Koch's Postulate). CVI 9: 8-18 [Full Text]  
• Ciervo, A., Petrucca, A., Ciarrocchi, S., Pinto, A., Bonazzi, L., Fabio, A., Farnetti, E., Chomel, B. B., Ciceroni, L. (2001). Molecular Characterization of First Human Bartonella Strain Isolated in Italy. J. Clin. Microbiol. 39: 4554-4557 [Abstract] [Full Text]  
• Mylonakis, E., Calderwood, S. B. (2001). Infective Endocarditis in Adults. NEJM 345: 1318-1330 [Full Text]  
• Chomel, B. B., Mac Donald, K. A., Kasten, R. W., Chang, C.-C., Wey, A. C., Foley, J. E., Thomas, W. P., Kittleson, M. D. (2001). Aortic Valve Endocarditis in a Dog Due to Bartonella clarridgeiae. J. Clin. Microbiol. 39: 3548-3554 [Abstract] [Full Text]  
• De La Rosa, G. R., Barnett, B. J., Ericsson, C. D., Turk, J. B. (2001). Native Valve Endocarditis Due to Bartonella henselae in a Middle-Aged Human Immunodeficiency Virus-Negative Woman. J. Clin. Microbiol. 39: 3417-3419 [Abstract] [Full Text]  
• Houpikian, P., Raoult, D. (2001). 16S/23S rRNA Intergenic Spacer Regions for Phylogenetic Analysis, Identification, and Subtyping of Bartonella Species. J. Clin. Microbiol. 39: 2768-2778 [Abstract] [Full Text]  
• Liang, Z., La Scola, B., Lepidi, H., Raoult, D. (2001). Production of Bartonella Genus-Specific Monoclonal Antibodies. CVI 8: 847-849 [Abstract] [Full Text]  
• Fournier, P.-E., Minnick, M. F., Lepidi, H., Salvo, E., Raoult, D. (2001). Experimental Model of Human Body Louse Infection Using Green Fluorescent Protein-Expressing Bartonella quintana. Infect. Immun. 69: 1876-1879 [Abstract] [Full Text]  
• Bruneval, P, Choucair, J, Paraf, F, Casalta, J-P, Raoult, D, Scherchen, F, Mainardi, J-L (2001). Detection of fastidious bacteria in cardiac valves in cases of blood culture negative endocarditis. J. Clin. Pathol. 54: 238-240 [Abstract] [Full Text]  
• Renesto, P., Gouvernet, J., Drancourt, M., Roux, V., Raoult, D. (2001). Use of rpoB Gene Analysis for Detection and Identification of Bartonella Species. J. Clin. Microbiol. 39: 430-437 [Abstract] [Full Text]  
• Brouqui, P., Raoult, D. (2001). Endocarditis Due to Rare and Fastidious Bacteria. Clin. Microbiol. Rev. 14: 177-207 [Abstract] [Full Text]  
• Rolain, J.-M., Maurin, M., Raoult, D. (2000). Bactericidal effect of antibiotics on Bartonella and Brucella spp.: clinical implications. J Antimicrob Chemother 46: 811-814 [Abstract] [Full Text]  
• Chang, C.-C., Kasten, R. W., Chomel, B. B., Simpson, D. C., Hew, C. M., Kordick, D. L., Heller, R., Piemont, Y., Breitschwerdt, E. B. (2000). Coyotes (Canis latrans) as the Reservoir for a Human Pathogenic Bartonella sp.: Molecular Epidemiology of Bartonella vinsonii subsp. berkhoffii Infection in Coyotes from Central Coastal California. J. Clin. Microbiol. 38: 4193-4200 [Abstract] [Full Text]  
• Drancourt, M., Bollet, C., Carlioz, A., Martelin, R., Gayral, J.-P., Raoult, D. (2000). 16S Ribosomal DNA Sequence Analysis of a Large Collection of Environmental and Clinical Unidentifiable Bacterial Isolates. J. Clin. Microbiol. 38: 3623-3630 [Abstract] [Full Text]  
• Kerkhoff, F T, Rothova, A (2000). Bartonella henselae associated uveitis and HLA-B27. Br J Ophthalmol 84: 1125-1129 [Abstract] [Full Text]  
• Handley, S. A., Regnery, R. L. (2000). Differentiation of Pathogenic Bartonella Species by Infrequent Restriction Site PCR. J. Clin. Microbiol. 38: 3010-3015 [Abstract] [Full Text]  
• Maurin, M., Raoult, D. (2000). Isolation in Endothelial Cell Cultures of Chlamydia trachomatis LGV (Serovar L2) from a Lymph Node of a Patient with Suspected Cat Scratch Disease. J. Clin. Microbiol. 38: 2062-2064 [Abstract] [Full Text]  
• Liang, Z., Raoult, D. (2000). Species-Specific Monoclonal Antibodies for Rapid Identification of Bartonella quintana. CVI 7: 21-24 [Abstract] [Full Text]  
• Matar, G. M., Koehler, J. E., Malcolm, G., Lambert-Fair, M. A., Tappero, J., Hunter, S. B., Swaminathan, B. (1999). Identification of Bartonella Species Directly in Clinical Specimens by PCR-Restriction Fragment Length Polymorphism Analysis of a 16S rRNA Gene Fragment. J. Clin. Microbiol. 37: 4045-4047 [Abstract] [Full Text]  
• Breitschwerdt, E. B., Atkins, C. E., Brown, T. T., Kordick, D. L., Snyder, P. S. (1999). Bartonella vinsonii subsp. berkhoffii and Related Members of the Alpha Subdivision of the Proteobacteria in Dogs with Cardiac Arrhythmias, Endocarditis, or Myocarditis. J. Clin. Microbiol. 37: 3618-3626 [Abstract] [Full Text]  
• Raoult, D. (1999). Afebrile Blood Culture-Negative Endocarditis. ANN INTERN MED 131: 144-146 [Full Text]  
• Fenollar, F., Raoult, D. (1999). Diagnosis of Rickettsial Diseases Using Samples Dried on Blotting Paper. CVI 6: 483-488 [Abstract] [Full Text]  
• La Scola, B., Raoult, D. (1999). Culture of Bartonella quintana and Bartonella henselae from Human Samples: a 5-Year Experience (1993 to 1998). J. Clin. Microbiol. 37: 1899-1905 [Abstract] [Full Text]  
• Holmberg, M., McGill, S., Ehrenborg, C., Wesslén, L., Hjelm, E., Darelid, J., Blad, L., Engstrand, L., Regnery, R., Friman, G. (1999). Evaluation of Human Seroreactivity to Bartonella Species in Sweden. J. Clin. Microbiol. 37: 1381-1384 [Abstract] [Full Text]  
• Roux, V., Raoult, D. (1999). Body Lice as Tools for Diagnosis and Surveillance of Reemerging Diseases. J. Clin. Microbiol. 37: 596-599 [Abstract] [Full Text]  
• Skolnik, P. R., Mark, E. J. (1999). Case 5-1999- A 37-Year-Old Man with Fever and Diffuse Lymphadenopathy. NEJM 340: 545-554 [Full Text]  
• Brouqui, P., Lascola, B., Roux, V., Raoult, D. (1999). Chronic Bartonella quintana Bacteremia in Homeless Patients. NEJM 340: 184-189 [Abstract] [Full Text]  
• Bayer, A. S., Bolger, A. F., Taubert, K. A., Wilson, W., Steckelberg, J., Karchmer, A. W., Levison, M., Chambers, H. F., Dajani, A. S., Gewitz, M. H., Newburger, J. W., Gerber, M. A., Shulman, S. T., Pallasch, T. J., Gage, T. W., Ferrieri, P. (1998). Diagnosis and Management of Infective Endocarditis and Its Complications. Circulation 98: 2936-2948 [Full Text]  
• McGill, S. L., Regnery, R. L., Karem, K. L. (1998). Characterization of Human Immunoglobulin (Ig) Isotype and IgG Subclass Response to Bartonella henselae Infection. Infect. Immun. 66: 5915-5920 [Abstract] [Full Text]  
• Breitschwerdt, E. B., Hegarty, B. C., Hancock, S. I. (1998). Sequential Evaluation of Dogs Naturally Infected with Ehrlichia canis, Ehrlichia chaffeensis, Ehrlichia equi, Ehrlichia ewingii, or Bartonella vinsonii. J. Clin. Microbiol. 36: 2645-2651 [Abstract] [Full Text]  
• Parrott, J. H., Dure, L., Sullender, W., Buraphacheep, W., Frye, T. A., Galliani, C. A., Marston, E., Jones, D., Regnery, R. (1997). Central Nervous System Infection Associated With Bartonella quintana: A Report of Two Cases. Pediatrics 100: 403-403 [Full Text]  
• Jacoby, G. A., Hay, C. M. (1997). Case 2-1997- A 38-Year-Old Man with Digital Clubbing, Low-Grade Fever, and a Murmur. NEJM 336: 205-210 [Full Text]  
• Comer, J. A., Flynn, C., Regnery, R. L., Vlahov, D., Childs, J. E. (1996). Antibodies to Bartonella Species in Inner-city Intravenous Drug Users in Baltimore, Md. Arch Intern Med 156: 2491-2495 [Abstract]  
• Walker, D. H., Barbour, A. G., Oliver, J. H., Lane, R. S., Dumler, J. S., Dennis, D. T., Persing, D. H., Azad, A. F., McSweegan, E. (1996). Emerging Bacterial Zoonotic and Vector-Borne Diseases: Ecological and Epidemiological Factors. JAMA 275: 463-469 [Abstract]  
• (1995). THE RETURN OF TRENCH FEVER. JWatch General 1995: 5-5 [Full Text]  
• Relman, D. A. (1995). Has Trench Fever Returned?. NEJM 332: 463-464 [Full Text]