Bartonella (Rochalimaea) quintana Endocarditis in Three Homeless Men
Michel Drancourt, M.D., Ph.D., Jean Luc Mainardi, M.D., Philippe Brouqui, M.D., Ph.D., François Vandenesch, M.D., Anne Carta, M.D., Franck Lehnert, M.D., Jerome Etienne, M.D., Fred Goldstein, M.D., Jacques Acar, M.D., and Didier Raoult, M.D., Ph.D.
BackgroundBartonella (Rochalimaea) quintana is the agent oftrench fever and is transmitted by the body louse. We searchedfor this organism in three alcoholic homeless men with endocarditis.
Methods Blood samples were cultured on a human endothelial cellline and on blood agar. Bacteria were identified by sequencingthe amplified 16S ribosomal RNA gene. The presence of bartonellain tissue was assessed by Gram's staining, immunostaining, andpolymerase-chain-reaction amplification. Serologic studies forantibodies to bartonella species were performed by indirectimmunofluorescence and Western immunoblotting.
ResultsB. quintana was isolated from one patient in the blood-agarculture and from the other two patients in the endothelial-cellculture. The organism was also identified by both immunostainingand molecular techniques in the valvular vegetations from thethree patients and in a cervical lymph node from one patient.The 16S ribosomal RNA gene sequences of the three isolates werealmost identical to that of the prototype strain of B. quintana.High titers of antibodies to B. quintana were detected in allthree patients, but so were cross-reacting antibodies to chlamydiaspecies. In all three patients studies were repeatedly negativefor antibodies to the human immunodeficiency virus.
ConclusionsB. quintana is a cause of endocarditis in homelesspatients and may be serologically misdiagnosed as a chlamydialinfection.
Bartonella quintana, the agent of trench fever, affected about1 million soldiers during World War I and a smaller number duringWorld War II. Sporadic reports have suggested that infectionwith this agent, which is transmitted by the body louse, isnot restricted to wartime.1 Over the past few years, B. quintana(formerly known as Rochalimaea quintana) has been reported inNorth America in 5 patients infected with the human immunodeficiencyvirus (HIV),2,3 including 1 with endocarditis,4 and in 10 HIV-negativepatients, including 1 with subacute endocarditis5 (and SpachDH: personal communication). We recently described two additionalstrains isolated from blood specimens obtained from patientswith bacillary angiomatosis6 and one from a patient with chronicadenopathy.7 We now report on three homeless men with B. quintanaendocarditis.
Case Reports
Patient 1
Patient 1 was a 47-year-old man who presented with fatigue,fever, a weight loss of 12 kg, and purpura of the lower limbs.His medical history included a heart murmur and chronic alcoholism.He had been homeless for one year and had been in contact witha dog but reported no dog bites or scratches. The weight loss,fatigue, and fever had started six months before admission.
At the time of admission, physical examination revealed a temperatureof 38.5°C, bilateral epistaxis, and purpura of the lowerlimbs. The pulse was 110 beats per minute and the blood pressurewas 105/60 mm Hg, with a grade 4/6 systolic murmur of mitralregurgitation and a gallop rhythm. An echocardiogram showedsevere mitral regurgitation, perforation of the mitral valvewith ruptured chordae, and an echogenic mass on the mitral valve.There was also an echogenic mass on the posterior cusp of theaortic valve and moderate aortic regurgitation.
Pertinent laboratory data are presented in Table 1. Eight setsof blood cultures were performed. Enzyme-linked immunosorbentassays and Western blot immunoassays for HIV-1 antibody, performedat the time of admission and repeated two months later, werenegative.
Table 1. Demographic, Clinical, and Serologic Characteristics of Three Men with B. quintana Endocarditis.
Therapy was begun with a continuous intravenous infusion ofamoxicillin (12 g per day) and gentamicin (180 mg per day).The mitral insufficiency became more marked, and on day 4 thepatient underwent mitral-valve replacement with a Starr prosthesis.Pathological examination of the excised valve disclosed fibrinvegetation. Numerous minute coccobacillary organisms were observedafter Gram's staining, but the culture of tissue from the valveremained sterile.
The same antibiotic treatment was continued for six weeks. Thepatient reported dysphonia, and an enlarged cervical lymph nodewas excised for diagnostic purposes. Five of the eight bloodcultures grew a gram-negative bacillus subsequently identifiedas B. quintana, and the patient's serum had high titers of antibodyto B. quintana (Table 2). The patient remained well 10 monthsafter surgery.
Table 2. IgG Antibodies against B. quintana Grown on 5 Percent Sheep-Blood Agar (Agar) and Human Endothelial Cells (Cells), B. henselae, C. pneumoniae, C. psittaci, and C. trachomatis in the Three Patients with B. quintana Endocarditis.
Patient 2
Patient 2 was a 41-year-old man who presented with a temperatureof 38.5°C and an erythematous lesion of the right foot.He was homeless and lived in close contact with two dogs, acat, kittens, and a goat. He had a history of alcoholism andcigarette smoking. Aortic insufficiency was diagnosed clinicallyat the time of admission, and echocardiography revealed abnormalaortic cusps with one vegetation and dilatation of the leftventricle. The cutaneous lesions were clinically diagnosed asseptic emboli but were not examined by biopsy. Blood culturesperformed according to routine procedures were negative.
The patient was treated for three weeks with intravenous vancomycincombined with ofloxacin and netilmicin, followed by oral rifampinplus ofloxacin and pristinamycin for three additional weeks.The patient, then afebrile, was admitted to the HôpitalLouis Pradel (Lyons, France) for aortic-valve replacement. Pertinentlaboratory data are shown in Table 1. Enzyme-linked immunosorbentassays and Western blot immunoassays, performed at the timeof surgery and repeated three months later, were negative forHIV-1 antibody. Examination of the aortic valve at the timeof surgery revealed numerous perforations of the cusps and multiplevegetations of the aortic ring. The valve was excised, and amechanical prosthetic valve was implanted. Histologic examinationof the valve showed vegetations consisting of fibrin and platelets.The patient received intravenous antibiotic treatment with vancomycinplus ofloxacin for two weeks after surgery, followed by doxycyclinefor four weeks. He was well six months after surgery.
Patient 3
Patient 3 was a 43-year-old man who presented with congestiveheart failure and fever. He was a former soldier in the FrenchForeign Legion, had been back in France for 10 years, and wasliving in poor sanitary conditions in a seedy hotel close tothe harbor in Marseilles. He had no contact with animals. Hewas an alcoholic and a cigarette smoker. His medical historywas unremarkable with the exception of an episode of undiagnosedmicroscopic hematuria in 1983. Progressive dyspnea and coughdeveloped one month before his hospitalization.
Clinical examination at the time of admission disclosed a 15-kgweight loss, a rectal temperature of 38.5°C, jaundice, cough,peripheral edema, hepatomegaly, splenomegaly, and loud systolicaortic and mitral murmurs. A chest radiograph showed markedcardiomegaly and a diffuse interstitial infiltrate. Pertinentlaboratory results are shown in Table 1. Enzyme-linked immunosorbentassays and Western-blot tests for the presence of HIV-1 antibodies,performed at the time of admission and repeated 40 days later,were negative. Six blood cultures were performed, and empiricaltreatment with intravenous ceftazidime (3 g per day) plus ofloxacin(400 mg per day) was prescribed. Transthoracic echocardiographydisclosed an aortic vegetation and a left ventricular ejectionfraction of 30 percent. A diagnosis of infectious endocarditiswith severe cardiac failure was made. The fever resolved aftertwo days of antibiotic therapy. Netilmicin (300 mg per day)was added to the regimen when infection with B. quintana wassuspected.
The aortic and mitral valves were excised five weeks after admissionand replaced by a Carpentier-type bioprosthesis and a HancockIItype bioprosthesis, respectively. Antibiotic therapywas continued for three weeks. Vegetations were observed onboth valves, and microscopical examination confirmed the presenceof infectious endocarditis. All microbiologic studies were negative,with the exception of serologic tests for chlamydia and bartonellaspecies (Table 2). The patient died four months after surgery;no autopsy was performed.
Methods
Bacterial Strains
The following bacterial strains were obtained from the AmericanType Culture Collection (ATCC, Rockville, Md.): B. quintana(Fuller strain, ATCC VR358), B. henselae (Houston, ATCC 49882),Chlamydia pneumoniae (ATCC VR1310), C. psittaci (ATCC VR601),and C. trachomatis (ATCC VR878). B. quintana, Oklahoma strain,was provided by D.F. Welch; B. quintana, Toulouse strain, isa local isolate.6
Isolation Procedures
The blood samples, obtained in Bactec blood-culture bottles,and the excised cardiac valves were plated on 5 percent sheep-bloodagar incubated at 37°C in an atmosphere of 5 percent carbondioxide and on human endothelial-cell-line ECV 304,8 cultivatedas previously described.3
Identification of the Isolates
For the antigenic characterization, the isolates were allowedto react with serial dilutions of polyclonal mouse antiB.quintana serum and with a monoclonal antibody specific for B.henselae, with the use of an indirect immunofluorescence techniquedescribed previously.6 Analysis of cell-wall fatty acids wascarried out as previously reported9 in the first isolate only.Restriction-fragmentlength polymorphisms (RFLPs) wereanalyzed in a portion of the citratesynthase gene amplifiedby the polymerase chain reaction (PCR).10 16S ribosomal RNA(rRNA) gene sequencing was performed on amplified products withthe use of the direct, solid-phase method.11 For PCR amplifications,quick DNA extractions were performed with bacteria grown inagar (the first isolate) or cell culture (the second and thirdisolates), with the use of the Chelex 100 method.12 A fragmentof the 16S rRNA gene (approximately 1400 base pairs [bp]) wasamplified by PCR with the f D1 primer described by Weisburget al.,13 with 5' biotin labeling and primer roc4 (5'CACCCCAGTCGCTGACCCTA3').After immobilization of the biotinylated amplicon with streptavidin-coupledmagnetic beads (Dynabeads M-280, Dynal, Oslo, Norway) and alkalinedenaturation, the immobilized products were sequenced with anautomatic sequencer (ALF DNA sequencer, Pharmacia Biotech, Uppsala,Sweden) and the Autoread sequencing kit supplied by the samemanufacturer. 5'-Fluoresceinlabeled primers roc1 (5'AGGCACGAAGTTAGCCGGGGC3'),roc2 (5'ATCGTTTACGGCGTGGACTAC3'), roc3 (5'GAGGGTTGCGCTCGTTGCGGG3'),and roc4 were used for sequencing the direct DNA strand. Foreach isolate, the sequence was determined four times. The sequencesfor the isolates were compared with those of B. quintana, B.henselae, B. elizabethae, and B. vinsonii in GenBank throughBisance,14 with the use of the Clustal package.15 The Fullerand Oklahoma strains of B. quintana were used as controls.
Detection of B. quintana in Tissues
A formalin-fixed, paraffin-embedded cervical lymph node fromPatient 1 and formalin-fixed, paraffin-embedded cardiac valvesfrom all three patients were examined after Gram's and Giménezstaining.16 Immunofluorescent staining was performed with mousepolyclonal antiB. quintana serum. The immunohistochemicalanalysis was a modification of that described by Dumler et al.17Alkaline phosphatase and fast red were used to stain the tissuespecimens after incubation with mouse polyclonal antiB.quintana serum. PCR amplification of a portion of the bartonellacitratesynthase gene was also used to detect these organismsin the tissue specimens.10
Serologic Studies
Serum samples were reacted with two B. quintana, Oklahoma strain,antigen preparations. In one preparation, the bacteria weregrown on 5 percent sheep-blood agar and resuspended in formaldehyde.In the other preparation, the bacteria were propagated on theECV 304 cell line, purified by low-speed centrifugation of thecell-culture supernatant, and resuspended in formaldehyde. Antibodieswere detected by a microimmunofluorescence technique.6 A Westernblot immunoassay was performed as previously reported,6 withbacteria grown on 5 percent sheep-blood agar used as antigens,both boiled and not boiled. Mouse polyclonal antiB. quintanaserum was used as a positive control. The presence of IgG, IgA,and IgM antibodies against C. pneumoniae, C. trachomatis, andC. psittaci was determined by microimmunofluorescence. To detectcross-reactivity, one serum sample from Patient 1 was adsorbedwith C. pneumoniae or blood-agargrown B. quintana, Oklahomastrain, and tested against B. quintana and C. pneumoniae.
Results
Isolation of Bacteria
The first strain, isolated from a blood sample from Patient1, was grown on sheep-blood agar after 27 days of incubationand was subsequently subcultured on sheep-blood agar and onendothelial cells (Table 1). The second and third isolates,obtained from blood samples from Patients 2 and 3, were grownonly on endothelial cells after 20 and 15 days of incubation,respectively. Subsequent attempts to culture these organismson sheep-blood agar were unsuccessful. Cultures of the excisedvalves remained sterile.
Identification of the Isolates
After Giménez staining, the three isolates appeared asthin bacilli or coccobacilli. They reacted with mouse polyclonalantibody against B. quintana but not with a monoclonal antibodydirected against B. henselae. The fatty-acid composition ofthe cell wall was comparable to that previously reported forbartonella species.18 Insufficient material was available forphenotypic characterization of the second and third isolates.For all three isolates, PCRRFLP analysis of the citratesynthase amplicons resulted in profiles identical to those reportedfor B. quintana.10 For each isolate, a total of 1300 nucleotidepositions of the 16S rRNA gene were determined, representing92 percent of the gene in B. quintana. In this overlapping regionof 1300 nucleotides in the sequences for B. henselae, B. quintana,and the three clinical isolates, no difference was found betweenB. quintana and the three isolates at the 16 positions thatdifferentiate B. quintana from B. henselae. However, one discrepancywas noted between the sequence in the Fuller strain of B. quintanafrom GenBank and the sequences in the three isolates and ourFuller and Oklahoma strains: a thymidine residue at position1150 (Escherichia coli standard numbering system) appeared asa guanosine residue in the GenBank sequence.
Detection of B. quintana in Tissue
Immunofluorescence and immunohistochemical techniques demonstratedthe presence of B. quintana in the cardiac valves from the threepatients (Figure 1) and in the cervical lymph node from Patient1. The first isolate was also demonstrated by Gram's stainingof the valve. Immunohistochemical techniques gave the best results.Also, PCR amplification of a portion of the citrate synthasegene was positive in the cardiac valves and in the lymph node.
Figure 1. Immunofluorescence Staining of B. quintana in a Cardiac Valve from Patient 1 (x2000).
The pathogens appear as bright bacilli (arrow) against the dark field of the valve tissue.
Serologic Studies
Five serum samples from Patient 1, four from Patient 2, andfive from Patient 3 were tested for IgG, IgA, and IgM antibodies.All the samples had IgG titers >1:400 against agar-grownB. quintana antigen and IgG titers >1:1600 against endothelial-cellgrownantigen, with almost no detectable IgM or IgA (Table 2). Onlyone sample had antiB. henselae antibody, but all thesamples had IgG titers >1:256 against C. pneumoniae and IgGtiters <1:64 against C. psittaci and C. trachomatis. Adsorptionof the serum samples with C. pneumoniae antigen did not alterthe antibody titer against B. quintana, whereas adsorption withagar-grown B. quintana antigen eliminated antibody against C.pneumoniae. When analyzed by Western immunoblotting, the samplesfrom the three patients had a slight reaction against B. quintanacrude antigen, whereas they exhibited numerous bands againstboiled B. quintana antigen (Figure 2). There was a cross-reactionwith C. pneumoniae, which decreased after adsorption of theserum with B. quintana antigen, with the persistence of oneband (Figure 3). Proteinase K digestion of the antigens suppressedtheir reactivity.
Figure 2. Western Blot Immunoassay of Serum Samples from Three Patients with B. quintana Endocarditis.
Lane 1 shows the results for Patient 1, lane 2 for Patient 2, lane 3 for Patient 3, and lane m for mouse antiB. quintana serum (positive control). MW denotes molecular weight, A crude B. quintana antigen, and B boiled B. quintana antigen.
Figure 3. Western Blot Immunoassay with the Fourth Serum Sample from Patient 1.
The upper panel shows the results without adsorption, and the lower panel the results after adsorption with agar-grown B. quintana. Lane A shows HeLa cells (control), lane B C. pneumoniae antigen, lane C proteinase Kdigested C. pneumoniae antigen, lane D endothelial-cell-line ECV 304 (control), lane E ECV 304grown B. quintana antigen, lane F ECV 304grown B. quintana antigen digested with proteinase K, lane G boiled, agar-grown B. quintana antigen, and lane H agar-grown B. quintana antigen digested with proteinase K. MW denotes molecular weight. The arrow in each panel indicates the band that may provide evidence of cross-reactivity between B. quintana infection and C. pneumoniae infection.
Discussion
We report endocarditis due to B. quintana in three men who werenot infected with HIV. All three were about 40 years old, hadhistories of chronic alcoholism and smoking, and were homeless.
Three isolates of B. quintana were identified on the basis oftheir antigenicity, RFLP analysis of the citrate synthase gene,the 16S rRNA gene sequence,19 and the cell-wall fatty-acid compositionin one isolate. The sequence of the 16S rRNA gene was determinedwith the use of rapid DNA preparation and solid-phase, automaticDNA sequencing. Solid-phase, manual sequencing has previouslybeen used to identify B. elizabethae.18 Analysis of the 16SrRNA sequence allowed us to identify the three isolates as B.quintana, although a discrepancy in one base was noted betweenour sequence and that of GenBank. Also, differences in isolationwere noted: whereas one strain was isolated in the blood-agarculture, the other two were isolated only in cell culture andcould not be subcultured on other mediums. Such differencesin the ease of isolation have previously been noted for B. quintana.3Isolation from the cardiac valves was unsuccessful, despiteimmunologic and molecular detection of B. quintana in thesespecimens, but there had been antibiotic treatment before excisionof the valves.20
Knowledge of the clinical spectrum of human pathogens belongingto the bacterial genus bartonella (previously known as rochalimaea)has expanded dramatically over the past three years. Earlier,B. quintana, the agent of trench fever,21 and B. vinsonii werethe only known members of the genus, and the latter was notassociated with disease in humans.22 A third species, B. henselae,was subsequently identified in immunocompetent and immunocompromisedpatients, including HIV-infected patients with bacillary angiomatosis,visceral bacillary peliosis, relapsing fever with bacteremia,encephalitis, and endocarditis.2,10,23 More recently, B. elizabethaewas isolated from an immunocompetent patient with endocarditis.18A reclassification of these four species in the genus bartonellawas proposed on the basis of their phenotypic and genotypiccharacteristics.24
The body louse, Pediculus humanus, has been recognized as thevector of B. quintana causing trench fever. Although the AmericanHIV-infected patients with B. quintana infection reported nocontact with animals or arthropods, one of them had been treatedfor scabies eight months before the isolation of B. quintana,3suggesting poor hygienic conditions. We isolated B. quintana,Toulouse strain, from a homeless patient with the acquired immunodeficiencysyndrome and cutaneous bacillary angiomatosis.6 This suggeststhat ectoparasites, which are frequently associated with poorhygienic conditions, may be the vector of B. quintana. However,we also isolated two strains from patients who were not homeless.7
Several serologic methods have been proposed for the diagnosisof trench fever,25,26,27 and serotyping of bartonella speciesin mice has been reported.28 The serologic studies in our threepatients were highly suggestive of infection due to B. quintana.Of 12,355 serum specimens tested in our laboratory for the presenceof B. quintana antibodies over the past 17 months, 70 (0.57percent) had IgG titers >1:100, and 31 serum samples (0.25percent) from 11 patients, including those described here, hadIgG titers >1:400. Thus, with the use of immunofluorescenceand blood-agargrown antigen, a cutoff value of 1:100for the IgG titer allows detection of B. quintana infection.All tested samples had higher IgG titers when tested againstendothelial-cellgrown antigen, which may be related tothe endothelial-cellassociated expression of one or severalantigens by B. quintana.
Our patients had substantial titers of IgG antibodies againstC. pneumoniae, which may have been related either to dual infectionwith chlamydia species and B. quintana or to a serologic cross-reactivitybetween chlamydia species and B. quintana. To the best of ourknowledge, there was no common source of exposure to chlamydiaspecies and B. quintana, and there was no evidence of chlamydialinfection in these patients, apart from the antibody titers.Therefore, the most likely explanation for the high titers ofIgG antibodies against C. pneumoniae is cross-reactivity betweenB. quintana and chlamydia species. After adsorption of the serumsamples by B. quintana antigen, the antibodies against C. pneumoniaedisappeared, confirming a cross-reaction. A similar cross-reactionreported between B. bacilliformis and C. psittaci was attributedto a lipopolysaccharide epitope.29
This cross-reactivity may be confusing, since both chlamydiaand bartonella species are implicated in infective endocarditis.30,31Serologic studies can support a presumptive diagnosis of endocarditiscaused by bartonella or chlamydia species, but a definitivediagnosis requires demonstration of the microorganism in bloodor a cardiac valve. We reviewed a series of 10 cases of endocarditisassociated with chlamydia species.31 Serum samples from nineof these patients were tested for B. quintana, and all had highlevel of antibodies.
The studies in the three patients described here add to theevidence that bartonella species, including B. quintana, B.henselae, and B. elizabethae, are etiologic agents of endocarditis.These organisms should be included in the differential diagnosisof culture-negative endocarditis.
Supported by a grant from the French Ministry of Health.
We are indebted to H. Tissot Dupont and J. Gouvernet for performingthe sequence analysis and to T.J. Marrie for reviewing the manuscript.
Source Information
From the Unité des Rickettsies, Faculté de Médecine, Marseilles (M.D., A.C., D.R.); Laboratoire de Microbiologie Médicale (J.L.M., F.G., J.A.) and Service de Cardiologie (F.L.), Hôpital Saint-Joseph, Paris; Service des Maladies Tropicales et Infectieuses, Hôpital Félix Houphouet-Boigny, Marseilles (P.B.); and Laboratoire de Bactériologie, Hôpital Louis Pradel, Lyons (F.V., J.E.) all in France. Supported by a grant from the French Ministry of Health.
Address reprint requests to Dr. Raoult at Unité des Rickettsies, Faculté de Médecine, Blvd. Jean Moulin, 13385 Marseilles CEDEX 5, France.
References
Vinson JW. In vitro cultivation of the rickettsial agent of trench fever. Bull World Health Organ 1966;35:155-164. [Medline]
Welch DF, Pickett DA, Slater LN, Steigerwalt AG, Brenner DJ. Rochalimaea henselae sp. nov., a cause of septicemia, bacillary angiomatosis, and parenchymal bacillary peliosis. J Clin Microbiol 1992;30:275-280. [Free Full Text]
Koehler JE, Quinn FD, Berger TG, LeBoit PE, Tappero JW. Isolation of rochalimaea species from cutaneous and osseous lesions of bacillary angiomatosis. N Engl J Med 1992;327:1625-1631. [Abstract]
Spach DH, Callis KP, Paauw DS, et al. Endocarditis caused by Rochalimaea quintana in a patient infected with human immunodeficiency virus. J Clin Microbiol 1993;31:692-694. [Free Full Text]
Larson AM, Dougherty MJ, Nowowiejski DJ, et al. Detection of Bartonella (Rochalimaea) quintana by routine acridine orange staining of broth blood cultures. J Clin Microbiol 1994;32:1492-1496. [Free Full Text]
Maurin M, Roux V, Stein A, Ferrier F, Viraben R, Raoult D. Isolation and characterization by immunofluorescence, sodium dodecyl sulfate-polyacrylamide gel electrophoresis, Western blot, restriction fragment length polymorphism-PCR, 16S rRNA gene sequencing, and pulsed-field gel electrophoresis of Rochalimaea quintana from a patient with bacillary angiomatosis. J Clin Microbiol 1994;32:1166-1171. [Free Full Text]
Raoult D, Drancourt M, Carta A, Gastaut JA. Bartonella (Rochalimaea) quintana isolation in patient with chronic adenopathy, lymphopenia, and a cat. Lancet 1994;343:977-977. [CrossRef][Medline]
Takahashi K, Sawasaki Y, Hata JI, Mukai K, Goto T. Spontaneous transformation and immortalization of human endothelial cells. In Vitro Cell Dev Biol 1990;26:265-274. [Medline]
Miller L, Berger T. Bacterial identification by gas chromatography of whole cell fatty acids. Avondale, Pa.: HewlettPackard, 1985. (HewlettPackard application note 228-41.)
Regnery RL, Anderson BE, Clarridge JE III, Rodriguez-Barradas MC, Jones DC, Carr JH. Characterization of a novel Rochalimaea species, R. henselae sp. nov., isolated from blood of a febrile, human immunodeficiency virus-positive patient. J Clin Microbiol 1992;30:265-274. [Free Full Text]
Hultman T, Stahl S, Hornes E, Uhlen M. Direct solid phase sequencing of genomic and plasmid DNA using magnetic beads as solid support. Nucleic Acids Res 1989;17:4937-4946. [Free Full Text]
Stein A, Raoult D. A simple method for amplification of DNA from paraffin-embedded tissues. Nucleic Acids Res 1992;20:5237-5238. [Free Full Text]
Weisburg WG, Barns SM, Pelletier DA, Lane DJ. 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 1991;173:697-703. [Free Full Text]
Dessen P, Fondrat C, Valencien C, Mugnier C. BISANCE: a French service for access to biomolecular sequence databases. Comput Appl Biosci 1990;6:355-356. [Free Full Text]
Higgins DG, Sharp PM. CLUSTAL: a package for performing multiple sequence alignment on a microcomputer. Gene 1988;73:237-244. [CrossRef][Medline]
Dumler JS, Brouqui P, Aronson J, Taylor JP, Walker DH. Identification of ehrlichia in human tissue. N Engl J Med 1991;325:1109-1110. [Medline]
Daly JS, Worthington MG, Brenner DJ, et al. Rochalimaea elizabethae sp. nov. isolated from a patient with endocarditis. J Clin Microbiol 1993;31:872-881. [Free Full Text]
Relman DA, Loutit JS, Schmidt TM, Falkow S, Tompkins LS. The agent of bacillary angiomatosis -- an approach to the identification of uncultured pathogens. N Engl J Med 1990;323:1573-1580. [Abstract]
Maurin M, Raoult D. Antimicrobial susceptibility of Rochalimaea quintana, Rochalimaea vinsonii, and the newly recognized Rochalimaea henselae. J Antimicrob Chemother 1993;32:587-594. [Free Full Text]
Swift HF. Trench fever. Arch Intern Med 1920;26:76-98. [Free Full Text]
Baker JA. A rickettsial infection in Canadian voles. J Exp Med 1946;84:37-50. [Abstract]
Hadfield TL, Warren R, Kass M, Brun E, Levy C. Endocarditis caused by Rochalimaea henselae. Hum Pathol 1993;24:1140-1141. [CrossRef][Medline]
Brenner DJ, O'Connor SP, Winkler HH, Steigerwalt AG. Proposals to unify the genera Bartonella and Rochalimaea, with descriptions of Bartonella quintana comb. nov., Bartonella vinsonii comb. nov., Bartonella henselae comb. nov., and Bartonella elizabethae comb. nov., and to remove the family Bartonellaceae from the order Rickettsiales. Int J Syst Bacteriol 1993;43:777-786. [Free Full Text]
Kostrzewski J. The epidemiology of trench fever. Med Dosw Mikrobiol 1950;11:233-263.
Myers WF, Wisseman CL Jr. Serologic studies of trench fever employing a microagglutination procedure. In: Proceedings of the International Symposium on the Control of Lice and Louse-borne Diseases. Washington, D.C.: Pan American Health Organization, 1973:79-81. (Scientific publication no. 263.)
Hollingdale MR, Herrmann JE, Vinson JW. Enzyme immunoassay of antibody to Rochalimaea quintana: diagnosis of trench fever and serologic cross-reactions among other rickettsiae. J Infect Dis 1978;137:578-582. [Medline]
Knobloch J, Bialek R, Müller G, Asmus P. Common surface epitope of Bartonella bacilliformis and Chlamydia psittaci. Am J Trop Med Hyg 1988;39:427-433.
Shapiro DS, Kenney SC, Johnson M, Davis CH, Knight ST, Wyrick PB. Chlamydia psittaci endocarditis diagnosed by blood culture. N Engl J Med 1992;326:1192-1195. [Medline]
Etienne J, Ory D, Thouvenot D, et al. Chlamydial endocarditis: a report on ten cases. Eur Heart J 1992;13:1422-1426. [Free Full Text]
Raoult, D., Abbara, S., Jassal, D. S., Kradin, R. L.
(2007). Case 5-2007 -- A 53-Year-Old Man with a Prosthetic Aortic Valve and Recent Onset of Fatigue, Dyspnea, Weight Loss, and Sweats. NEJM
356: 715-725
[Full Text]
Maggi, R. G., Duncan, A. W., Breitschwerdt, E. B.
(2005). Novel Chemically Modified Liquid Medium That Will Support the Growth of Seven Bartonella Species. J. Clin. Microbiol.
43: 2651-2655
[Abstract][Full Text]
Norris, W. M., Nielsen, E. L., Engelberg, R. A., Curtis, J. R.
(2005). Treatment Preferences for Resuscitation and Critical Care Among Homeless Persons. Chest
127: 2180-2187
[Abstract][Full Text]
Breitschwerdt, E. B., Hegarty, B. C., Maggi, R., Hawkins, E., Dyer, P.
(2005). Bartonella Species as a Potential Cause of Epistaxis in Dogs. J. Clin. Microbiol.
43: 2529-2533
[Abstract][Full Text]
ZNAZEN, A., ROLAIN, J.-M., HAMMAMI, N., KAMMOUN, S., HAMMAMI, A., RAOULT, D.
(2005). HIGH PREVALENCE OF BARTONELLA QUINTANA ENDOCARDITIS IN SFAX, TUNISIA. Am J Trop Med Hyg
72: 503-507
[Abstract][Full Text]
Breitkopf, C., Hammel, D., Scheld, H. H., Peters, G., Becker, K.
(2005). Impact of a Molecular Approach to Improve the Microbiological Diagnosis of Infective Heart Valve Endocarditis. Circulation
111: 1415-1421
[Abstract][Full Text]
Maggi, R. G., Breitschwerdt, E. B.
(2005). Potential Limitations of the 16S-23S rRNA Intergenic Region for Molecular Detection of Bartonella Species. J. Clin. Microbiol.
43: 1171-1176
[Abstract][Full Text]
Biddinger, P. D., Isselbacher, E. M., Fan, D., Shepard, J.-A. O.
(2005). Case 5-2005 - A 53-Year-Old Man with Depression and Sudden Shortness of Breath. NEJM
352: 709-716
[Full Text]
Fenollar, F., Sire, S., Raoult, D.
(2005). Bartonella vinsonii subsp. arupensis as an Agent of Blood Culture-Negative Endocarditis in a Human. J. Clin. Microbiol.
43: 945-947
[Abstract][Full Text]
Foucault, C., La Scola, B., Lindroos, H., Andersson, S. G. E., Raoult, D.
(2005). Multispacer Typing Technique for Sequence-Based Typing of Bartonella quintana. J. Clin. Microbiol.
43: 41-48
[Abstract][Full Text]
Elliott, T. S. J., Foweraker, J., Gould, F. K., Perry, J. D., Sandoe, J. A. T.
(2004). Guidelines for the antibiotic treatment of endocarditis in adults: report of the Working Party of the British Society for Antimicrobial Chemotherapy. J Antimicrob Chemother
54: 971-981
[Abstract][Full Text]
Avidor, B., Graidy, M., Efrat, G., Leibowitz, C., Shapira, G., Schattner, A., Zimhony, O., Giladi, M.
(2004). Bartonella koehlerae, a New Cat-Associated Agent of Culture-Negative Human Endocarditis. J. Clin. Microbiol.
42: 3462-3468
[Abstract][Full Text]
Rolain, J. M., Brouqui, P., Koehler, J. E., Maguina, C., Dolan, M. J., Raoult, D.
(2004). Recommendations for Treatment of Human Infections Caused by Bartonella Species. Antimicrob. Agents Chemother.
48: 1921-1933
[Full Text]
Rolain, J. M., Lecam, C., Raoult, D.
(2003). Simplified Serological Diagnosis of Endocarditis Due to Coxiella burnetii and Bartonella. CVI
10: 1147-1148
[Abstract][Full Text]
Chomel, B. B., Wey, A. C., Kasten, R. W.
(2003). Isolation of Bartonella washoensis from a Dog with Mitral Valve Endocarditis. J. Clin. Microbiol.
41: 5327-5332
[Abstract][Full Text]
Mann, P, Nye, F, Williams, G, Walker, A, Amadi, A
(2003). From trench fever to endocarditis. Postgrad. Med. J.
79: 655-656
[Abstract][Full Text]
Rovery, C., Rolain, J. M., Raoult, D., Brouqui, P.
(2003). Shell Vial Culture as a Tool for Isolation of Brucella melitensis in Chronic Hepatic Abscess. J. Clin. Microbiol.
41: 4460-4461
[Abstract][Full Text]
Foucault, C., Raoult, D., Brouqui, P.
(2003). Randomized Open Trial of Gentamicin and Doxycycline for Eradication of Bartonella quintana from Blood in Patients with Chronic Bacteremia. Antimicrob. Agents Chemother.
47: 2204-2207
[Abstract][Full Text]
Rolain, J. M., Gouriet, F., Enea, M., Aboud, M., Raoult, D.
(2003). Detection by Immunofluorescence Assay of Bartonella henselae in Lymph Nodes from Patients with Cat Scratch Disease. CVI
10: 686-691
[Abstract][Full Text]
Zeaiter, Z., Fournier, P.-E., Greub, G., Raoult, D.
(2003). Diagnosis of Bartonella Endocarditis by a Real-Time Nested PCR Assay Using Serum. J. Clin. Microbiol.
41: 919-925
[Abstract][Full Text]
Lamas, C C, Eykyn, S J
(2003). Blood culture negative endocarditis: analysis of 63 cases presenting over 25 years. Heart
89: 258-262
[Abstract][Full Text]
Rolain, J.-M., Maurin, M., Mallet, M.-N., Parzy, D., Raoult, D.
(2003). Culture and Antibiotic Susceptibility of Bartonella quintana in Human Erythrocytes. Antimicrob. Agents Chemother.
47: 614-619
[Abstract][Full Text]
Raoult, D., Fournier, P.-E., Vandenesch, F., Mainardi, J.-L., Eykyn, S. J., Nash, J., James, E., Benoit-Lemercier, C., Marrie, T. J.
(2003). Outcome and Treatment of Bartonella Endocarditis. Arch Intern Med
163: 226-230
[Abstract][Full Text]
Houpikian, P., Raoult, D.
(2003). Western Immunoblotting for Bartonella Endocarditis. CVI
10: 95-102
[Abstract][Full Text]
Maurin, M., Rolain, J. M., Raoult, D.
(2002). Comparison of In-House and Commercial Slides for Detection by Immunofluorescence of Immunoglobulins G and M against Bartonella henselae and Bartonella quintana. CVI
9: 1004-1009
[Abstract][Full Text]
Fournier, P.-E., Mainardi, J.-L., Raoult, D.
(2002). Value of Microimmunofluorescence for Diagnosis and Follow-up of Bartonella Endocarditis. CVI
9: 795-801
[Abstract][Full Text]
Jacomo, V., Kelly, P. J., Raoult, D.
(2002). Natural History of Bartonella Infections (an Exception to Koch's Postulate). CVI
9: 8-18
[Full Text]
Ciervo, A., Petrucca, A., Ciarrocchi, S., Pinto, A., Bonazzi, L., Fabio, A., Farnetti, E., Chomel, B. B., Ciceroni, L.
(2001). Molecular Characterization of First Human Bartonella Strain Isolated in Italy. J. Clin. Microbiol.
39: 4554-4557
[Abstract][Full Text]
Mylonakis, E., Calderwood, S. B.
(2001). Infective Endocarditis in Adults. NEJM
345: 1318-1330
[Full Text]
Chomel, B. B., Mac Donald, K. A., Kasten, R. W., Chang, C.-C., Wey, A. C., Foley, J. E., Thomas, W. P., Kittleson, M. D.
(2001). Aortic Valve Endocarditis in a Dog Due to Bartonella clarridgeiae. J. Clin. Microbiol.
39: 3548-3554
[Abstract][Full Text]
De La Rosa, G. R., Barnett, B. J., Ericsson, C. D., Turk, J. B.
(2001). Native Valve Endocarditis Due to Bartonella henselae in a Middle-Aged Human Immunodeficiency Virus-Negative Woman. J. Clin. Microbiol.
39: 3417-3419
[Abstract][Full Text]
Houpikian, P., Raoult, D.
(2001). 16S/23S rRNA Intergenic Spacer Regions for Phylogenetic Analysis, Identification, and Subtyping of Bartonella Species. J. Clin. Microbiol.
39: 2768-2778
[Abstract][Full Text]
Liang, Z., La Scola, B., Lepidi, H., Raoult, D.
(2001). Production of Bartonella Genus-Specific Monoclonal Antibodies. CVI
8: 847-849
[Abstract][Full Text]
Fournier, P.-E., Minnick, M. F., Lepidi, H., Salvo, E., Raoult, D.
(2001). Experimental Model of Human Body Louse Infection Using Green Fluorescent Protein-Expressing Bartonella quintana. Infect. Immun.
69: 1876-1879
[Abstract][Full Text]
Bruneval, P, Choucair, J, Paraf, F, Casalta, J-P, Raoult, D, Scherchen, F, Mainardi, J-L
(2001). Detection of fastidious bacteria in cardiac valves in cases of blood culture negative endocarditis. J. Clin. Pathol.
54: 238-240
[Abstract][Full Text]
Renesto, P., Gouvernet, J., Drancourt, M., Roux, V., Raoult, D.
(2001). Use of rpoB Gene Analysis for Detection and Identification of Bartonella Species. J. Clin. Microbiol.
39: 430-437
[Abstract][Full Text]
Brouqui, P., Raoult, D.
(2001). Endocarditis Due to Rare and Fastidious Bacteria. Clin. Microbiol. Rev.
14: 177-207
[Abstract][Full Text]
Rolain, J.-M., Maurin, M., Raoult, D.
(2000). Bactericidal effect of antibiotics on Bartonella and Brucella spp.: clinical implications. J Antimicrob Chemother
46: 811-814
[Abstract][Full Text]
Chang, C.-C., Kasten, R. W., Chomel, B. B., Simpson, D. C., Hew, C. M., Kordick, D. L., Heller, R., Piemont, Y., Breitschwerdt, E. B.
(2000). Coyotes (Canis latrans) as the Reservoir for a Human Pathogenic Bartonella sp.: Molecular Epidemiology of Bartonella vinsonii subsp. berkhoffii Infection in Coyotes from Central Coastal California. J. Clin. Microbiol.
38: 4193-4200
[Abstract][Full Text]
Drancourt, M., Bollet, C., Carlioz, A., Martelin, R., Gayral, J.-P., Raoult, D.
(2000). 16S Ribosomal DNA Sequence Analysis of a Large Collection of Environmental and Clinical Unidentifiable Bacterial Isolates. J. Clin. Microbiol.
38: 3623-3630
[Abstract][Full Text]
Kerkhoff, F T, Rothova, A
(2000). Bartonella henselae associated uveitis and HLA-B27. Br J Ophthalmol
84: 1125-1129
[Abstract][Full Text]
Handley, S. A., Regnery, R. L.
(2000). Differentiation of Pathogenic Bartonella Species by Infrequent Restriction Site PCR. J. Clin. Microbiol.
38: 3010-3015
[Abstract][Full Text]
Maurin, M., Raoult, D.
(2000). Isolation in Endothelial Cell Cultures of Chlamydia trachomatis LGV (Serovar L2) from a Lymph Node of a Patient with Suspected Cat Scratch Disease. J. Clin. Microbiol.
38: 2062-2064
[Abstract][Full Text]
Liang, Z., Raoult, D.
(2000). Species-Specific Monoclonal Antibodies for Rapid Identification of Bartonella quintana. CVI
7: 21-24
[Abstract][Full Text]
Matar, G. M., Koehler, J. E., Malcolm, G., Lambert-Fair, M. A., Tappero, J., Hunter, S. B., Swaminathan, B.
(1999). Identification of Bartonella Species Directly in Clinical Specimens by PCR-Restriction Fragment Length Polymorphism Analysis of a 16S rRNA Gene Fragment. J. Clin. Microbiol.
37: 4045-4047
[Abstract][Full Text]
Breitschwerdt, E. B., Atkins, C. E., Brown, T. T., Kordick, D. L., Snyder, P. S.
(1999). Bartonella vinsonii subsp. berkhoffii and Related Members of the Alpha Subdivision of the Proteobacteria in Dogs with Cardiac Arrhythmias, Endocarditis, or Myocarditis. J. Clin. Microbiol.
37: 3618-3626
[Abstract][Full Text]
Raoult, D.
(1999). Afebrile Blood Culture-Negative Endocarditis. ANN INTERN MED
131: 144-146
[Full Text]
Fenollar, F., Raoult, D.
(1999). Diagnosis of Rickettsial Diseases Using Samples Dried on Blotting Paper. CVI
6: 483-488
[Abstract][Full Text]
La Scola, B., Raoult, D.
(1999). Culture of Bartonella quintana and Bartonella henselae from Human Samples: a 5-Year Experience (1993 to 1998). J. Clin. Microbiol.
37: 1899-1905
[Abstract][Full Text]
Holmberg, M., McGill, S., Ehrenborg, C., Wesslén, L., Hjelm, E., Darelid, J., Blad, L., Engstrand, L., Regnery, R., Friman, G.
(1999). Evaluation of Human Seroreactivity to Bartonella Species in Sweden. J. Clin. Microbiol.
37: 1381-1384
[Abstract][Full Text]
Roux, V., Raoult, D.
(1999). Body Lice as Tools for Diagnosis and Surveillance of Reemerging Diseases. J. Clin. Microbiol.
37: 596-599
[Abstract][Full Text]
Skolnik, P. R., Mark, E. J.
(1999). Case 5-1999- A 37-Year-Old Man with Fever and Diffuse Lymphadenopathy. NEJM
340: 545-554
[Full Text]
Bayer, A. S., Bolger, A. F., Taubert, K. A., Wilson, W., Steckelberg, J., Karchmer, A. W., Levison, M., Chambers, H. F., Dajani, A. S., Gewitz, M. H., Newburger, J. W., Gerber, M. A., Shulman, S. T., Pallasch, T. J., Gage, T. W., Ferrieri, P.
(1998). Diagnosis and Management of Infective Endocarditis and Its Complications. Circulation
98: 2936-2948
[Full Text]
McGill, S. L., Regnery, R. L., Karem, K. L.
(1998). Characterization of Human Immunoglobulin (Ig) Isotype and IgG Subclass Response to Bartonella henselae Infection. Infect. Immun.
66: 5915-5920
[Abstract][Full Text]
Breitschwerdt, E. B., Hegarty, B. C., Hancock, S. I.
(1998). Sequential Evaluation of Dogs Naturally Infected with Ehrlichia canis, Ehrlichia chaffeensis, Ehrlichia equi, Ehrlichia ewingii, or Bartonella vinsonii. J. Clin. Microbiol.
36: 2645-2651
[Abstract][Full Text]
Parrott, J. H., Dure, L., Sullender, W., Buraphacheep, W., Frye, T. A., Galliani, C. A., Marston, E., Jones, D., Regnery, R.
(1997). Central Nervous System Infection Associated With Bartonella quintana: A Report of Two Cases. Pediatrics
100: 403-403
[Full Text]
Jacoby, G. A., Hay, C. M.
(1997). Case 2-1997- A 38-Year-Old Man with Digital Clubbing, Low-Grade Fever, and a Murmur. NEJM
336: 205-210
[Full Text]
Comer, J. A., Flynn, C., Regnery, R. L., Vlahov, D., Childs, J. E.
(1996). Antibodies to Bartonella Species in Inner-city Intravenous Drug Users in Baltimore, Md. Arch Intern Med
156: 2491-2495
[Abstract]
Walker, D. H., Barbour, A. G., Oliver, J. H., Lane, R. S., Dumler, J. S., Dennis, D. T., Persing, D. H., Azad, A. F., McSweegan, E.
(1996). Emerging Bacterial Zoonotic and Vector-Borne Diseases: Ecological and Epidemiological Factors. JAMA
275: 463-469
[Abstract]
(1995). THE RETURN OF TRENCH FEVER. JWatch General
1995: 5-5
[Full Text]
Relman, D. A.
(1995). Has Trench Fever Returned?. NEJM
332: 463-464
[Full Text]