The Genetic Basis of the Reduced Expression of Bilirubin UDP-Glucuronosyltransferase 1 in Gilbert's Syndrome
Piter J. Bosma, Ph.D., Jayanta Roy Chowdhury, M.D., Conny Bakker, Shailaja Gantla, Ph.D., Anita de Boer, Ben A. Oostra, Ph.D., Dick Lindhout, Ph.D., Guido N.J. Tytgat, M.D., Peter L.M. Jansen, M.D., Ph.D., Ronald P.J. Oude Elferink, Ph.D., and Namita Roy Chowdhury, Ph.D.
Background People with Gilbert's syndrome have mild, chronicunconjugated hyperbilirubinemia in the absence of liver diseaseor overt hemolysis. Hepatic glucuronidating activity, essentialfor efficient biliary excretion of bilirubin, is reduced toabout 30 percent of normal.
Methods We sequenced the coding and promoter regions of thegene for bilirubin UDP-glucuronosyltransferase 1 (bilirubin/uridinediphosphoglucuronate-glucuronosyltransferase 1) — theonly enzyme that contributes substantially to bilirubin glucuronidation— in 10 unrelated patients with Gilbert's syndrome, 16members of a kindred with a history of Crigler–Najjarsyndrome type II, and 55 normal subjects.
Results The coding region of the gene for the enzyme was normalin the 10 patients with Gilbert's syndrome. These patients werehomozygous for two extra bases (TA) in the TATAA element ofthe 5' promoter region of the gene (A(TA)7TAA rather than thenormal A(TA)6TAA). The presence of the longer TATAA elementresulted in the reduced expression of a reporter gene, encodingfirefly luciferase, in a human hepatoma cell line. The frequencyof the abnormal allele was 40 percent among the normal subjects.The 3 men in the control group who were homozygous for the longerTATAA element had significantly higher serum bilirubin levelsthan the other 52 normal subjects (P = 0.009). Among the kindredwith a history of Crigler–Najjar syndrome type II, onlythe six heterozygous carriers who had a longer TATAA elementon the structurally normal allele had mild hyperbilirubinemia,characteristic of Gilbert's syndrome.
Conclusions Reduced expression of bilirubin UDP-glucuronosyltransferase1 due to an abnormality in the promoter region of the gene forthis enzyme appears to be necessary for Gilbert's syndrome butnot sufficient for the complete manifestation of the syndrome.
People with Gilbert's syndrome have mild, chronic unconjugatedhyperbilirubinemia in the absence of liver disease or overthemolysis.1,2 Although the syndrome is inherited, many peopledo not have a clear family history.3 An autosomal mode of inheritancehas been proposed,4 and more recently, a recessive pattern ofinheritance has been suggested.5 On the basis of serum bilirubinlevels, 3 to 10 percent of the general population are estimatedto have Gilbert's syndrome.6,7,8 Serum bilirubin levels fluctuatein people with Gilbert's syndrome and often fall within acceptednormal limits, making it unclear whether these people constitutea distinct subpopulation6 or whether their bilirubin valuesrepresent the upper end of the normal distribution curve.7,8Gilbert's syndrome is considered harmless in adults, althoughan incidental finding of hyperbilirubinemia may raise the possibilityof liver disease and sometimes trigger unnecessary investigations.It is not known whether the syndrome has a role in exaggeratedneonatal jaundice.
Hepatic glucuronidating activity, which is essential for efficientbiliary excretion of bilirubin, is approximately 30 percentof normal in patients with Gilbert's syndrome.9,10 The reducedglucuronidation results in an increased proportion of bilirubinmonoglucuronide in bile.11 In human liver, bilirubin glucuronidationis mediated by one specific isoform of microsomal bilirubin,UDP-glucuronosyltransferase (bilirubin/uridine diphosphoglucuronate-glucuronosyltransferase).Of the two isoforms reported,12,13 only bilirubin UDP-glucuronosyltransferase1 contributes substantially to bilirubin glucuronidation.14
Genetic lesions causing an absence of enzymatic bilirubin glucuronidationresult in Crigler–Najjar syndrome type I,2,15,16,17,18,19,20,21whereas mutations causing severe deficiency of the enzyme resultin Crigler–Najjar syndrome type II.22,23,24 Because mildhyperbilirubinemia is often found among relatives of patientswith Crigler–Najjar syndrome, some have postulated thatGilbert's syndrome represents a heterozygous form of Crigler–Najjarsyndrome.25,26 However, many carriers of Crigler–Najjarsyndrome do not have hyperbilirubinemia,22 and the incidenceof Gilbert's syndrome is much higher than that expected on thebasis of the number of heterozygous carriers of Crigler–Najjarsyndrome, which is 1 per 1 million births.
We studied the genetic basis of reduced hepatic bilirubin glucuronidationin people with Gilbert's syndrome and found that a variant TATAAelement (which contains two extra nucleotides, TA) in the upstreampromoter region of the gene for bilirubin UDP-glucuronosyltransferase1 is associated with the syndrome. The TATAA element is thebinding site for transcription factor IID, which is importantin the initiation of transcription.27,28,29,30,31 The presenceof this longer TATAA element in the promoter region of the genefor bilirubin UDP-glucuronosyltransferase 1 resulted in reducedexpression of a reporter gene, encoding firefly luciferase,in a human hepatoma cell line. The presence of the longer TATAAelement correlated with higher mean serum bilirubin levels innormal, healthy subjects and in compound heterozygous carriersof Crigler–Najjar syndrome type II.
Methods
Patients with Gilbert's Syndrome
We studied 10 patients with Gilbert's syndrome, ranging from15 to 54 years of age. Blood was collected from all 10 afterthey provided informed consent. Criteria for the diagnosis ofGilbert's syndrome included a consistent mild elevation of serumbilirubin (level, 1.2 to 5.3 mg per deciliter [20 to 90 µmolper liter]). The bilirubin was at least 90 percent unconjugatedaccording to van den Bergh's test and 99 percent unconjugatedon the basis of high-performance liquid chromatography. Serumalanine aminotransferase and aspartate aminotransferase valueswere normal. Hemolysis was excluded on the basis of normal hemoglobinand haptoglobin values and reticulocyte counts. Three patientswere given a 400-kcal diet for 24 hours, which doubled theirserum bilirubin levels. Two patients underwent duodenal aspirationfor bile-pigment analysis by high-performance liquid chromatography32;in both, monoglucuronide made up 30 percent of bilirubin conjugates.33
Subjects from a Kindred with Crigler–Najjar Syndrome Type II
We examined 2 patients with Crigler–Najjar syndrome typeII, 10 heterozygous carriers, and 4 family members who werenot carriers from a kindred with a history of the syndrome.Both patients were homozygous for a structural mutation thatmarkedly reduced the catalytic activity of bilirubin UDP-glucuronosyltransferase.22,24Four of the 10 heterozygous carriers had mild hyperbilirubinemia.All provided informed consent.
Control Subjects
We examined 55 normal subjects (28 women and 27 men; age, 21to 55 years) with no known history of jaundice. All providedinformed consent. Serum bilirubin was measured in samples collectedon two different days.34 In our laboratory the upper limit ofnormal for serum bilirubin is 1.0 mg per deciliter (17.1 µmolper liter). For samples with a serum bilirubin level of 0.9mg per deciliter (15.4 µmol per liter), less than 5 percentvariation is found between samples collected on two differentdays.
Nucleotide Sequencing of Coding and Upstream Regions of the Gene for Bilirubin UDP-Glucuronosyltransferase 1
Genomic DNA was isolated from lymphocytes and the five exonsconstituting the coding region of the gene for bilirubin UDP-glucuronosyltransferase1, and their flanking intron–exon junctions were amplifiedby the polymerase chain reaction (PCR) and sequenced as described.15The segment of DNA 5' to the coding region (from nucleotide-227 to nucleotide 132) was amplified with a sense primer, 5'GAGGTTCTGGAAGTACTTTGC3',and an antisense primer, 5'CCAAGCATGCTCAGCCAG3'. PCR was performedfor 30 cycles consisting of denaturation at 95°C for 30seconds, annealing at 56°C for 30 seconds, and extensionat 72°C for 30 seconds, with 1.5 mmol of magnesium chlorideper liter used as a buffer. Both strands of the amplified segmentwere sequenced with two internal primers.
Functional Evaluation of the Variant Tataa Element
A fragment of the upstream region (from nucleotide -546 to nucleotide-4) of the bilirubin UDP-glucuronosyltransferase 1 gene wasamplified by PCR with genomic DNA from a subject homozygousfor the long TATAA element, A(TA)7TAA, and from a subject homozygousfor the normal TATAA element, A(TA)6TAA. Amplimers were designedto introduce a XhoI and a HindIII site at the 5' and 3' endsof the amplicon (amplified product), respectively. The two ampliconswere cloned in appropriate orientation in the XhoI and HindIIIsites 5' to the entire coding region of firefly luciferase geneof the plasmid pXP1, which lacks a promoter region. The nucleotidesequences of both constructs were identical except for the additionof two bases in the longer TATAA box. A plasmid, pSV-lacZ (Promega,Madison, Wis.), containing the structural region of bacterial-galactosidase driven by the promoter of the large transformingantigen of simian virus 40, was used to determine the efficiencyof transfection. Cells from a well-differentiated human hepatomacell line (HuH7) were grown to 40 percent confluence in RPMImedium containing 4 percent fetal-calf serum. The cells werecotransfected with 1.5 µg each of the test luciferaseconstruct and pSV-lacZ with Lipofectin (GIBCO-BRL, Gaithersburg,Md.). After the cells were harvested, luciferase activity wasdetermined with a Promega luciferase assay system. Protein content35and o-aminophenol--galactosidase activity36 were determinedas described previously.
Statistical Analysis
Mean serum bilirubin values were compared by analysis of varianceor a two-tailed nonparametric Wilcoxon test.37 Statistical analyseswere performed with Sigma Stat for Windows.
Results
Patients with Gilbert's Syndrome
In four unrelated patients with Gilbert's syndrome, the nucleotidesequences of all five exons encoding the gene for bilirubinUDP-glucuronosyltransferase 1 and all intron–exon junctionswere normal, indicating that the syndrome in these patientswas not caused by structural mutations. To investigate whetheran abnormality of the promoter region caused reduced expressionof the normal enzyme, we determined the sequence of a 247-nucleotideregion immediately upstream of the translation-initiation codon.Normally, an A(TA)6TAA element is present between nucleotides-23 and -38.13 All four of the patients were homozygous foran additional TA in this element, resulting in the sequenceA(TA)7TAA (Figure 1). Subsequently, we sequenced this regionin six additional unrelated patients with Gilbert's syndrome,all of whom were found to be homozygous for the additional TA.
Figure 1. Length of the TATAA Element in the Promoter Region of the Gene for Bilirubin UDP-Glucuronosyltransferase 1.
The upstream region of the gene for bilirubin UDP-glucuronosyltransferase 1 was amplified with specific primers and sequenced directly. The sample on the left (lanes 1 through 4) is from a subject homozygous for the normal TATAA element (A(TA)6TAA), and the sample on the right (lanes 5 through 8) is from a subject homozygous for the variant element (A(TA)7TAA). Both TATAA elements are boxed.
Effect of the Longer TATAA Element on Gene Expression
To determine the effect of the longer TATAA element on geneexpression, a 542-base-pair (bp) region upstream of the gene,which contained A(TA)6TAA, and a 544-bp region containing A(TA)7TAAwere each linked upstream to a firefly luciferase gene, andthe construct was transfected into a human hepatoma cell line(HuH7). To assess the efficiency of transfection, a -galactosidaseexpression vector, driven by a viral promoter, was cotransfected.The expression of both reporter genes was assessed in four experiments;the mean results of the four experiments are shown in Figure 2.The expression of luciferase in the presence of the longerTATAA element was only 18 to 33 percent of that recorded inthe presence of the normal TATAA element. There was no significantdifference in the level of expression of the cotransfected o-aminophenol--galactosidase.
Figure 2. Functional efficiency of Bilirubin UDP-Glucuronosyltransferase 1, According to Whether the Promoter Region of the Gene Contained the Normal or the Variant TATAAElement.
A 542-bp segment of DNA located upstream of exon 1A of the gene for bilirubin UDP-glucuronosyltransferase 1 containing the normal TATAA element (A(TA)6TAA) and a 544-bp segment containing the variant element (A(TA)7TAA) were cloned upstream of the coding region of the firefly luciferase gene. Each construct was cotransfected by PCR into a human hepatoma cell line (HuH7) with pSV-lacZ with use of Lipofectin. Forty-eight hours later, luciferase activity and o-aminophenol--galactosidase activity were assayed with the use of various amounts of lysate protein. The mean (±SD) results of four experiments are shown.
Normal Subjects
The frequency of the two TATAA elements was determined in 55normal subjects. Eight were homozygous for A(TA)7TAA, 19 werehomozygous for A(TA)6TAA, and 28 were heterozygous. The calculatedallele frequency for the longer TATAA element was 40 percent.The mean serum bilirubin levels (mean of values in blood samplesobtained on two different days) were 0.5 mg per deciliter (8.3µmol per liter) in the subjects who were homozygous forA(TA)6TAA, 0.6 mg per deciliter (10.4 µmol per liter)in the heterozygotes, and 0.8 mg per deciliter (12.8 µmolper liter) in the subjects who were homozygous for A(TA)7TAA(Figure 3). The mean serum bilirubin levels were significantlyhigher (P = 0.009) in the 3 men who were homozygous for A(TA)7TAAthan in the other normal subjects (1.0 mg per deciliter [17.1µmol per liter] vs. 0.6 mg per deciliter in the other52 subjects and 0.7 mg per deciliter [11.2 µmol per liter]in the other 24 normal men), whereas the mean values in the5 women who were homozygous for A(TA)7TAA did not differ significantlyfrom those in the subjects who were homozygous for A(TA)6TAA(0.6 mg per deciliter vs. 0.5 mg per deciliter [8.3 µmolper liter]).
Figure 3. Correlation between Serum Bilirubin Levels and the Length of the TATAA Element in the Promoter Region of the Gene for Bilirubin UDP-Glucuronosyltransferase 1 in 55 Normal Subjects.
Eight subjects were homozygous for the short TATAA element (A(TA)6TAA), 19 were homozygous for the long TATAA element (A(TA)7TAA), and 28 were heterozygous. Each point represents the mean serum bilirubin value for a subject as determined independently on two different days. Circles denote female subjects, and triangles male subjects. The mean values in all three groups are shown. Analysis of variance showed that the mean serum bilirubin values differed significantly between groups (P = 0.012); uncorrected P values: P = 0.033 for the comparison of A(TA)6TAA homozygotes with heterozygotes; P = 0.008 for the comparison of A(TA)6TAA homozygotes with A(TA)7TAA homozygotes; and P = 0.164 for the comparison of heterozygotes with A(TA)7TAA homozygotes. To convert values for serum bili-rubin to micromoles per liter, multiply by 17.1.
Kindred with Crigler–Najjar Syndrome Type II
In a large kindred with a history of Crigler–Najjar syndrometype II,22 2 family members with the syndrome who were homozygousfor a structural mutation that reduces the catalytic activityof bilirubin UDP-glucuronosyltransferase to 4 percent of normal24were studied, as were 10 family members who were heterozygousfor this mutation (carriers) and 4 family members who were notcarriers (Table 1). The coding region of the second allele forthe bilirubin UDP-glucuronosyltransferase 1 gene was normalin the heterozygotes. Determination of the sequence analyzedin the upstream region revealed that both patients with Crigler–Najjarsyndrome type II were homozygous for A(TA)6TAA, indicating thatthe structurally mutated allele contains a normal promoter.In six of the heterozygous carriers, the structurally normalallele contained the long TATAA element, A(TA)7TAA, whereasin four the short element was present. The six heterozygoteswith the promoter abnormality had significantly higher serumbilirubin values than the four with the normal TATAA element(1.6 mg per deciliter [27.4 µmol per liter] vs. 0.6 mgper deciliter, P = 0.01).
Table 1. Association of the Length of the TATAA Element Present in the Alleles for Bilirubin UDP-Glucuronosyltransferase 1 with Serum Bilirubin Levels in a Kindred with a History of Crigler–Najjar Syndrome Type II.
Discussion
We investigated the genetic mechanism of reduced bilirubin UDP-glucuronosyltransferase1 activity in Gilbert's syndrome. The absence of any mutationin the coding region of the gene in four consecutive unrelatedpatients indicates that the decreased bilirubin glucuronidationis not due to a structural alteration of the enzyme. The presenceof a long TATAA element, containing an extra TA, in both allelesin these four patients and in six additional patients with Gilbert'ssyndrome suggested the involvement of this variant promoterin the reduced expression of the enzyme. As the binding sitefor transcription factor IID, the TATAA element has an importantrole in the initiation of transcription,27,28,29,30,31 and itsmutation can result in reduced frequency and accuracy of transcriptioninitiation.30,31 Our functional studies showed that the presenceof the longer TATAA element in the upstream regulatory regionof the gene reduces the expression of a reporter gene in a humanhepatoma cell line. Together, these results suggest that thedecreased bilirubin glucuronidating activity in Gilbert's syndromeresults from reduced expression of the bilirubin glucuronidatingenzyme.
All 10 patients with Gilbert's syndrome were homozygous forthe longer TATAA element, suggesting that reduced expressionof bilirubin UDP-glucuronosyltransferase 1 is essential forthe syndrome. However, a mild reduction in the enzyme is notalways sufficient for the full manifestation of the phenotype.Our results indicate that as much as 16 percent of the populationshould be homozygous for the long TATAA element, whereas only3 to 10 percent of the general population have clinically diagnosedGilbert's syndrome.6,7,8 Among the normal subjects, only menwho were homozygous for the longer TATAA element had significantelevations in serum bilirubin levels, reflecting a greater bilirubinload in men per kilogram of body weight or the inhibition ofenzymatic glucuronidation by androgenic steroids (or both).38This finding is consistent with the high male-to-female ratioamong patients with diagnosed Gilbert's syndrome.4,8 The presenceof other inherited or acquired factors affecting bilirubin metabolism,in addition to reduced glucuronidation, may result in the fullmanifestation of the syndrome. In some patients, impaired hepaticuptake of bilirubin has been found.33,39,40 Although hemolysisis not part of the syndrome, many patients who consult physiciansmay have a high bilirubin load because of a slightly reducederythrocyte life span.41 Fasting may also increase the bilirubinload,42,43 and the resulting hyperbilirubinemia may be exaggeratedin patients with Gilbert's syndrome44 because of the reducedexpression of the glucuronidating enzyme.
Gilbert's syndrome runs in families,3 although only one familymember may have jaundice.2 Both autosomal dominant3 and autosomalrecessive5 modes of inheritance have been proposed. Becausehomozygosity for A(TA)7TAA appears to be a requirement for thesyndrome, our findings suggest an autosomal recessive mode ofinheritance, whereas the high frequency of the structurallymutated allele may explain the appearance of a pseudodominantpattern of inheritance in some instances.
Our results also help to explain the high incidence of mildhyperbilirubinemia in relatives of patients with Crigler–Najjarsyndrome. Heterozygous carriers of Crigler–Najjar syndromehave one structurally normal allele and would be expected tohave bilirubin glucuronidating activity that is at least 50percent of normal, so that normal serum bilirubin levels wouldbe maintained. However, when this structurally normal allelecontains the longer TATAA element, the decreased expressionof bilirubin UDP-glucuronosyltransferase 1 results in hyperbilirubinemia.
In summary, reduced expression of bilirubin UDP-glucuronosyltransferase1 due to an abnormality in the promoter region of the gene appearsto be necessary for Gilbert's syndrome but is not sufficientfor the complete manifestation of the condition.
Supported in part by grants from the National Institutes ofHealth (RO1-DK39137 to Dr. N. Chowdhury, RO1-DK46057 to Dr.J. Chowdhury, and P30-DK41296).
We are indebted to B. Goldhoorn and T. Out for technical assistancein DNA purification and sequence determination.
Source Information
From the Department of Gastroenterology and Hepatology, Academic Medical Center, Amsterdam, the Netherlands (P.J.B., C.B., A.B., G.N.J.T., R.P.J.O.E.); Marion Bessin Liver Research Center, Division of Gastroenterology and Liver Diseases, Departments of Medicine and Molecular Genetics, Albert Einstein College of Medicine, Bronx, N.Y. (J.R.C., S.G., N.R.C.); the Department of Clinical Genetics, Erasmus University, Rotterdam, the Netherlands (B.A.O., D.L.); and the Department of Gastroenterology and Hepatology, Academic Hospital Groningen, Groningen, the Netherlands (P.L.M.J.).
Address reprint requests to Dr. Bosma at FO-116, Academic Medical Center, Meibergdreef 9, 1105 AZ, Amsterdam, the Netherlands.
References
Gilbert A, Lereboullet P. La cholémie simple familiale. Semaine Med 1901;21:241-3.
Chowdhury JR, Chowdhury NR, Wolkoff AW, Arias JM. Heme and bile pigment metabolism. In: Arias IM, Boyer JL, Fausto N, Jakoby WB, Schachter DA, Schafritz DA, eds. The liver: biology and pathobiology. 3rd ed. New York: Raven Press, 1994:471-504.
Thompson RPH. Genetic transmission of Gilbert's syndrome. In: Okolicsanyi L, ed. Familial hyperbilirubinemia. New York: John Wiley, 1981:91-7.
Powell LW, Hemingway E, Billing BH, Sherlock S. Idiopathic unconjugated hyperbilirubinemia (Gilbert's syndrome): a study of 42 families. N Engl J Med 1967;277:1108-1112.
Owens IS, Ritter JK. The novel bilirubin/phenol UDP-glucuronosyltransferase UGT1 gene locus: implications for multiple nonhemolytic familial hyperbilirubinemia phenotypes. Pharmacogenetics 1992;2:93-108. [Medline]
Owens D, Evans J. Population studies on Gilbert's syndrome. J Med Genet 1975;12:152-156. [Free Full Text]
Bailey A, Robinson D, Dawson AM. Does Gilbert's disease exist? Lancet 1977;1:931-933. [Medline]
Sieg A, Arab L, Schlierf G, Stiehl A, Kommerell B. Die Prävalenz des Gilbert-Syndroms in Deutschland. Dtsch Med Wochenschr 1987;112:1206-1208. [Medline]
Arias IM, London IM. Bilirubin glucuronide formation in vitro: demonstration of a defect in Gilbert's disease. Science 1957;126:563-564. [Free Full Text]
Black M, Billing BH. Hepatic bilirubin UDP-glucuronyl transferase activity in liver disease and Gilbert's syndrome. N Engl J Med 1969;280:1266-1271.
Fevery J, Blanckaert N, Heirwegh KPM, Preaux A-M, Berthelot P. Unconjugated bilirubin and an increased proportion of bilirubin monoconjugates in the bile of patients with Gilbert's syndrome and Crigler-Najjar disease. J Clin Invest 1977;60:970-979.
Ritter JK, Crawford JM, Owens IS. Cloning of two human liver bilirubin UDP-glucuronosyltransferase cDNAs with expression in COS-1 cells. J Biol Chem 1991;266:1043-1047. [Free Full Text]
Ritter JK, Chen F, Sheen YY, et al. A novel complex locus UGT1 encodes human bilirubin, phenol, and other UDP-glucuronosyltransferase isozymes with identical carboxyl termini. J Biol Chem 1992;267:3257-3261. [Free Full Text]
Bosma PJ, Seppen J, Goldhoorn B, et al. Bilirubin UDP-glucuronosyltransferase 1 is the only relevant bilirubin glucuronidating isoform in man. J Biol Chem 1994;269:17960-17964. [Erratum, J Biol Chem 1994;269(41):2542.] [Free Full Text]
Bosma PJ, Chowdhury NR, Goldhoorn BG, et al. Sequence of exons and the flanking regions of human bilirubin-UDP-glucuronosyltransferase gene complex and identification of a genetic mutation in a patient with Crigler-Najjar syndrome, type I. Hepatology 1992;15:941-947. [Medline]
Bosma PJ, Chowdhury JR, Huang TJ, et al. Mechanisms of inherited deficiencies of multiple UDP-glucuronosyltransferase isoforms in two patients with Crigler-Najjar syndrome, type I. FASEB J 1992;6:2859-2863. [Abstract]
Ritter JK, Yeatman MT, Ferreira P, Owens IS. Identification of a genetic alteration in the code for bilirubin UDP-glucuronosyltransferase in the UGT1 gene complex of a Crigler-Najjar type I patient. J Clin Invest 1992;90:150-155.
Moghrabi N, Clarke DJ, Burchell B, Boxer M. Cosegregation of intragenic markers with a novel mutation that causes Crigler-Najjar syndrome type I: implication in carrier detection and prenatal diagnosis. Am J Hum Genet 1993;53:722-729. [Medline]
Ritter JK, Yeatman MT, Kaiser C, Gridelli B, Owens IS. A phenylalanine codon deletion at the UGT1 gene complex locus of a Crigler-Najjar type I patient generates a pH-sensitive bilirubin UDP-glucuronosyltransferase. J Biol Chem 1993;268:23573-23579. [Free Full Text]
Labrune P, Myara A, Hadchouel M, et al. Genetic heterogeneity of Crigler-Najjar syndrome type I: a study of 14 cases. Hepatology 1993;18:126A-126A.abstract
Erps LT, Ritter JK, Hersh JH, Blossom D, Martin NC, Owens IS. Identification of the two single base substitutions in the UGT1 gene locus which abolish bilirubin uridine diphosphate glucuronosyltransferase activity in vitro. J Clin Invest 1994;93:564-570.
Bosma PJ, Goldhoorn B, Oude Elferink RP, Sinaasappel M, Oostra BA, Jansen PLM. A mutation in bilirubin uridine 5'-diphosphate-glucuronosyltransferase isoform 1 causing Crigler-Najjar syndrome type II. Gastroenterology 1993;105:216-220. [Medline]
Moghrabi N, Clarke DJ, Boxer M, Burchell B. Identification of an A-to-G missense mutation in exon 2 of the UGT1 gene complex that causes Crigler-Najjar syndrome type 2. Genomics 1993;18:171-173. [CrossRef][Medline]
Seppen J, Bosma PJ, Goldhoorn BG, et al. Discrimination between Crigler-Najjar syndrome type I and II by expression of mutant bilirubin uridine diphosphate-glucuronosyltransferase. J Clin Invest 1994;94:2385-2391.
Arias IM, Gartner LM, Cohen M, Ezzer JB, Levi AJ. Chronic nonhemolytic unconjugated hyperbilirubinemia with glucuronosyltransferase deficiency: clinical, biochemical, pharmacologic and genetic evidence for heterogeneity. Am J Med 1969;47:395-409. [CrossRef][Medline]
Hunter JO, Thompson RPH, Dunn PM, Williams R. Inheritance of type 2 Crigler-Najjar hyperbilirubinemia. Gut 1973;14:46-49. [Free Full Text]
Maniatis T, Goodbourn S, Fischer JA. Regulation of inducible and tissue-specific gene expression. Science 1987;236:1237-1245. [Free Full Text]
Saltzman AG, Weinmann R. Promoter specificity and modulation of RNA polymerase II transcription. FASEB J 1989;3:1723-1733. [Abstract]
Greenblatt J. Roles of TFIID in transcriptional initiation by RNA polymerase II. Cell 1991;66:1067-1070. [CrossRef][Medline]
Grosveld GC, de Boer E, Shewmaker CK, Flavell RA. DNA sequences necessary for transcription of the rabbit beta-globin gene in vivo. Nature 1982;295:120-126. [CrossRef][Medline]
Dierks P, van Ooyen A, Cochran MD, Dobkin C, Reiser J, Weissmann C. Three regions upstream from the cap site are required for efficient and accurate transcription of the rabbit beta-globin gene in mouse 3T6 cells. Cell 1983;32:695-706. [CrossRef][Medline]
Spivak W, Carey MC. Reverse-phase h.p.l.c. separation, quantification and preparation of bilirubin and its conjugates from native bile: quantitative analysis of the intact tetrapyrroles based on h.p.l.c. of their ethyl anthranilate azo derivatives. Biochem J 1985;225:787-805. [Medline]
Billing BH, Williams R, Richards TG. Defects in hepatic transport of bilirubin in congenital hyperbilirubinaemia: an analysis of plasma bilirubin disappearance curves. Clin Sci 1964;27:245-257. [Medline]
Jendrassik L, Gróf P. Vereinfachte photometrische Methoden zur Bestimmung des Blutbilirubins. Biochem Z 1938;297:81-89.
Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:248-254. [CrossRef][Medline]
Platt T, Müller-Hill B, Miller JH. Assay of -galactosidase. In: Miller JH, ed. Experiments in molecular genetics. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1972:352-5.
Altman DG. Practical statistics for medical research. London: Chapman & Hall, 1991.
Muraca M, Fevery J. Influence of sex and sex steroids on bilirubin-uridine diphosphate-glucuronosyltransferase activity of rat liver. Gastroenterology 1984;87:308-313. [Medline]
Berk PD, Blaschke TF, Waggoner JG. Defective bromosulfophthalein clearance in patients with constitutional hepatic dysfunction (Gilbert's syndrome). Gastroenterology 1972;63:472-481. [Medline]
Martin JF, Vierling J-M, Wolkoff AW, et al. Abnormal hepatic transport of indocyanine green in Gilbert's syndrome. Gastroenterology 1976;70:385-391. [Medline]
Berk PD, Blaschke TF. Detection of Gilbert's syndrome in patients with hemolysis: a method using radioactive chromium. Ann Intern Med 1972;77:527-531.
Bensinger TA, Maisels MJ, Carlson DE, Conrad ME. Effect of low caloric diet on endogenous carbon monoxide production: normal adults and Gilbert's syndrome. Proc Soc Exp Biol Med 1973;144:417-419. [CrossRef][Medline]
Lundh B, Johansson MB, Mercke C, Cavallin-Stahl E. Enhancement of heme catabolism by caloric restriction in man. Scand J Clin Lab Invest 1972;30:421-427. [Medline]
Felsher BF, Carpio NM, VanCouvering K. Effect of fasting and phenobarbital on hepatic UDP-glucuronic acid formation in the rat. J Lab Clin Med 1979;93:414-427. [Medline]
Shih, P.-a. B., Wang, L., Chiron, S., Wen, G., Nievergelt, C., Mahata, M., Khandrika, S., Rao, F., Fung, M. M., Mahata, S. K., Hamilton, B. A., O'Connor, D. T.
(2009). Peptide YY (PYY) Gene Polymorphisms in the 3'-Untranslated and Proximal Promoter Regions Regulate Cellular Gene Expression and PYY Secretion and Metabolic Syndrome Traits in Vivo. J. Clin. Endocrinol. Metab.
94: 4557-4566
[Abstract][Full Text]
Watchko, J. F., Lin, Z., Clark, R. H., Kelleher, A. S., Walker, M. W., Spitzer, A. R., for the Pediatrix Hyperbilirubinemia Study Group,
(2009). Complex Multifactorial Nature of Significant Hyperbilirubinemia in Neonates. Pediatrics
124: e868-e877
[Abstract][Full Text]
Li, Y., Buckley, D., Wang, S., Klaassen, C. D., Zhong, X.-b.
(2009). Genetic Polymorphisms in the TATA Box and Upstream Phenobarbital-Responsive Enhancer Module of the UGT1A1 Promoter Have Combined Effects on UDP-Glucuronosyltransferase 1A1 Transcription Mediated by Constitutive Androstane Receptor, Pregnane X Receptor, or Glucocorticoid Receptor in Human Liver. Drug Metab. Dispos.
37: 1978-1986
[Abstract][Full Text]
Iwuchukwu, O. F., Ajetunmobi, J., Ung, D., Nagar, S.
(2009). Characterizing the Effects of Common UDP Glucuronosyltransferase (UGT) 1A6 and UGT1A1 Polymorphisms on cis- and trans-Resveratrol Glucuronidation. Drug Metab. Dispos.
37: 1726-1732
[Abstract][Full Text]
Johnson, A. D., Kavousi, M., Smith, A. V., Chen, M.-H., Dehghan, A., Aspelund, T., Lin, J.-P., van Duijn, C. M., Harris, T. B., Cupples, L. A., Uitterlinden, A. G., Launer, L., Hofman, A., Rivadeneira, F., Stricker, B., Yang, Q., O'Donnell, C. J., Gudnason, V., Witteman, J. C.
(2009). Genome-wide association meta-analysis for total serum bilirubin levels. Hum Mol Genet
18: 2700-2710
[Abstract][Full Text]
Balliet, R. M., Chen, G., Gallagher, C. J., Dellinger, R. W., Sun, D., Lazarus, P.
(2009). Characterization of UGTs Active against SAHA and Association between SAHA Glucuronidation Activity Phenotype with UGT Genotype. Cancer Res.
69: 2981-2989
[Abstract][Full Text]
Navarro, S. L., Peterson, S., Chen, C., Makar, K. W., Schwarz, Y., King, I. B., Li, S. S., Li, L., Kestin, M., Lampe, J. W.
(2009). Cruciferous Vegetable Feeding Alters UGT1A1 Activity: Diet- and Genotype-Dependent Changes in Serum Bilirubin in a Controlled Feeding Trial. Cancer Prevention Research
2: 345-352
[Abstract][Full Text]
Blevins-Primeau, A. S., Sun, D., Chen, G., Sharma, A. K., Gallagher, C. J., Amin, S., Lazarus, P.
(2009). Functional Significance of UDP-Glucuronosyltransferase Variants in the Metabolism of Active Tamoxifen Metabolites. Cancer Res.
69: 1892-1900
[Abstract][Full Text]
Saracino, M. R., Bigler, J., Schwarz, Y., Chang, J.-L., Li, S., Li, L., White, E., Potter, J. D., Lampe, J. W.
(2009). Citrus Fruit Intake Is Associated with Lower Serum Bilirubin Concentration among Women with the UGT1A1*28 Polymorphism. J. Nutr.
139: 555-560
[Abstract][Full Text]
Benoit-Biancamano, M.-O., Connelly, J., Villeneuve, L., Caron, P., Guillemette, C.
(2009). Deferiprone Glucuronidation by Human Tissues and Recombinant UDP Glucuronosyltransferase 1A6: An in Vitro Investigation of Genetic and Splice Variants. Drug Metab. Dispos.
37: 322-329
[Abstract][Full Text]
Huang, R. S., Ratain, M. J.
(2009). Pharmacogenetics and pharmacogenomics of anticancer agents. CA Cancer J Clin
59: 42-55
[Abstract][Full Text]
Ehmer, U., Lankisch, T. O., Erichsen, T. J., Kalthoff, S., Freiberg, N., Wehmeier, M., Manns, M. P., Strassburg, C. P.
(2008). Rapid Allelic Discrimination by TaqMan PCR for the Detection of the Gilbert's Syndrome Marker UGT1A1*28. J. Mol. Diagn.
10: 549-552
[Abstract][Full Text]
Lin, Z., Fontaine, J., Watchko, J. F.
(2008). Coexpression of Gene Polymorphisms Involved in Bilirubin Production and Metabolism. Pediatrics
122: e156-e162
[Abstract][Full Text]
Rantner, B., Kollerits, B., Anderwald-Stadler, M., Klein-Weigel, P., Gruber, I., Gehringer, A., Haak, M., Schnapka-Kopf, M., Fraedrich, G., Kronenberg, F.
(2008). Association between the UGT1A1 TA-Repeat Polymorphism and Bilirubin Concentration in Patients with Intermittent Claudication: Results from the CAVASIC Study. Clin. Chem.
54: 851-857
[Abstract][Full Text]
Nguyen, N., Bonzo, J. A., Chen, S., Chouinard, S., Kelner, M. J., Hardiman, G., Belanger, A., Tukey, R. H.
(2008). Disruption of the Ugt1 Locus in Mice Resembles Human Crigler-Najjar Type I Disease. J. Biol. Chem.
283: 7901-7911
[Abstract][Full Text]
Lankisch, T. O., Schulz, C., Zwingers, T., Erichsen, T. J., Manns, M. P., Heinemann, V., Strassburg, C. P.
(2008). Gilbert's Syndrome and Irinotecan Toxicity: Combination with UDP-Glucuronosyltransferase 1A7 Variants Increases Risk. Cancer Epidemiol. Biomarkers Prev.
17: 695-701
[Abstract][Full Text]
Perlstein, T. S., Pande, R. L., Beckman, J. A., Creager, M. A.
(2008). Serum Total Bilirubin Level and Prevalent Lower-Extremity Peripheral Arterial Disease: National Health and Nutrition Examination Survey (NHANES) 1999 to 2004. Arterioscler. Thromb. Vasc. Bio.
28: 166-172
[Abstract][Full Text]
Zhang, D., Zhang, D., Cui, D., Gambardella, J., Ma, L., Barros, A., Wang, L., Fu, Y., Rahematpura, S., Nielsen, J., Donegan, M., Zhang, H., Humphreys, W. G.
(2007). Characterization of the UDP Glucuronosyltransferase Activity of Human Liver Microsomes Genotyped for the UGT1A1*28 Polymorphism. Drug Metab. Dispos.
35: 2270-2280
[Abstract][Full Text]
Guo, Y., Lu, P., Farrell, E., Zhang, X., Weller, P., Monshouwer, M., Wang, J., Liao, G., Zhang, Z., Hu, S., Allard, J., Shafer, S., Usuka, J., Peltz, G.
(2007). In silico and in vitro pharmacogenetic analysis in mice. Proc. Natl. Acad. Sci. USA
104: 17735-17740
[Abstract][Full Text]
Bomgaars, L. R., Bernstein, M., Krailo, M., Kadota, R., Das, S., Chen, Z., Adamson, P. C., Blaney, S. M.
(2007). Phase II Trial of Irinotecan in Children With Refractory Solid Tumors: A Children's Oncology Group Study. JCO
25: 4622-4627
[Abstract][Full Text]
Hong, A. L., Huo, D., Kim, H.-J., Niu, Q., Fackenthal, D. L., Cummings, S. A., John, E. M., West, D. W., Whittemore, A. S., Das, S., Olopade, O. I.
(2007). UDP-Glucuronosyltransferase 1A1 Gene Polymorphisms and Total Bilirubin Levels in an Ethnically Diverse Cohort of Women. Drug Metab. Dispos.
35: 1254-1261
[Abstract][Full Text]
Daly, T. M., Dumaual, C. M., Miao, X., Farmen, M. W., Njau, R. K., Fu, D.-J., Bauer, N. L., Close, S., Watanabe, N., Bruckner, C., Hardenbol, P., Hockett, R. D.
(2007). Multiplex Assay for Comprehensive Genotyping of Genes Involved in Drug Metabolism, Excretion, and Transport. Clin. Chem.
53: 1222-1230
[Abstract][Full Text]
Stewart, C. F., Panetta, J. C., O'Shaughnessy, M. A., Throm, S. L., Fraga, C. H., Owens, T., Liu, T., Billups, C., Rodriguez-Galindo, C., Gajjar, A., Furman, W. L., McGregor, L. M.
(2007). UGT1A1 Promoter Genotype Correlates With SN-38 Pharmacokinetics, but Not Severe Toxicity in Patients Receiving Low-Dose Irinotecan. JCO
25: 2594-2600
[Abstract][Full Text]
Cote, J.-F., Kirzin, S., Kramar, A., Mosnier, J.-F., Diebold, M.-D., Soubeyran, I., Thirouard, A.-S., Selves, J., Laurent-Puig, P., Ychou, M.
(2007). UGT1A1 Polymorphism Can Predict Hematologic Toxicity in Patients Treated with Irinotecan. Clin. Cancer Res.
13: 3269-3275
[Abstract][Full Text]
Wang, X., Tomso, D. J., Chorley, B. N., Cho, H.-Y., Cheung, V. G., Kleeberger, S. R., Bell, D. A.
(2007). Identification of polymorphic antioxidant response elements in the human genome. Hum Mol Genet
16: 1188-1200
[Abstract][Full Text]
Kishi, S., Cheng, C., French, D., Pei, D., Das, S., Cook, E. H., Hijiya, N., Rizzari, C., Rosner, G. L., Frudakis, T., Pui, C.-H., Evans, W. E., Relling, M. V.
(2007). Ancestry and pharmacogenetics of antileukemic drug toxicity. Blood
109: 4151-4157
[Abstract][Full Text]
Chang, J.-L., Bigler, J., Schwarz, Y., Li, S. S., Li, L., King, I. B., Potter, J. D., Lampe, J. W.
(2007). UGT1A1 Polymorphism Is Associated with Serum Bilirubin Concentrations in a Randomized, Controlled, Fruit and Vegetable Feeding Trial. J. Nutr.
137: 890-897
[Abstract][Full Text]
Immenschuh, S., Shan, Y., Kroll, H., Santoso, S., Wossmann, W., Bein, G., Bonkovsky, H. L.
(2007). Marked Hyperbilirubinemia Associated With the Heme Oxygenase-1 Gene Promoter Microsatellite Polymorphism in a Boy With Autoimmune Hemolytic Anemia. Pediatrics
119: e764-e767
[Abstract][Full Text]
Muslu, N., Turhan, A. B., Eskandari, G., Atici, A., Ozturk, O. G., Kul, S., Atik, U.
(2007). The Frequency of UDP-Glucuronosyltransferase 1A1 Promoter Region (TA)7 Polymorphism in Newborns and it's Relation with Jaundice. J Trop Pediatr
53: 64-68
[Abstract][Full Text]
Wong, R. J., Stevenson, D. K., Ahlfors, C. E., Vreman, H. J.
(2007). Neonatal Jaundice: Bilirubin Physiology and Clinical Chemistry. NeoReviews
8: e58-e67
[Abstract][Full Text]
D'Apolito, M., Marrone, A., Servedio, V., Vajro, P., De Falco, L., Iolascon, A.
(2007). Seven novel mutations of the UGT1A1 gene in patients with unconjugated hyperbilirubinemia. haematol
92: 133-134
[Abstract][Full Text]
Gajdos, V., Petit, F. M., Perret, C., Mollet-Boudjemline, A., Colin, P., Capel, L., Nicaud, V., Evans, A., Arveiler, D., Parisot, F., Francoual, J., Genin, E., Cambien, F., Labrune, P.
(2006). Further Evidence That the UGT1A1*28 Allele Is Not Associated with Coronary Heart Disease: The ECTIM Study. Clin. Chem.
52: 2313-2314
[Full Text]
Smellie, W S A, Forth, J, Ryder, S, Galloway, M J, Wood, A C, Watson, I D
(2006). Best practice in primary care pathology: review 5. J. Clin. Pathol.
59: 1229-1237
[Abstract][Full Text]
Hahn, K. K., Wolff, J. J., Kolesar, J. M.
(2006). Pharmacogenetics and irinotecan therapy. Am J Health Syst Pharm
63: 2211-2217
[Abstract][Full Text]
Malfatti, M. A., Dingley, K. H., Nowell-Kadlubar, S., Ubick, E. A., Mulakken, N., Nelson, D., Lang, N. P., Felton, J. S., Turteltaub, K. W.
(2006). The Urinary Metabolite Profile of the Dietary Carcinogen 2-Amino-1-Methyl-6-Phenylimidazo[4,5-b]Pyridine Is Predictive of Colon DNA Adducts after a Low-Dose Exposure in Humans. Cancer Res.
66: 10541-10547
[Abstract][Full Text]
Lin, J.-P., O'Donnell, C. J., Schwaiger, J. P., Cupples, L. A., Lingenhel, A., Hunt, S. C., Yang, S., Kronenberg, F.
(2006). Association Between the UGT1A1*28 Allele, Bilirubin Levels, and Coronary Heart Disease in the Framingham Heart Study. Circulation
114: 1476-1481
[Abstract][Full Text]
O'Dwyer, P. J., Catalano, R. B.
(2006). Uridine Diphosphate Glucuronosyltransferase (UGT) 1A1 and Irinotecan: Practical Pharmacogenomics Arrives in Cancer Therapy. JCO
24: 4534-4538
[Full Text]
Felton, J. S., Malfatti, M. A.
(2006). What Do Diet-Induced Changes in Phase I and II Enzymes Tell Us about Prevention from Exposure to Heterocyclic Amines?. J. Nutr.
136: 2683S-2684S
[Full Text]
Kroetz, D. L.
(2006). Role for Drug Transporters Beyond Tumor Resistance: Hepatic Functional Imaging and Genotyping of Multidrug Resistance Transporters for the Prediction of Irinotecan Toxicity. JCO
24: 4225-4227
[Full Text]
Chen, Y., Chen, S., Li, X., Wang, X., Zeng, S.
(2006). Genetic Variants of Human UGT1A3: Functional Characterization and Frequency Distribution in a Chinese Han Population. Drug Metab. Dispos.
34: 1462-1467
[Abstract][Full Text]
Gardiner, S. J., Begg, E. J.
(2006). Pharmacogenetics, Drug-Metabolizing Enzymes, and Clinical Practice. Pharmacol. Rev.
58: 521-590
[Abstract][Full Text]
de Jong, F. A., Kehrer, D. F. S., Mathijssen, R. H. J., Creemers, G.-J., de Bruijn, P., van Schaik, R. H. N., Planting, A. S. Th., van der Gaast, A., Eskens, F. A. L. M., Janssen, J. Th. P., Ruit, J. B., Verweij, J., Sparreboom, A., de Jonge, M. J. A.
(2006). Prophylaxis of Irinotecan-Induced Diarrhea with Neomycin and Potential Role for UGT1A1*28 Genotype Screening: A Double-Blind, Randomized, Placebo-Controlled Study. The Oncologist
11: 944-954
[Abstract][Full Text]
Weinshilboum, R., Wang, L.
(2006). Pharmacogenomics: Bench to Bedside. Focus
4: 431-
[Abstract][Full Text]
Park, J., Chen, L., Ratnashinge, L., Sellers, T. A., Tanner, J.-P., Lee, J.-H., Dossett, N., Lang, N., Kadlubar, F. F., Ambrosone, C. B., Zachariah, B., Heysek, R. V., Patterson, S., Pow-Sang, J.
(2006). Deletion Polymorphism of UDP-Glucuronosyltransferase 2B17 and Risk of Prostate Cancer in African American and Caucasian Men.. Cancer Epidemiol. Biomarkers Prev.
15: 1473-1478
[Abstract][Full Text]
Girard, H., Villeneuve, L., Court, M. H., Fortier, L.-C., Caron, P., Hao, Q., von Moltke, L. L., Greenblatt, D. J., Guillemette, C.
(2006). THE NOVEL UGT1A9 INTRONIC I399 POLYMORPHISM APPEARS AS A PREDICTOR OF 7-ETHYL-10-HYDROXYCAMPTOTHECIN GLUCURONIDATION LEVELS IN THE LIVER. Drug Metab. Dispos.
34: 1220-1228
[Abstract][Full Text]
Kantarjian, H., Giles, F., Wunderle, L., Bhalla, K., O'Brien, S., Wassmann, B., Tanaka, C., Manley, P., Rae, P., Mietlowski, W., Bochinski, K., Hochhaus, A., Griffin, J. D., Hoelzer, D., Albitar, M., Dugan, M., Cortes, J., Alland, L., Ottmann, O. G.
(2006). Nilotinib in imatinib-resistant CML and Philadelphia chromosome-positive ALL.. NEJM
354: 2542-2551
[Abstract][Full Text]
Han, J.-Y., Lim, H.-S., Shin, E. S., Yoo, Y.-K., Park, Y. H., Lee, J.-E., Jang, I.-J., Ho Lee, D., Soo Lee, J.
(2006). Comprehensive Analysis of UGT1A Polymorphisms Predictive for Pharmacokinetics and Treatment Outcome in Patients With Non-Small-Cell Lung Cancer Treated With Irinotecan and Cisplatin. JCO
24: 2237-2244
[Abstract][Full Text]
Ratain, M. J.
(2006). From bedside to bench to bedside to clinical practice: an odyssey with irinotecan.. Clin. Cancer Res.
12: 1658-1660
[Full Text]
Harraway, J. R., George, P. M.
(2005). Use of Fully Denaturing HPLC for UGT1A1 Genotyping in Gilbert Syndrome. Clin. Chem.
51: 2183-2185
[Full Text]
Costa, E., Vieira, E., dos Santos, R.
(2005). The Polymorphism c.-3279T>G in the Phenobarbital-Responsive Enhancer Module of the Bilirubin UDP-Glucuronosyltransferase Gene Is Associated with Gilbert Syndrome. Clin. Chem.
51: 2204-2206
[Full Text]
French, D., Wilkinson, M. R., Yang, W., de Chaisemartin, L., Cook, E. H., Das, S., Ratain, M. J., Evans, W. E., Downing, J. R., Pui, C.-H., Relling, M. V.
(2005). Global gene expression as a function of germline genetic variation. Hum Mol Genet
14: 1621-1629
[Abstract][Full Text]
Wright, M. A., Morrison, G., Lin, P., Leonard, G. D., Nguyen, D., Guo, X., Szabo, E., Hopkins, J. L., Leguizamo, J. P., Harold, N., Fioravanti, S., Schuler, B., Monahan, B. P., Saif, M. W., Quinn, M. G., Pang, J., Grem, J. L.
(2005). A Phase I Pharmacologic and Pharmacogenetic Trial of Sequential 24-Hour Infusion of Irinotecan Followed by Leucovorin and a 48-Hour Infusion of Fluorouracil in Adult Patients with Solid Tumors. Clin. Cancer Res.
11: 4144-4150
[Abstract][Full Text]
Watchko, J. F.
(2005). Vigintiphobia Revisited. Pediatrics
115: 1747-1753
[Abstract][Full Text]
Peterson, S., Bigler, J., Horner, N. K., Potter, J. D., Lampe, J. W.
(2005). Cruciferae Interact with the UGT1A1*28 Polymorphism to Determine Serum Bilirubin Levels in Humans. J. Nutr.
135: 1051-1055
[Abstract][Full Text]
Lankisch, T. O., Vogel, A., Eilermann, S., Fiebeler, A., Krone, B., Barut, A., Manns, M. P., Strassburg, C. P.
(2005). Identification and Characterization of a Functional TATA Box Polymorphism of the UDP Glucuronosyltransferase 1A7 Gene. Mol. Pharmacol.
67: 1732-1739
[Abstract][Full Text]
Zukunft, J., Lang, T., Richter, T., Hirsch-Ernst, K. I., Nussler, A. K., Klein, K., Schwab, M., Eichelbaum, M., Zanger, U. M.
(2005). A Natural CYP2B6 TATA Box Polymorphism (-82T-> C) Leading to Enhanced Transcription and Relocation of the Transcriptional Start Site. Mol. Pharmacol.
67: 1772-1782
[Abstract][Full Text]
Kaniwa, N., Kurose, K., Jinno, H., Tanaka-Kagawa, T., Saito, Y., Saeki, M., Sawada, J.-i., Tohkin, M., Hasegawa, R.
(2005). RACIAL VARIABILITY IN HAPLOTYPE FREQUENCIES OF UGT1A1 AND GLUCURONIDATION ACTIVITY OF A NOVEL SINGLE NUCLEOTIDE POLYMORPHISM 686C> T (P229L) FOUND IN AN AFRICAN-AMERICAN. Drug Metab. Dispos.
33: 458-465
[Abstract][Full Text]
Giannini, E. G., Testa, R., Savarino, V.
(2005). Liver enzyme alteration: a guide for clinicians. CMAJ
172: 367-379
[Abstract][Full Text]
Lee, W., Lockhart, A. C., Kim, R. B., Rothenberg, M. L.
(2005). Cancer Pharmacogenomics: Powerful Tools in Cancer Chemotherapy and Drug Development. The Oncologist
10: 104-111
[Abstract][Full Text]
Haverfield, E. V., McKenzie, C. A., Forrester, T., Bouzekri, N., Harding, R., Serjeant, G., Walker, T., Peto, T. E. A., Ward, R., Weatherall, D. J.
(2005). UGT1A1 variation and gallstone formation in sickle cell disease. Blood
105: 968-972
[Abstract][Full Text]
Basu, A., Chaudhuri, P., Majumder, P. P.
(2005). Identification of polymorphic motifs using probabilistic search algorithms. Genome Res
15: 67-77
[Abstract][Full Text]
van der Logt, E.M.J., Bergevoet, S.M., Roelofs, H.M.J., van Hooijdonk, Z., te Morsche, R.H.M., Wobbes, T., de Kok, J.B., Nagengast, F.M., Peters, W.H.M.
(2004). Genetic polymorphisms in UDP-glucuronosyltransferases and glutathione S-transferases and colorectal cancer risk. Carcinogenesis
25: 2407-2415
[Abstract][Full Text]
Rouits, E., Boisdron-Celle, M., Dumont, A., Guerin, O., Morel, A., Gamelin, E.
(2004). Relevance of Different UGT1A1 Polymorphisms in Irinotecan-Induced Toxicity: A Molecular and Clinical Study of 75 Patients. Clin. Cancer Res.
10: 5151-5159
[Abstract][Full Text]
Sedlak, T. W., Snyder, S. H.
(2004). Bilirubin Benefits: Cellular Protection by a Biliverdin Reductase Antioxidant Cycle. Pediatrics
113: 1776-1782
[Full Text]
McLeod, H. L., Watters, J. W.
(2004). Irinotecan Pharmacogenetics: Is It Time to Intervene?. JCO
22: 1356-1359
[Full Text]
Innocenti, F., Undevia, S. D., Iyer, L., Xian Chen, P., Das, S., Kocherginsky, M., Karrison, T., Janisch, L., Ramirez, J., Rudin, C. M., Vokes, E. E., Ratain, M. J.
(2004). Genetic Variants in the UDP-glucuronosyltransferase 1A1 Gene Predict the Risk of Severe Neutropenia of Irinotecan. JCO
22: 1382-1388
[Abstract][Full Text]
Wells, P. G., Mackenzie, P. I., Roy Chowdhury, J., Guillemette, C., Gregory, P. A., Ishii, Y., Hansen, A. J., Kessler, F. K., Kim, P. M., Roy Chowdhury, N., Ritter, J. K.
(2004). GLUCURONIDATION AND THE UDP-GLUCURONOSYLTRANSFERASES IN HEALTH AND DISEASE. Drug Metab. Dispos.
32: 281-290
[Abstract][Full Text]
Goetz, M. P., Ames, M. M., Weinshilboum, R. M.
(2004). Primer on Medical Genomics Part XII: Pharmacogenomics--General Principles With Cancer as a Model. Mayo Clin Proc.
79: 376-384
[Abstract]
Duguay, Y., McGrath, M., Lepine, J., Gagne, J.-F., Hankinson, S. E., Colditz, G. A., Hunter, D. J., Plante, M., Tetu, B., Belanger, A., Guillemette, C., De Vivo, I.
(2004). The Functional UGT1A1 Promoter Polymorphism Decreases Endometrial Cancer Risk. Cancer Res.
64: 1202-1207
[Abstract][Full Text]
Fang, J.-L., Lazarus, P.
(2004). Correlation between the UDP-Glucuronosyltransferase (UGT1A1) TATAA Box Polymorphism and Carcinogen Detoxification Phenotype: Significantly Decreased Glucuronidating Activity against Benzo(a)pyrene-7,8-dihydrodiol(-) in Liver Microsomes from Subjects with the UGT1A1*28 Variant. Cancer Epidemiol. Biomarkers Prev.
13: 102-109
[Abstract][Full Text]
Jinno, H., Saeki, M., Saito, Y., Tanaka-Kagawa, T., Hanioka, N., Sai, K., Kaniwa, N., Ando, M., Shirao, K., Minami, H., Ohtsu, A., Yoshida, T., Saijo, N., Ozawa, S., Sawada, J.-I.
(2003). Functional Characterization of Human UDP-Glucuronosyltransferase 1A9 Variant, D256N, Found in Japanese Cancer Patients. J. Pharmacol. Exp. Ther.
306: 688-693
[Abstract][Full Text]
Mathijssen, R. H. J., Marsh, S., Karlsson, M. O., Xie, R., Baker, S. D., Verweij, J., Sparreboom, A., McLeod, H. L.
(2003). Irinotecan Pathway Genotype Analysis to Predict Pharmacokinetics. Clin. Cancer Res.
9: 3246-3253
[Abstract][Full Text]
Bosma, P. J., van der Meer, I. M., Bakker, C. T., Hofman, A., Paul-Abrahamse, M., Witteman, J. C.
(2003). UGT1A1*28 Allele and Coronary Heart Disease: The Rotterdam Study. Clin. Chem.
49: 1180-1181
[Full Text]
Murata, M., Warren, E. H., Riddell, S. R.
(2003). A Human Minor Histocompatibility Antigen Resulting from Differential Expression due to a Gene Deletion. JEM
197: 1279-1289
[Abstract][Full Text]
Watanabe, Y., Nakajima, M., Ohashi, N., Kume, T., Yokoi, T.
(2003). Glucuronidation of Etoposide in Human Liver Microsomes Is Specifically Catalyzed by UDP-Glucuronosyltransferase 1A1. Drug Metab. Dispos.
31: 589-595
[Abstract][Full Text]
Iyer, L. V., Ho, M. N., Shinn, W. M., Bradford, W. W., Tanga, M. J., Nath, S. S., Green, C. E.
(2003). Glucuronidation of 1'-Hydroxyestragole (1'-HE) by Human UDP-Glucuronosyltransferases UGT2B7 and UGT1A9. Toxicol Sci
73: 36-43
[Abstract][Full Text]
Kaplan, M., Hammerman, C., Maisels, M. J.
(2003). Bilirubin Genetics for the Nongeneticist: Hereditary Defects of Neonatal Bilirubin Conjugation. Pediatrics
111: 886-893
[Full Text]
Weinshilboum, R.
(2003). Inheritance and Drug Response. NEJM
348: 529-537
[Full Text]
Jinno, H., Tanaka-Kagawa, T., Hanioka, N., Saeki, M., Ishida, S., Nishimura, T., Ando, M., Saito, Y., Ozawa, S., Sawada, J.-i.
(2003). Glucuronidation of 7-Ethyl-10-hydroxycamptothecin (SN-38), an Active Metabolite of Irinotecan (CPT-11), by Human UGT1A1 Variants, G71R, P229Q, and Y486D. Drug Metab. Dispos.
31: 108-113
[Abstract][Full Text]
Tukey, R. H., Strassburg, C. P., Mackenzie, P. I.
(2002). Pharmacogenomics of Human UDP-Glucuronosyltransferases and Irinotecan Toxicity. Mol. Pharmacol.
62: 446-450
[Full Text]
Garcia-Carbonero, R., Supko, J. G.
(2002). Current Perspectives on the Clinical Experience, Pharmacology, and Continued Development of the Camptothecins. Clin. Cancer Res.
8: 641-661
[Abstract][Full Text]
Zucker, S. D., Qin, X., Rouster, S. D., Yu, F., Green, R. M., Keshavan, P., Feinberg, J., Sherman, K. E.
(2001). Mechanism of indinavir-induced hyperbilirubinemia. Proc. Natl. Acad. Sci. USA
10.1073/pnas.231140698v1
[Abstract][Full Text]
Stevenson, D. K., Fanaroff, A. A., Maisels, M. J., Young, B. W. Y., Wong, R. J., Vreman, H. J., MacMahon, J. R., Yeung, C. Y., Seidman, D. S., Gale, R., Oh, W., Bhutani, V. K., Johnson, L. H., Kaplan, M., Hammerman, C., Nakamura, H.
(2001). Prediction of Hyperbilirubinemia in Near-Term and Term Infants. Pediatrics
108: 31-39
[Abstract][Full Text]
Guillemette, C., De Vivo, I., Hankinson, S. E., Haiman, C. A., Spiegelman, D., Housman, D. E., Hunter, D. J.
(2001). Association of Genetic Polymorphisms in UGT1A1 with Breast Cancer and Plasma Hormone Levels. Cancer Epidemiol. Biomarkers Prev.
10: 711-714
[Abstract][Full Text]
Aguilar-Martinez, P, Bismuth, M, Picot, M C, Thelcide, C, Pageaux, G-P, Blanc, F, Blanc, P, Schved, J-F, Larrey, D
(2001). Variable phenotypic presentation of iron overload in H63D homozygotes: are genetic modifiers the cause?. Gut
48: 836-842
[Abstract][Full Text]
Innocenti, F., Iyer, L., Ratain, M. J.
(2001). Pharmacogenetics of Anticancer Agents: Lessons from Amonafide and Irinotecan. Drug Metab. Dispos.
29: 596-600
[Abstract][Full Text]
Ewesuedo, R. B., Iyer, L., Das, S., Koenig, A., Mani, S., Vogelzang, N. J., Schilsky, R. L., Brenckman, W., Ratain, M. J.
(2001). Phase I Clinical and Pharmacogenetic Study of Weekly TAS-103 in Patients With Advanced Cancer. JCO
19: 2084-2090
[Abstract][Full Text]
KADAKOL, A., SAPPAL, B. S, GHOSH, S. S, LOWENHEIM, M., CHOWDHURY, A., CHOWDHURY, S., SANTRA, A., ARIAS, I. M, CHOWDHURY, J. R., CHOWDHURY, N. R.
(2001). Interaction of coding region mutations and the Gilbert-type promoter abnormality of the UGT1A1 gene causes moderate degrees of unconjugated hyperbilirubinaemia and may lead to neonatal kernicterus. J. Med. Genet.
38: 244-249
[Full Text]
Tukey, R. H., Strassburg, C. P.
(2001). Genetic Multiplicity of the Human UDP-Glucuronosyltransferases and Regulation in the Gastrointestinal Tract. Mol. Pharmacol.
59: 405-414
[Abstract][Full Text]
Dennery, P. A., Seidman, D. S., Stevenson, D. K.
(2001). Neonatal Hyperbilirubinemia. NEJM
344: 581-590
[Full Text]
Ando, Y., Saka, H., Ando, M., Sawa, T., Muro, K., Ueoka, H., Yokoyama, A., Saitoh, S., Shimokata, K., Hasegawa, Y.
(2000). Polymorphisms of UDP-Glucuronosyltransferase Gene and Irinotecan Toxicity: A Pharmacogenetic Analysis. Cancer Res.
60: 6921-6926
[Abstract][Full Text]
von Ahsen, N., Oellerich, M., Schutz, E.
(2000). DNA Base Bulge vs Unmatched End Formation in Probe-based Diagnostic Insertion/Deletion Genotyping: Genotyping the UGT1A1 (TA)n Polymorphism by Real-Time Fluorescence PCR. Clin. Chem.
46: 1939-1945
[Abstract][Full Text]
Dufour, D. R., Lott, J. A., Nolte, F. S., Gretch, D. R., Koff, R. S., Seeff, L. B.
(2000). Diagnosis and Monitoring of Hepatic Injury. I. Performance Characteristics of Laboratory Tests. Clin. Chem.
46: 2027-2049
[Abstract][Full Text]
Maruo, Y., Nishizawa, K., Sato, H., Sawa, H., Shimada, M.
(2000). Prolonged Unconjugated Hyperbilirubinemia Associated With Breast Milk and Mutations of the Bilirubin Uridine Diphosphate- Glucuronosyltransferase Gene. Pediatrics
106: 59e-59
[Abstract][Full Text]
IOLASCON, A., MELONI, A., COPPOLA, B., ROSATELLI, M. C.
(2000). Crigler-Najjar syndrome type II resulting from three different mutations in the bilirubin uridine 5'-diphosphate-glucuronosyltransferase (UGT1A1) gene. J. Med. Genet.
37: 712-713
[Full Text]
-galactosidase driven by the promoter of the large transforming antigen of simian virus 40, was used to determine the efficiency of transfection. Cells from a well-differentiated human hepatoma cell line (HuH7) were grown to 40 percent confluence in RPMI medium containing 4 percent fetal-calf serum. The cells were cotransfected with 1.5 µg each of the test luciferase construct and pSV-lacZ with Lipofectin (GIBCO-BRL, Gaithersburg, Md.). After the cells were harvested, luciferase activity was determined with a Promega luciferase assay system. Protein content35 and o-aminophenol-
Previous
