FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 333:1171-1175 November 2, 1995 Number 18 Next

Abstract PDF Letters Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

ABSTRACT

Background People with Gilbert's syndrome have mild, chronic unconjugated hyperbilirubinemia in the absence of liver disease or overt hemolysis. Hepatic glucuronidating activity, essential for efficient biliary excretion of bilirubin, is reduced to about 30 percent of normal.

Methods We sequenced the coding and promoter regions of the gene for bilirubin UDP-glucuronosyltransferase 1 (bilirubin/uridine diphosphoglucuronate-glucuronosyltransferase 1) — the only enzyme that contributes substantially to bilirubin glucuronidation — in 10 unrelated patients with Gilbert's syndrome, 16 members of a kindred with a history of Crigler–Najjar syndrome type II, and 55 normal subjects.

Results The coding region of the gene for the enzyme was normal in the 10 patients with Gilbert's syndrome. These patients were homozygous for two extra bases (TA) in the TATAA element of the 5' promoter region of the gene (A(TA)₇TAA rather than the normal A(TA)₆TAA). The presence of the longer TATAA element resulted in the reduced expression of a reporter gene, encoding firefly luciferase, in a human hepatoma cell line. The frequency of the abnormal allele was 40 percent among the normal subjects. The 3 men in the control group who were homozygous for the longer TATAA element had significantly higher serum bilirubin levels than the other 52 normal subjects (P = 0.009). Among the kindred with a history of Crigler–Najjar syndrome type II, only the six heterozygous carriers who had a longer TATAA element on the structurally normal allele had mild hyperbilirubinemia, characteristic of Gilbert's syndrome.

Conclusions Reduced expression of bilirubin UDP-glucuronosyltransferase 1 due to an abnormality in the promoter region of the gene for this enzyme appears to be necessary for Gilbert's syndrome but not sufficient for the complete manifestation of the syndrome.

Hepatic glucuronidating activity, which is essential for efficient biliary excretion of bilirubin, is approximately 30 percent of normal in patients with Gilbert's syndrome.^9,10 The reduced glucuronidation results in an increased proportion of bilirubin monoglucuronide in bile.¹¹ In human liver, bilirubin glucuronidation is mediated by one specific isoform of microsomal bilirubin, UDP-glucuronosyltransferase (bilirubin/uridine diphosphoglucuronate-glucuronosyltransferase). Of the two isoforms reported,^12,13 only bilirubin UDP-glucuronosyltransferase 1 contributes substantially to bilirubin glucuronidation.¹⁴

Genetic lesions causing an absence of enzymatic bilirubin glucuronidation result in Crigler–Najjar syndrome type I,^{2,15,16,17,18,19,20,21} whereas mutations causing severe deficiency of the enzyme result in Crigler–Najjar syndrome type II.^22,23,24 Because mild hyperbilirubinemia is often found among relatives of patients with Crigler–Najjar syndrome, some have postulated that Gilbert's syndrome represents a heterozygous form of Crigler–Najjar syndrome.^25,26 However, many carriers of Crigler–Najjar syndrome do not have hyperbilirubinemia,²² and the incidence of Gilbert's syndrome is much higher than that expected on the basis of the number of heterozygous carriers of Crigler–Najjar syndrome, which is 1 per 1 million births.

We studied the genetic basis of reduced hepatic bilirubin glucuronidation in people with Gilbert's syndrome and found that a variant TATAA element (which contains two extra nucleotides, TA) in the upstream promoter region of the gene for bilirubin UDP-glucuronosyltransferase 1 is associated with the syndrome. The TATAA element is the binding site for transcription factor IID, which is important in the initiation of transcription.^{27,28,29,30,31} The presence of this longer TATAA element in the promoter region of the gene for bilirubin UDP-glucuronosyltransferase 1 resulted in reduced expression of a reporter gene, encoding firefly luciferase, in a human hepatoma cell line. The presence of the longer TATAA element correlated with higher mean serum bilirubin levels in normal, healthy subjects and in compound heterozygous carriers of Crigler–Najjar syndrome type II.

Methods

Patients with Gilbert's Syndrome

We studied 10 patients with Gilbert's syndrome, ranging from 15 to 54 years of age. Blood was collected from all 10 after they provided informed consent. Criteria for the diagnosis of Gilbert's syndrome included a consistent mild elevation of serum bilirubin (level, 1.2 to 5.3 mg per deciliter [20 to 90 µmol per liter]). The bilirubin was at least 90 percent unconjugated according to van den Bergh's test and 99 percent unconjugated on the basis of high-performance liquid chromatography. Serum alanine aminotransferase and aspartate aminotransferase values were normal. Hemolysis was excluded on the basis of normal hemoglobin and haptoglobin values and reticulocyte counts. Three patients were given a 400-kcal diet for 24 hours, which doubled their serum bilirubin levels. Two patients underwent duodenal aspiration for bile-pigment analysis by high-performance liquid chromatography³²; in both, monoglucuronide made up 30 percent of bilirubin conjugates.³³

Subjects from a Kindred with Crigler–Najjar Syndrome Type II

We examined 2 patients with Crigler–Najjar syndrome type II, 10 heterozygous carriers, and 4 family members who were not carriers from a kindred with a history of the syndrome. Both patients were homozygous for a structural mutation that markedly reduced the catalytic activity of bilirubin UDP-glucuronosyltransferase.^22,24 Four of the 10 heterozygous carriers had mild hyperbilirubinemia. All provided informed consent.

Control Subjects

We examined 55 normal subjects (28 women and 27 men; age, 21 to 55 years) with no known history of jaundice. All provided informed consent. Serum bilirubin was measured in samples collected on two different days.³⁴ In our laboratory the upper limit of normal for serum bilirubin is 1.0 mg per deciliter (17.1 µmol per liter). For samples with a serum bilirubin level of 0.9 mg per deciliter (15.4 µmol per liter), less than 5 percent variation is found between samples collected on two different days.

Nucleotide Sequencing of Coding and Upstream Regions of the Gene for Bilirubin UDP-Glucuronosyltransferase 1

Genomic DNA was isolated from lymphocytes and the five exons constituting the coding region of the gene for bilirubin UDP-glucuronosyltransferase 1, and their flanking intron–exon junctions were amplified by the polymerase chain reaction (PCR) and sequenced as described.¹⁵ The segment of DNA 5' to the coding region (from nucleotide -227 to nucleotide 132) was amplified with a sense primer, 5'GAGGTTCTGGAAGTACTTTGC3', and an antisense primer, 5'CCAAGCATGCTCAGCCAG3'. PCR was performed for 30 cycles consisting of denaturation at 95°C for 30 seconds, annealing at 56°C for 30 seconds, and extension at 72°C for 30 seconds, with 1.5 mmol of magnesium chloride per liter used as a buffer. Both strands of the amplified segment were sequenced with two internal primers.

Functional Evaluation of the Variant Tataa Element

A fragment of the upstream region (from nucleotide -546 to nucleotide -4) of the bilirubin UDP-glucuronosyltransferase 1 gene was amplified by PCR with genomic DNA from a subject homozygous for the long TATAA element, A(TA)₇TAA, and from a subject homozygous for the normal TATAA element, A(TA)₆TAA. Amplimers were designed to introduce a XhoI and a HindIII site at the 5' and 3' ends of the amplicon (amplified product), respectively. The two amplicons were cloned in appropriate orientation in the XhoI and HindIII sites 5' to the entire coding region of firefly luciferase gene of the plasmid pXP1, which lacks a promoter region. The nucleotide sequences of both constructs were identical except for the addition of two bases in the longer TATAA box. A plasmid, pSV-lacZ (Promega, Madison, Wis.), containing the structural region of bacterial -galactosidase driven by the promoter of the large transforming antigen of simian virus 40, was used to determine the efficiency of transfection. Cells from a well-differentiated human hepatoma cell line (HuH7) were grown to 40 percent confluence in RPMI medium containing 4 percent fetal-calf serum. The cells were cotransfected with 1.5 µg each of the test luciferase construct and pSV-lacZ with Lipofectin (GIBCO-BRL, Gaithersburg, Md.). After the cells were harvested, luciferase activity was determined with a Promega luciferase assay system. Protein content³⁵ and o-aminophenol--galactosidase activity³⁶ were determined as described previously.

Statistical Analysis

Mean serum bilirubin values were compared by analysis of variance or a two-tailed nonparametric Wilcoxon test.³⁷ Statistical analyses were performed with Sigma Stat for Windows.

Results

Patients with Gilbert's Syndrome

In four unrelated patients with Gilbert's syndrome, the nucleotide sequences of all five exons encoding the gene for bilirubin UDP-glucuronosyltransferase 1 and all intron–exon junctions were normal, indicating that the syndrome in these patients was not caused by structural mutations. To investigate whether an abnormality of the promoter region caused reduced expression of the normal enzyme, we determined the sequence of a 247-nucleotide region immediately upstream of the translation-initiation codon. Normally, an A(TA)₆TAA element is present between nucleotides -23 and -38.¹³ All four of the patients were homozygous for an additional TA in this element, resulting in the sequence A(TA)₇TAA (Figure 1). Subsequently, we sequenced this region in six additional unrelated patients with Gilbert's syndrome, all of whom were found to be homozygous for the additional TA.

View larger version (23K): [in this window] [in a new window]   Figure 1. Length of the TATAA Element in the Promoter Region of the Gene for Bilirubin UDP-Glucuronosyltransferase 1. The upstream region of the gene for bilirubin UDP-glucuronosyltransferase 1 was amplified with specific primers and sequenced directly. The sample on the left (lanes 1 through 4) is from a subject homozygous for the normal TATAA element (A(TA)6TAA), and the sample on the right (lanes 5 through 8) is from a subject homozygous for the variant element (A(TA)7TAA). Both TATAA elements are boxed.

 
Effect of the Longer TATAA Element on Gene Expression

To determine the effect of the longer TATAA element on gene expression, a 542-base-pair (bp) region upstream of the gene, which contained A(TA)₆TAA, and a 544-bp region containing A(TA)₇TAA were each linked upstream to a firefly luciferase gene, and the construct was transfected into a human hepatoma cell line (HuH7). To assess the efficiency of transfection, a -galactosidase expression vector, driven by a viral promoter, was cotransfected. The expression of both reporter genes was assessed in four experiments; the mean results of the four experiments are shown in Figure 2. The expression of luciferase in the presence of the longer TATAA element was only 18 to 33 percent of that recorded in the presence of the normal TATAA element. There was no significant difference in the level of expression of the cotransfected o-aminophenol--galactosidase.

View larger version (4K): [in this window] [in a new window]   Figure 2. Functional efficiency of Bilirubin UDP-Glucuronosyltransferase 1, According to Whether the Promoter Region of the Gene Contained the Normal or the Variant TATAAElement. A 542-bp segment of DNA located upstream of exon 1A of the gene for bilirubin UDP-glucuronosyltransferase 1 containing the normal TATAA element (A(TA)6TAA) and a 544-bp segment containing the variant element (A(TA)7TAA) were cloned upstream of the coding region of the firefly luciferase gene. Each construct was cotransfected by PCR into a human hepatoma cell line (HuH7) with pSV-lacZ with use of Lipofectin. Forty-eight hours later, luciferase activity and o-aminophenol--galactosidase activity were assayed with the use of various amounts of lysate protein. The mean (±SD) results of four experiments are shown.

 
Normal Subjects

The frequency of the two TATAA elements was determined in 55 normal subjects. Eight were homozygous for A(TA)₇TAA, 19 were homozygous for A(TA)₆TAA, and 28 were heterozygous. The calculated allele frequency for the longer TATAA element was 40 percent. The mean serum bilirubin levels (mean of values in blood samples obtained on two different days) were 0.5 mg per deciliter (8.3 µmol per liter) in the subjects who were homozygous for A(TA)₆TAA, 0.6 mg per deciliter (10.4 µmol per liter) in the heterozygotes, and 0.8 mg per deciliter (12.8 µmol per liter) in the subjects who were homozygous for A(TA)₇TAA (Figure 3). The mean serum bilirubin levels were significantly higher (P = 0.009) in the 3 men who were homozygous for A(TA)₇TAA than in the other normal subjects (1.0 mg per deciliter [17.1 µmol per liter] vs. 0.6 mg per deciliter in the other 52 subjects and 0.7 mg per deciliter [11.2 µmol per liter] in the other 24 normal men), whereas the mean values in the 5 women who were homozygous for A(TA)₇TAA did not differ significantly from those in the subjects who were homozygous for A(TA)₆TAA (0.6 mg per deciliter vs. 0.5 mg per deciliter [8.3 µmol per liter]).

View larger version (8K): [in this window] [in a new window]   Figure 3. Correlation between Serum Bilirubin Levels and the Length of the TATAA Element in the Promoter Region of the Gene for Bilirubin UDP-Glucuronosyltransferase 1 in 55 Normal Subjects. Eight subjects were homozygous for the short TATAA element (A(TA)6TAA), 19 were homozygous for the long TATAA element (A(TA)7TAA), and 28 were heterozygous. Each point represents the mean serum bilirubin value for a subject as determined independently on two different days. Circles denote female subjects, and triangles male subjects. The mean values in all three groups are shown. Analysis of variance showed that the mean serum bilirubin values differed significantly between groups (P = 0.012); uncorrected P values: P = 0.033 for the comparison of A(TA)6TAA homozygotes with heterozygotes; P = 0.008 for the comparison of A(TA)6TAA homozygotes with A(TA)7TAA homozygotes; and P = 0.164 for the comparison of heterozygotes with A(TA)7TAA homozygotes. To convert values for serum bili-rubin to micromoles per liter, multiply by 17.1.

 
Kindred with Crigler–Najjar Syndrome Type II

In a large kindred with a history of Crigler–Najjar syndrome type II,²² 2 family members with the syndrome who were homozygous for a structural mutation that reduces the catalytic activity of bilirubin UDP-glucuronosyltransferase to 4 percent of normal²⁴ were studied, as were 10 family members who were heterozygous for this mutation (carriers) and 4 family members who were not carriers (Table 1). The coding region of the second allele for the bilirubin UDP-glucuronosyltransferase 1 gene was normal in the heterozygotes. Determination of the sequence analyzed in the upstream region revealed that both patients with Crigler–Najjar syndrome type II were homozygous for A(TA)₆TAA, indicating that the structurally mutated allele contains a normal promoter. In six of the heterozygous carriers, the structurally normal allele contained the long TATAA element, A(TA)₇TAA, whereas in four the short element was present. The six heterozygotes with the promoter abnormality had significantly higher serum bilirubin values than the four with the normal TATAA element (1.6 mg per deciliter [27.4 µmol per liter] vs. 0.6 mg per deciliter, P = 0.01).

View this table: [in this window] [in a new window]   Table 1. Association of the Length of the TATAA Element Present in the Alleles for Bilirubin UDP-Glucuronosyltransferase 1 with Serum Bilirubin Levels in a Kindred with a History of Crigler–Najjar Syndrome Type II.

 
Discussion

We investigated the genetic mechanism of reduced bilirubin UDP-glucuronosyltransferase 1 activity in Gilbert's syndrome. The absence of any mutation in the coding region of the gene in four consecutive unrelated patients indicates that the decreased bilirubin glucuronidation is not due to a structural alteration of the enzyme. The presence of a long TATAA element, containing an extra TA, in both alleles in these four patients and in six additional patients with Gilbert's syndrome suggested the involvement of this variant promoter in the reduced expression of the enzyme. As the binding site for transcription factor IID, the TATAA element has an important role in the initiation of transcription,^{27,28,29,30,31} and its mutation can result in reduced frequency and accuracy of transcription initiation.^30,31 Our functional studies showed that the presence of the longer TATAA element in the upstream regulatory region of the gene reduces the expression of a reporter gene in a human hepatoma cell line. Together, these results suggest that the decreased bilirubin glucuronidating activity in Gilbert's syndrome results from reduced expression of the bilirubin glucuronidating enzyme.

All 10 patients with Gilbert's syndrome were homozygous for the longer TATAA element, suggesting that reduced expression of bilirubin UDP-glucuronosyltransferase 1 is essential for the syndrome. However, a mild reduction in the enzyme is not always sufficient for the full manifestation of the phenotype. Our results indicate that as much as 16 percent of the population should be homozygous for the long TATAA element, whereas only 3 to 10 percent of the general population have clinically diagnosed Gilbert's syndrome.^6,7,8 Among the normal subjects, only men who were homozygous for the longer TATAA element had significant elevations in serum bilirubin levels, reflecting a greater bilirubin load in men per kilogram of body weight or the inhibition of enzymatic glucuronidation by androgenic steroids (or both).³⁸ This finding is consistent with the high male-to-female ratio among patients with diagnosed Gilbert's syndrome.^4,8 The presence of other inherited or acquired factors affecting bilirubin metabolism, in addition to reduced glucuronidation, may result in the full manifestation of the syndrome. In some patients, impaired hepatic uptake of bilirubin has been found.^33,39,40 Although hemolysis is not part of the syndrome, many patients who consult physicians may have a high bilirubin load because of a slightly reduced erythrocyte life span.⁴¹ Fasting may also increase the bilirubin load,^42,43 and the resulting hyperbilirubinemia may be exaggerated in patients with Gilbert's syndrome⁴⁴ because of the reduced expression of the glucuronidating enzyme.

Gilbert's syndrome runs in families,³ although only one family member may have jaundice.² Both autosomal dominant³ and autosomal recessive⁵ modes of inheritance have been proposed. Because homozygosity for A(TA)₇TAA appears to be a requirement for the syndrome, our findings suggest an autosomal recessive mode of inheritance, whereas the high frequency of the structurally mutated allele may explain the appearance of a pseudodominant pattern of inheritance in some instances.

Our results also help to explain the high incidence of mild hyperbilirubinemia in relatives of patients with Crigler–Najjar syndrome. Heterozygous carriers of Crigler–Najjar syndrome have one structurally normal allele and would be expected to have bilirubin glucuronidating activity that is at least 50 percent of normal, so that normal serum bilirubin levels would be maintained. However, when this structurally normal allele contains the longer TATAA element, the decreased expression of bilirubin UDP-glucuronosyltransferase 1 results in hyperbilirubinemia.

In summary, reduced expression of bilirubin UDP-glucuronosyltransferase 1 due to an abnormality in the promoter region of the gene appears to be necessary for Gilbert's syndrome but is not sufficient for the complete manifestation of the condition.

Supported in part by grants from the National Institutes of Health (RO1-DK39137 to Dr. N. Chowdhury, RO1-DK46057 to Dr. J. Chowdhury, and P30-DK41296).

We are indebted to B. Goldhoorn and T. Out for technical assistance in DNA purification and sequence determination.

Source Information

From the Department of Gastroenterology and Hepatology, Academic Medical Center, Amsterdam, the Netherlands (P.J.B., C.B., A.B., G.N.J.T., R.P.J.O.E.); Marion Bessin Liver Research Center, Division of Gastroenterology and Liver Diseases, Departments of Medicine and Molecular Genetics, Albert Einstein College of Medicine, Bronx, N.Y. (J.R.C., S.G., N.R.C.); the Department of Clinical Genetics, Erasmus University, Rotterdam, the Netherlands (B.A.O., D.L.); and the Department of Gastroenterology and Hepatology, Academic Hospital Groningen, Groningen, the Netherlands (P.L.M.J.).

Address reprint requests to Dr. Bosma at FO-116, Academic Medical Center, Meibergdreef 9, 1105 AZ, Amsterdam, the Netherlands.

References

1. Gilbert A, Lereboullet P. La cholémie simple familiale. Semaine Med 1901;21:241-3. 
2. Chowdhury JR, Chowdhury NR, Wolkoff AW, Arias JM. Heme and bile pigment metabolism. In: Arias IM, Boyer JL, Fausto N, Jakoby WB, Schachter DA, Schafritz DA, eds. The liver: biology and pathobiology. 3rd ed. New York: Raven Press, 1994:471-504.
3. Thompson RPH. Genetic transmission of Gilbert's syndrome. In: Okolicsanyi L, ed. Familial hyperbilirubinemia. New York: John Wiley, 1981:91-7.
4. Powell LW, Hemingway E, Billing BH, Sherlock S. Idiopathic unconjugated hyperbilirubinemia (Gilbert's syndrome): a study of 42 families. N Engl J Med 1967;277:1108-1112.
5. Owens IS, Ritter JK. The novel bilirubin/phenol UDP-glucuronosyltransferase UGT1 gene locus: implications for multiple nonhemolytic familial hyperbilirubinemia phenotypes. Pharmacogenetics 1992;2:93-108. [Medline]
6. Owens D, Evans J. Population studies on Gilbert's syndrome. J Med Genet 1975;12:152-156. [Abstract]
7. Bailey A, Robinson D, Dawson AM. Does Gilbert's disease exist? Lancet 1977;1:931-933. [Medline]
8. Sieg A, Arab L, Schlierf G, Stiehl A, Kommerell B. Die Prävalenz des Gilbert-Syndroms in Deutschland. Dtsch Med Wochenschr 1987;112:1206-1208. [Medline]
9. Arias IM, London IM. Bilirubin glucuronide formation in vitro: demonstration of a defect in Gilbert's disease. Science 1957;126:563-564. [Free Full Text]
10. Black M, Billing BH. Hepatic bilirubin UDP-glucuronyl transferase activity in liver disease and Gilbert's syndrome. N Engl J Med 1969;280:1266-1271.
11. Fevery J, Blanckaert N, Heirwegh KPM, Preaux A-M, Berthelot P. Unconjugated bilirubin and an increased proportion of bilirubin monoconjugates in the bile of patients with Gilbert's syndrome and Crigler-Najjar disease. J Clin Invest 1977;60:970-979.
12. Ritter JK, Crawford JM, Owens IS. Cloning of two human liver bilirubin UDP-glucuronosyltransferase cDNAs with expression in COS-1 cells. J Biol Chem 1991;266:1043-1047. [Free Full Text]
13. Ritter JK, Chen F, Sheen YY, et al. A novel complex locus UGT1 encodes human bilirubin, phenol, and other UDP-glucuronosyltransferase isozymes with identical carboxyl termini. J Biol Chem 1992;267:3257-3261. [Free Full Text]
14. Bosma PJ, Seppen J, Goldhoorn B, et al. Bilirubin UDP-glucuronosyltransferase 1 is the only relevant bilirubin glucuronidating isoform in man. J Biol Chem 1994;269:17960-17964. [Erratum, J Biol Chem 1994;269(41):2542.] [Free Full Text]
15. Bosma PJ, Chowdhury NR, Goldhoorn BG, et al. Sequence of exons and the flanking regions of human bilirubin-UDP-glucuronosyltransferase gene complex and identification of a genetic mutation in a patient with Crigler-Najjar syndrome, type I. Hepatology 1992;15:941-947. [Medline]
16. Bosma PJ, Chowdhury JR, Huang TJ, et al. Mechanisms of inherited deficiencies of multiple UDP-glucuronosyltransferase isoforms in two patients with Crigler-Najjar syndrome, type I. FASEB J 1992;6:2859-2863. [Abstract]
17. Ritter JK, Yeatman MT, Ferreira P, Owens IS. Identification of a genetic alteration in the code for bilirubin UDP-glucuronosyltransferase in the UGT1 gene complex of a Crigler-Najjar type I patient. J Clin Invest 1992;90:150-155.
18. Moghrabi N, Clarke DJ, Burchell B, Boxer M. Cosegregation of intragenic markers with a novel mutation that causes Crigler-Najjar syndrome type I: implication in carrier detection and prenatal diagnosis. Am J Hum Genet 1993;53:722-729. [Medline]
19. Ritter JK, Yeatman MT, Kaiser C, Gridelli B, Owens IS. A phenylalanine codon deletion at the UGT1 gene complex locus of a Crigler-Najjar type I patient generates a pH-sensitive bilirubin UDP-glucuronosyltransferase. J Biol Chem 1993;268:23573-23579. [Free Full Text]
20. Labrune P, Myara A, Hadchouel M, et al. Genetic heterogeneity of Crigler-Najjar syndrome type I: a study of 14 cases. Hepatology 1993;18:126A-126A.abstract 
21. Erps LT, Ritter JK, Hersh JH, Blossom D, Martin NC, Owens IS. Identification of the two single base substitutions in the UGT1 gene locus which abolish bilirubin uridine diphosphate glucuronosyltransferase activity in vitro. J Clin Invest 1994;93:564-570.
22. Bosma PJ, Goldhoorn B, Oude Elferink RP, Sinaasappel M, Oostra BA, Jansen PLM. A mutation in bilirubin uridine 5'-diphosphate-glucuronosyltransferase isoform 1 causing Crigler-Najjar syndrome type II. Gastroenterology 1993;105:216-220. [Medline]
23. Moghrabi N, Clarke DJ, Boxer M, Burchell B. Identification of an A-to-G missense mutation in exon 2 of the UGT1 gene complex that causes Crigler-Najjar syndrome type 2. Genomics 1993;18:171-173. [CrossRef][Medline]
24. Seppen J, Bosma PJ, Goldhoorn BG, et al. Discrimination between Crigler-Najjar syndrome type I and II by expression of mutant bilirubin uridine diphosphate-glucuronosyltransferase. J Clin Invest 1994;94:2385-2391.
25. Arias IM, Gartner LM, Cohen M, Ezzer JB, Levi AJ. Chronic nonhemolytic unconjugated hyperbilirubinemia with glucuronosyltransferase deficiency: clinical, biochemical, pharmacologic and genetic evidence for heterogeneity. Am J Med 1969;47:395-409. [CrossRef][Medline]
26. Hunter JO, Thompson RPH, Dunn PM, Williams R. Inheritance of type 2 Crigler-Najjar hyperbilirubinemia. Gut 1973;14:46-49. [Free Full Text]
27. Maniatis T, Goodbourn S, Fischer JA. Regulation of inducible and tissue-specific gene expression. Science 1987;236:1237-1245. [Free Full Text]
28. Saltzman AG, Weinmann R. Promoter specificity and modulation of RNA polymerase II transcription. FASEB J 1989;3:1723-1733. [Abstract]
29. Greenblatt J. Roles of TFIID in transcriptional initiation by RNA polymerase II. Cell 1991;66:1067-1070. [CrossRef][Medline]
30. Grosveld GC, de Boer E, Shewmaker CK, Flavell RA. DNA sequences necessary for transcription of the rabbit beta-globin gene in vivo. Nature 1982;295:120-126. [CrossRef][Medline]
31. Dierks P, van Ooyen A, Cochran MD, Dobkin C, Reiser J, Weissmann C. Three regions upstream from the cap site are required for efficient and accurate transcription of the rabbit beta-globin gene in mouse 3T6 cells. Cell 1983;32:695-706. [CrossRef][Medline]
32. Spivak W, Carey MC. Reverse-phase h.p.l.c. separation, quantification and preparation of bilirubin and its conjugates from native bile: quantitative analysis of the intact tetrapyrroles based on h.p.l.c. of their ethyl anthranilate azo derivatives. Biochem J 1985;225:787-805. [Medline]
33. Billing BH, Williams R, Richards TG. Defects in hepatic transport of bilirubin in congenital hyperbilirubinaemia: an analysis of plasma bilirubin disappearance curves. Clin Sci 1964;27:245-257. [Medline]
34. Jendrassik L, Gróf P. Vereinfachte photometrische Methoden zur Bestimmung des Blutbilirubins. Biochem Z 1938;297:81-89. 
35. Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1976;72:248-254. [CrossRef][Medline]
36. Platt T, Müller-Hill B, Miller JH. Assay of -galactosidase. In: Miller JH, ed. Experiments in molecular genetics. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1972:352-5.
37. Altman DG. Practical statistics for medical research. London: Chapman & Hall, 1991.
38. Muraca M, Fevery J. Influence of sex and sex steroids on bilirubin-uridine diphosphate-glucuronosyltransferase activity of rat liver. Gastroenterology 1984;87:308-313. [Medline]
39. Berk PD, Blaschke TF, Waggoner JG. Defective bromosulfophthalein clearance in patients with constitutional hepatic dysfunction (Gilbert's syndrome). Gastroenterology 1972;63:472-481. [Medline]
40. Martin JF, Vierling J-M, Wolkoff AW, et al. Abnormal hepatic transport of indocyanine green in Gilbert's syndrome. Gastroenterology 1976;70:385-391. [Medline]
41. Berk PD, Blaschke TF. Detection of Gilbert's syndrome in patients with hemolysis: a method using radioactive chromium. Ann Intern Med 1972;77:527-531.
42. Bensinger TA, Maisels MJ, Carlson DE, Conrad ME. Effect of low caloric diet on endogenous carbon monoxide production: normal adults and Gilbert's syndrome. Proc Soc Exp Biol Med 1973;144:417-419. [Medline]
43. Lundh B, Johansson MB, Mercke C, Cavallin-Stahl E. Enhancement of heme catabolism by caloric restriction in man. Scand J Clin Lab Invest 1972;30:421-427. [Medline]
44. Felsher BF, Carpio NM, VanCouvering K. Effect of fasting and phenobarbital on hepatic UDP-glucuronic acid formation in the rat. J Lab Clin Med 1979;93:414-427. [Medline]

Abstract PDF Letters Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

Related Letters:

The Genetic Basis of Gilbert's Syndrome
Mathew P., Bosma P. J., Oostra B. A.
Extract | Full Text  
N Engl J Med 1996; 334:802-803, Mar 21, 1996. Correspondence

This article has been cited by other articles:

• Lin, Z., Fontaine, J., Watchko, J. F. (2008). Coexpression of Gene Polymorphisms Involved in Bilirubin Production and Metabolism. Pediatrics 122: e156-e162 [Abstract] [Full Text]  
• Rantner, B., Kollerits, B., Anderwald-Stadler, M., Klein-Weigel, P., Gruber, I., Gehringer, A., Haak, M., Schnapka-Kopf, M., Fraedrich, G., Kronenberg, F. (2008). Association between the UGT1A1 TA-Repeat Polymorphism and Bilirubin Concentration in Patients with Intermittent Claudication: Results from the CAVASIC Study. Clin. Chem. 54: 851-857 [Abstract] [Full Text]  
• Nguyen, N., Bonzo, J. A., Chen, S., Chouinard, S., Kelner, M. J., Hardiman, G., Belanger, A., Tukey, R. H. (2008). Disruption of the Ugt1 Locus in Mice Resembles Human Crigler-Najjar Type I Disease. J. Biol. Chem. 283: 7901-7911 [Abstract] [Full Text]  
• Lankisch, T. O., Schulz, C., Zwingers, T., Erichsen, T. J., Manns, M. P., Heinemann, V., Strassburg, C. P. (2008). Gilbert's Syndrome and Irinotecan Toxicity: Combination with UDP-Glucuronosyltransferase 1A7 Variants Increases Risk. Cancer Epidemiol. Biomarkers Prev. 17: 695-701 [Abstract] [Full Text]  
• Perlstein, T. S., Pande, R. L., Beckman, J. A., Creager, M. A. (2008). Serum Total Bilirubin Level and Prevalent Lower-Extremity Peripheral Arterial Disease: National Health and Nutrition Examination Survey (NHANES) 1999 to 2004. Arterioscler. Thromb. Vasc. Bio. 28: 166-172 [Abstract] [Full Text]  
• Zhang, D., Zhang, D., Cui, D., Gambardella, J., Ma, L., Barros, A., Wang, L., Fu, Y., Rahematpura, S., Nielsen, J., Donegan, M., Zhang, H., Humphreys, W. G. (2007). Characterization of the UDP Glucuronosyltransferase Activity of Human Liver Microsomes Genotyped for the UGT1A1*28 Polymorphism. Drug Metab. Dispos. 35: 2270-2280 [Abstract] [Full Text]  
• Guo, Y., Lu, P., Farrell, E., Zhang, X., Weller, P., Monshouwer, M., Wang, J., Liao, G., Zhang, Z., Hu, S., Allard, J., Shafer, S., Usuka, J., Peltz, G. (2007). In silico and in vitro pharmacogenetic analysis in mice. Proc. Natl. Acad. Sci. USA 104: 17735-17740 [Abstract] [Full Text]  
• Bomgaars, L. R., Bernstein, M., Krailo, M., Kadota, R., Das, S., Chen, Z., Adamson, P. C., Blaney, S. M. (2007). Phase II Trial of Irinotecan in Children With Refractory Solid Tumors: A Children's Oncology Group Study. JCO 25: 4622-4627 [Abstract] [Full Text]  
• Hong, A. L., Huo, D., Kim, H.-J., Niu, Q., Fackenthal, D. L., Cummings, S. A., John, E. M., West, D. W., Whittemore, A. S., Das, S., Olopade, O. I. (2007). UDP-Glucuronosyltransferase 1A1 Gene Polymorphisms and Total Bilirubin Levels in an Ethnically Diverse Cohort of Women. Drug Metab. Dispos. 35: 1254-1261 [Abstract] [Full Text]  
• Daly, T. M., Dumaual, C. M., Miao, X., Farmen, M. W., Njau, R. K., Fu, D.-J., Bauer, N. L., Close, S., Watanabe, N., Bruckner, C., Hardenbol, P., Hockett, R. D. (2007). Multiplex Assay for Comprehensive Genotyping of Genes Involved in Drug Metabolism, Excretion, and Transport. Clin. Chem. 53: 1222-1230 [Abstract] [Full Text]  
• Stewart, C. F., Panetta, J. C., O'Shaughnessy, M. A., Throm, S. L., Fraga, C. H., Owens, T., Liu, T., Billups, C., Rodriguez-Galindo, C., Gajjar, A., Furman, W. L., McGregor, L. M. (2007). UGT1A1 Promoter Genotype Correlates With SN-38 Pharmacokinetics, but Not Severe Toxicity in Patients Receiving Low-Dose Irinotecan. JCO 25: 2594-2600 [Abstract] [Full Text]  
• Cote, J.-F., Kirzin, S., Kramar, A., Mosnier, J.-F., Diebold, M.-D., Soubeyran, I., Thirouard, A.-S., Selves, J., Laurent-Puig, P., Ychou, M. (2007). UGT1A1 Polymorphism Can Predict Hematologic Toxicity in Patients Treated with Irinotecan. Clin. Cancer Res. 13: 3269-3275 [Abstract] [Full Text]  
• Wang, X., Tomso, D. J., Chorley, B. N., Cho, H.-Y., Cheung, V. G., Kleeberger, S. R., Bell, D. A. (2007). Identification of polymorphic antioxidant response elements in the human genome. Hum Mol Genet 16: 1188-1200 [Abstract] [Full Text]  
• Kishi, S., Cheng, C., French, D., Pei, D., Das, S., Cook, E. H., Hijiya, N., Rizzari, C., Rosner, G. L., Frudakis, T., Pui, C.-H., Evans, W. E., Relling, M. V. (2007). Ancestry and pharmacogenetics of antileukemic drug toxicity. Blood 109: 4151-4157 [Abstract] [Full Text]  
• Chang, J.-L., Bigler, J., Schwarz, Y., Li, S. S., Li, L., King, I. B., Potter, J. D., Lampe, J. W. (2007). UGT1A1 Polymorphism Is Associated with Serum Bilirubin Concentrations in a Randomized, Controlled, Fruit and Vegetable Feeding Trial. J. Nutr. 137: 890-897 [Abstract] [Full Text]  
• Immenschuh, S., Shan, Y., Kroll, H., Santoso, S., Wossmann, W., Bein, G., Bonkovsky, H. L. (2007). Marked Hyperbilirubinemia Associated With the Heme Oxygenase-1 Gene Promoter Microsatellite Polymorphism in a Boy With Autoimmune Hemolytic Anemia. Pediatrics 119: e764-e767 [Abstract] [Full Text]  
• Muslu, N., Turhan, A. B., Eskandari, G., Atici, A., Ozturk, O. G., Kul, S., Atik, U. (2007). The Frequency of UDP-Glucuronosyltransferase 1A1 Promoter Region (TA)7 Polymorphism in Newborns and it's Relation with Jaundice. J Trop Pediatr 53: 64-68 [Abstract] [Full Text]  
• Wong, R. J., Stevenson, D. K., Ahlfors, C. E., Vreman, H. J. (2007). Neonatal Jaundice: Bilirubin Physiology and Clinical Chemistry. NeoReviews 8: e58-e67 [Abstract] [Full Text]  
• D'Apolito, M., Marrone, A., Servedio, V., Vajro, P., De Falco, L., Iolascon, A. (2007). Seven novel mutations of the UGT1A1 gene in patients with unconjugated hyperbilirubinemia. haematol 92: 133-134 [Abstract] [Full Text]  
• Gajdos, V., Petit, F. M., Perret, C., Mollet-Boudjemline, A., Colin, P., Capel, L., Nicaud, V., Evans, A., Arveiler, D., Parisot, F., Francoual, J., Genin, E., Cambien, F., Labrune, P. (2006). Further Evidence That the UGT1A1*28 Allele Is Not Associated with Coronary Heart Disease: The ECTIM Study. Clin. Chem. 52: 2313-2314 [Full Text]  
• Smellie, W S A, Forth, J, Ryder, S, Galloway, M J, Wood, A C, Watson, I D (2006). Best practice in primary care pathology: review 5. J. Clin. Pathol. 59: 1229-1237 [Abstract] [Full Text]  
• Hahn, K. K., Wolff, J. J., Kolesar, J. M. (2006). Pharmacogenetics and irinotecan therapy. Am J Health Syst Pharm 63: 2211-2217 [Abstract] [Full Text]  
• Malfatti, M. A., Dingley, K. H., Nowell-Kadlubar, S., Ubick, E. A., Mulakken, N., Nelson, D., Lang, N. P., Felton, J. S., Turteltaub, K. W. (2006). The Urinary Metabolite Profile of the Dietary Carcinogen 2-Amino-1-Methyl-6-Phenylimidazo[4,5-b]Pyridine Is Predictive of Colon DNA Adducts after a Low-Dose Exposure in Humans. Cancer Res. 66: 10541-10547 [Abstract] [Full Text]  
• Lin, J.-P., O'Donnell, C. J., Schwaiger, J. P., Cupples, L. A., Lingenhel, A., Hunt, S. C., Yang, S., Kronenberg, F. (2006). Association Between the UGT1A1*28 Allele, Bilirubin Levels, and Coronary Heart Disease in the Framingham Heart Study. Circulation 114: 1476-1481 [Abstract] [Full Text]  
• O'Dwyer, P. J., Catalano, R. B. (2006). Uridine Diphosphate Glucuronosyltransferase (UGT) 1A1 and Irinotecan: Practical Pharmacogenomics Arrives in Cancer Therapy. JCO 24: 4534-4538 [Full Text]  
• Felton, J. S., Malfatti, M. A. (2006). What Do Diet-Induced Changes in Phase I and II Enzymes Tell Us about Prevention from Exposure to Heterocyclic Amines?. J. Nutr. 136: 2683S-2684S [Full Text]  
• Kroetz, D. L. (2006). Role for Drug Transporters Beyond Tumor Resistance: Hepatic Functional Imaging and Genotyping of Multidrug Resistance Transporters for the Prediction of Irinotecan Toxicity. JCO 24: 4225-4227 [Full Text]  
• Chen, Y., Chen, S., Li, X., Wang, X., Zeng, S. (2006). Genetic Variants of Human UGT1A3: Functional Characterization and Frequency Distribution in a Chinese Han Population. Drug Metab. Dispos. 34: 1462-1467 [Abstract] [Full Text]  
• Gardiner, S. J., Begg, E. J. (2006). Pharmacogenetics, Drug-Metabolizing Enzymes, and Clinical Practice. Pharmacol. Rev. 58: 521-590 [Abstract] [Full Text]  
• de Jong, F. A., Kehrer, D. F. S., Mathijssen, R. H. J., Creemers, G.-J., de Bruijn, P., van Schaik, R. H. N., Planting, A. S. Th., van der Gaast, A., Eskens, F. A. L. M., Janssen, J. Th. P., Ruit, J. B., Verweij, J., Sparreboom, A., de Jonge, M. J. A. (2006). Prophylaxis of Irinotecan-Induced Diarrhea with Neomycin and Potential Role for UGT1A1*28 Genotype Screening: A Double-Blind, Randomized, Placebo-Controlled Study. The Oncologist 11: 944-954 [Abstract] [Full Text]  
• Weinshilboum, R., Wang, L. (2006). Pharmacogenomics: Bench to Bedside. Focus 4: 431- [Abstract] [Full Text]  
• Park, J., Chen, L., Ratnashinge, L., Sellers, T. A., Tanner, J.-P., Lee, J.-H., Dossett, N., Lang, N., Kadlubar, F. F., Ambrosone, C. B., Zachariah, B., Heysek, R. V., Patterson, S., Pow-Sang, J. (2006). Deletion Polymorphism of UDP-Glucuronosyltransferase 2B17 and Risk of Prostate Cancer in African American and Caucasian Men.. Cancer Epidemiol. Biomarkers Prev. 15: 1473-1478 [Abstract] [Full Text]  
• Girard, H., Villeneuve, L., Court, M. H., Fortier, L.-C., Caron, P., Hao, Q., von Moltke, L. L., Greenblatt, D. J., Guillemette, C. (2006). THE NOVEL UGT1A9 INTRONIC I399 POLYMORPHISM APPEARS AS A PREDICTOR OF 7-ETHYL-10-HYDROXYCAMPTOTHECIN GLUCURONIDATION LEVELS IN THE LIVER. Drug Metab. Dispos. 34: 1220-1228 [Abstract] [Full Text]  
• Kantarjian, H., Giles, F., Wunderle, L., Bhalla, K., O'Brien, S., Wassmann, B., Tanaka, C., Manley, P., Rae, P., Mietlowski, W., Bochinski, K., Hochhaus, A., Griffin, J. D., Hoelzer, D., Albitar, M., Dugan, M., Cortes, J., Alland, L., Ottmann, O. G. (2006). Nilotinib in imatinib-resistant CML and Philadelphia chromosome-positive ALL.. NEJM 354: 2542-2551 [Abstract] [Full Text]  
• Han, J.-Y., Lim, H.-S., Shin, E. S., Yoo, Y.-K., Park, Y. H., Lee, J.-E., Jang, I.-J., Ho Lee, D., Soo Lee, J. (2006). Comprehensive Analysis of UGT1A Polymorphisms Predictive for Pharmacokinetics and Treatment Outcome in Patients With Non-Small-Cell Lung Cancer Treated With Irinotecan and Cisplatin. JCO 24: 2237-2244 [Abstract] [Full Text]  
• Ratain, M. J. (2006). From bedside to bench to bedside to clinical practice: an odyssey with irinotecan.. Clin. Cancer Res. 12: 1658-1660 [Full Text]  
• Harraway, J. R., George, P. M. (2005). Use of Fully Denaturing HPLC for UGT1A1 Genotyping in Gilbert Syndrome. Clin. Chem. 51: 2183-2185 [Full Text]  
• Costa, E., Vieira, E., dos Santos, R. (2005). The Polymorphism c.-3279T>G in the Phenobarbital-Responsive Enhancer Module of the Bilirubin UDP-Glucuronosyltransferase Gene Is Associated with Gilbert Syndrome. Clin. Chem. 51: 2204-2206 [Full Text]  
• French, D., Wilkinson, M. R., Yang, W., de Chaisemartin, L., Cook, E. H., Das, S., Ratain, M. J., Evans, W. E., Downing, J. R., Pui, C.-H., Relling, M. V. (2005). Global gene expression as a function of germline genetic variation. Hum Mol Genet 14: 1621-1629 [Abstract] [Full Text]  
• Wright, M. A., Morrison, G., Lin, P., Leonard, G. D., Nguyen, D., Guo, X., Szabo, E., Hopkins, J. L., Leguizamo, J. P., Harold, N., Fioravanti, S., Schuler, B., Monahan, B. P., Saif, M. W., Quinn, M. G., Pang, J., Grem, J. L. (2005). A Phase I Pharmacologic and Pharmacogenetic Trial of Sequential 24-Hour Infusion of Irinotecan Followed by Leucovorin and a 48-Hour Infusion of Fluorouracil in Adult Patients with Solid Tumors. Clin. Cancer Res. 11: 4144-4150 [Abstract] [Full Text]  
• Watchko, J. F. (2005). Vigintiphobia Revisited. Pediatrics 115: 1747-1753 [Abstract] [Full Text]  
• Peterson, S., Bigler, J., Horner, N. K., Potter, J. D., Lampe, J. W. (2005). Cruciferae Interact with the UGT1A1*28 Polymorphism to Determine Serum Bilirubin Levels in Humans. J. Nutr. 135: 1051-1055 [Abstract] [Full Text]  
• Lankisch, T. O., Vogel, A., Eilermann, S., Fiebeler, A., Krone, B., Barut, A., Manns, M. P., Strassburg, C. P. (2005). Identification and Characterization of a Functional TATA Box Polymorphism of the UDP Glucuronosyltransferase 1A7 Gene. Mol. Pharmacol. 67: 1732-1739 [Abstract] [Full Text]  
• Zukunft, J., Lang, T., Richter, T., Hirsch-Ernst, K. I., Nussler, A. K., Klein, K., Schwab, M., Eichelbaum, M., Zanger, U. M. (2005). A Natural CYP2B6 TATA Box Polymorphism (-82T-> C) Leading to Enhanced Transcription and Relocation of the Transcriptional Start Site. Mol. Pharmacol. 67: 1772-1782 [Abstract] [Full Text]  
• Kaniwa, N., Kurose, K., Jinno, H., Tanaka-Kagawa, T., Saito, Y., Saeki, M., Sawada, J.-i., Tohkin, M., Hasegawa, R. (2005). RACIAL VARIABILITY IN HAPLOTYPE FREQUENCIES OF UGT1A1 AND GLUCURONIDATION ACTIVITY OF A NOVEL SINGLE NUCLEOTIDE POLYMORPHISM 686C> T (P229L) FOUND IN AN AFRICAN-AMERICAN. Drug Metab. Dispos. 33: 458-465 [Abstract] [Full Text]  
• Giannini, E. G., Testa, R., Savarino, V. (2005). Liver enzyme alteration: a guide for clinicians. CMAJ 172: 367-379 [Abstract] [Full Text]  
• Lee, W., Lockhart, A. C., Kim, R. B., Rothenberg, M. L. (2005). Cancer Pharmacogenomics: Powerful Tools in Cancer Chemotherapy and Drug Development. The Oncologist 10: 104-111 [Abstract] [Full Text]  
• Haverfield, E. V., McKenzie, C. A., Forrester, T., Bouzekri, N., Harding, R., Serjeant, G., Walker, T., Peto, T. E. A., Ward, R., Weatherall, D. J. (2005). UGT1A1 variation and gallstone formation in sickle cell disease. Blood 105: 968-972 [Abstract] [Full Text]  
• Basu, A., Chaudhuri, P., Majumder, P. P. (2005). Identification of polymorphic motifs using probabilistic search algorithms. Genome Res 15: 67-77 [Abstract] [Full Text]  
• van der Logt, E.M.J., Bergevoet, S.M., Roelofs, H.M.J., van Hooijdonk, Z., te Morsche, R.H.M., Wobbes, T., de Kok, J.B., Nagengast, F.M., Peters, W.H.M. (2004). Genetic polymorphisms in UDP-glucuronosyltransferases and glutathione S-transferases and colorectal cancer risk. Carcinogenesis 25: 2407-2415 [Abstract] [Full Text]  
• Rouits, E., Boisdron-Celle, M., Dumont, A., Guerin, O., Morel, A., Gamelin, E. (2004). Relevance of Different UGT1A1 Polymorphisms in Irinotecan-Induced Toxicity: A Molecular and Clinical Study of 75 Patients. Clin. Cancer Res. 10: 5151-5159 [Abstract] [Full Text]  
• Sedlak, T. W., Snyder, S. H. (2004). Bilirubin Benefits: Cellular Protection by a Biliverdin Reductase Antioxidant Cycle. Pediatrics 113: 1776-1782 [Full Text]  
• McLeod, H. L., Watters, J. W. (2004). Irinotecan Pharmacogenetics: Is It Time to Intervene?. JCO 22: 1356-1359 [Full Text]  
• Innocenti, F., Undevia, S. D., Iyer, L., Xian Chen, P., Das, S., Kocherginsky, M., Karrison, T., Janisch, L., Ramirez, J., Rudin, C. M., Vokes, E. E., Ratain, M. J. (2004). Genetic Variants in the UDP-glucuronosyltransferase 1A1 Gene Predict the Risk of Severe Neutropenia of Irinotecan. JCO 22: 1382-1388 [Abstract] [Full Text]  
• Wells, P. G., Mackenzie, P. I., Roy Chowdhury, J., Guillemette, C., Gregory, P. A., Ishii, Y., Hansen, A. J., Kessler, F. K., Kim, P. M., Roy Chowdhury, N., Ritter, J. K. (2004). GLUCURONIDATION AND THE UDP-GLUCURONOSYLTRANSFERASES IN HEALTH AND DISEASE. Drug Metab. Dispos. 32: 281-290 [Abstract] [Full Text]  
• Duguay, Y., McGrath, M., Lepine, J., Gagne, J.-F., Hankinson, S. E., Colditz, G. A., Hunter, D. J., Plante, M., Tetu, B., Belanger, A., Guillemette, C., De Vivo, I. (2004). The Functional UGT1A1 Promoter Polymorphism Decreases Endometrial Cancer Risk. Cancer Res. 64: 1202-1207 [Abstract] [Full Text]  
• Fang, J.-L., Lazarus, P. (2004). Correlation between the UDP-Glucuronosyltransferase (UGT1A1) TATAA Box Polymorphism and Carcinogen Detoxification Phenotype: Significantly Decreased Glucuronidating Activity against Benzo(a)pyrene-7,8-dihydrodiol(-) in Liver Microsomes from Subjects with the UGT1A1*28 Variant. Cancer Epidemiol. Biomarkers Prev. 13: 102-109 [Abstract] [Full Text]  
• Jinno, H., Saeki, M., Saito, Y., Tanaka-Kagawa, T., Hanioka, N., Sai, K., Kaniwa, N., Ando, M., Shirao, K., Minami, H., Ohtsu, A., Yoshida, T., Saijo, N., Ozawa, S., Sawada, J.-I. (2003). Functional Characterization of Human UDP-Glucuronosyltransferase 1A9 Variant, D256N, Found in Japanese Cancer Patients. J. Pharmacol. Exp. Ther. 306: 688-693 [Abstract] [Full Text]  
• Mathijssen, R. H. J., Marsh, S., Karlsson, M. O., Xie, R., Baker, S. D., Verweij, J., Sparreboom, A., McLeod, H. L. (2003). Irinotecan Pathway Genotype Analysis to Predict Pharmacokinetics. Clin. Cancer Res. 9: 3246-3253 [Abstract] [Full Text]  
• Bosma, P. J., van der Meer, I. M., Bakker, C. T., Hofman, A., Paul-Abrahamse, M., Witteman, J. C. (2003). UGT1A1*28 Allele and Coronary Heart Disease: The Rotterdam Study. Clin. Chem. 49: 1180-1181 [Full Text]  
• Murata, M., Warren, E. H., Riddell, S. R. (2003). A Human Minor Histocompatibility Antigen Resulting from Differential Expression due to a Gene Deletion. J. Exp. Med. 197: 1279-1289 [Abstract] [Full Text]  
• Watanabe, Y., Nakajima, M., Ohashi, N., Kume, T., Yokoi, T. (2003). Glucuronidation of Etoposide in Human Liver Microsomes Is Specifically Catalyzed by UDP-Glucuronosyltransferase 1A1. Drug Metab. Dispos. 31: 589-595 [Abstract] [Full Text]  
• Iyer, L. V., Ho, M. N., Shinn, W. M., Bradford, W. W., Tanga, M. J., Nath, S. S., Green, C. E. (2003). Glucuronidation of 1'-Hydroxyestragole (1'-HE) by Human UDP-Glucuronosyltransferases UGT2B7 and UGT1A9. Toxicol Sci 73: 36-43 [Abstract] [Full Text]  
• Kaplan, M., Hammerman, C., Maisels, M. J. (2003). Bilirubin Genetics for the Nongeneticist: Hereditary Defects of Neonatal Bilirubin Conjugation. Pediatrics 111: 886-893 [Full Text]  
• Weinshilboum, R. (2003). Inheritance and Drug Response. NEJM 348: 529-537 [Full Text]  
• Jinno, H., Tanaka-Kagawa, T., Hanioka, N., Saeki, M., Ishida, S., Nishimura, T., Ando, M., Saito, Y., Ozawa, S., Sawada, J.-i. (2003). Glucuronidation of 7-Ethyl-10-hydroxycamptothecin (SN-38), an Active Metabolite of Irinotecan (CPT-11), by Human UGT1A1 Variants, G71R, P229Q, and Y486D. Drug Metab. Dispos. 31: 108-113 [Abstract] [Full Text]  
• Tukey, R. H., Strassburg, C. P., Mackenzie, P. I. (2002). Pharmacogenomics of Human UDP-Glucuronosyltransferases and Irinotecan Toxicity. Mol. Pharmacol. 62: 446-450 [Full Text]  
• Garcia-Carbonero, R., Supko, J. G. (2002). Current Perspectives on the Clinical Experience, Pharmacology, and Continued Development of the Camptothecins. Clin. Cancer Res. 8: 641-661 [Abstract] [Full Text]  
• Zucker, S. D., Qin, X., Rouster, S. D., Yu, F., Green, R. M., Keshavan, P., Feinberg, J., Sherman, K. E. (2001). Mechanism of indinavir-induced hyperbilirubinemia. Proc. Natl. Acad. Sci. USA 10.1073/pnas.231140698v1 [Abstract] [Full Text]  
• Stevenson, D. K., Fanaroff, A. A., Maisels, M. J., Young, B. W. Y., Wong, R. J., Vreman, H. J., MacMahon, J. R., Yeung, C. Y., Seidman, D. S., Gale, R., Oh, W., Bhutani, V. K., Johnson, L. H., Kaplan, M., Hammerman, C., Nakamura, H. (2001). Prediction of Hyperbilirubinemia in Near-Term and Term Infants. Pediatrics 108: 31-39 [Abstract] [Full Text]  
• Guillemette, C., De Vivo, I., Hankinson, S. E., Haiman, C. A., Spiegelman, D., Housman, D. E., Hunter, D. J. (2001). Association of Genetic Polymorphisms in UGT1A1 with Breast Cancer and Plasma Hormone Levels. Cancer Epidemiol. Biomarkers Prev. 10: 711-714 [Abstract] [Full Text]  
• Aguilar-Martinez, P, Bismuth, M, Picot, M C, Thelcide, C, Pageaux, G-P, Blanc, F, Blanc, P, Schved, J-F, Larrey, D (2001). Variable phenotypic presentation of iron overload in H63D homozygotes: are genetic modifiers the cause?. Gut 48: 836-842 [Abstract] [Full Text]  
• Innocenti, F., Iyer, L., Ratain, M. J. (2001). Pharmacogenetics of Anticancer Agents: Lessons from Amonafide and Irinotecan. Drug Metab. Dispos. 29: 596-600 [Abstract] [Full Text]  
• Ewesuedo, R. B., Iyer, L., Das, S., Koenig, A., Mani, S., Vogelzang, N. J., Schilsky, R. L., Brenckman, W., Ratain, M. J. (2001). Phase I Clinical and Pharmacogenetic Study of Weekly TAS-103 in Patients With Advanced Cancer. JCO 19: 2084-2090 [Abstract] [Full Text]  
• KADAKOL, A., SAPPAL, B. S, GHOSH, S. S, LOWENHEIM, M., CHOWDHURY, A., CHOWDHURY, S., SANTRA, A., ARIAS, I. M, CHOWDHURY, J. R., CHOWDHURY, N. R. (2001). Interaction of coding region mutations and the Gilbert-type promoter abnormality of the UGT1A1 gene causes moderate degrees of unconjugated hyperbilirubinaemia and may lead to neonatal kernicterus. J. Med. Genet. 38: 244-249 [Full Text]  
• Tukey, R. H., Strassburg, C. P. (2001). Genetic Multiplicity of the Human UDP-Glucuronosyltransferases and Regulation in the Gastrointestinal Tract. Mol. Pharmacol. 59: 405-414 [Abstract] [Full Text]  
• Dennery, P. A., Seidman, D. S., Stevenson, D. K. (2001). Neonatal Hyperbilirubinemia. NEJM 344: 581-590 [Full Text]  
• Ando, Y., Saka, H., Ando, M., Sawa, T., Muro, K., Ueoka, H., Yokoyama, A., Saitoh, S., Shimokata, K., Hasegawa, Y. (2000). Polymorphisms of UDP-Glucuronosyltransferase Gene and Irinotecan Toxicity: A Pharmacogenetic Analysis. Cancer Res. 60: 6921-6926 [Abstract] [Full Text]  
• von Ahsen, N., Oellerich, M., Schutz, E. (2000). DNA Base Bulge vs Unmatched End Formation in Probe-based Diagnostic Insertion/Deletion Genotyping: Genotyping the UGT1A1 (TA)n Polymorphism by Real-Time Fluorescence PCR. Clin. Chem. 46: 1939-1945 [Abstract] [Full Text]  
• Dufour, D. R., Lott, J. A., Nolte, F. S., Gretch, D. R., Koff, R. S., Seeff, L. B. (2000). Diagnosis and Monitoring of Hepatic Injury. I. Performance Characteristics of Laboratory Tests. Clin. Chem. 46: 2027-2049 [Abstract] [Full Text]  
• Maruo, Y., Nishizawa, K., Sato, H., Sawa, H., Shimada, M. (2000). Prolonged Unconjugated Hyperbilirubinemia Associated With Breast Milk and Mutations of the Bilirubin Uridine Diphosphate- Glucuronosyltransferase Gene. Pediatrics 106: 59e-59 [Abstract] [Full Text]  
• IOLASCON, A., MELONI, A., COPPOLA, B., ROSATELLI, M. C. (2000). Crigler-Najjar syndrome type II resulting from three different mutations in the bilirubin uridine 5'-diphosphate-glucuronosyltransferase (UGT1A1) gene. J. Med. Genet. 37: 712-713 [Full Text]  
• Bhutani, V. K., Gourley, G. R., Adler, S., Kreamer, B., Dalin, C., Johnson, L. H. (2000). Noninvasive Measurement of Total Serum Bilirubin in a Multiracial Predischarge Newborn Population to Assess the Risk of Severe Hyperbilirubinemia. Pediatrics 106: 17e-17 [Abstract] [Full Text]  
• Raftogianis, R., Creveling, C., Weinshilboum, R., Weisz, J. (2000). Chapter 6: Estrogen Metabolism by Conjugation. J Natl Cancer Inst Monogr 2000: 113-124 [Abstract] [Full Text]  
• Lampe, J. W., Bigler, J., Bush, A. C., Potter, J. D. (2000). Prevalence of Polymorphisms in the Human UDP-Glucuronosyltransferase 2B Family: UGT2B4(D458E), UGT2B7(H268Y), and UGT2B15(D85Y). Cancer Epidemiol. Biomarkers Prev. 9: 329-333 [Abstract] [Full Text]  
• Marziliano, N., Pelo, E., Minuti, B., Passerini, I., Torricelli, F., Da Prato, L. (2000). Melting Temperature Assay for a UGT1A Gene Variant in Gilbert Syndrome. Clin. Chem. 46: 423-425 [Full Text]  
• Guillemette, C., Millikan, R. C., Newman, B., Housman, D. E. (2000). Genetic Polymorphisms in Uridine Diphospho-Glucuronosyltransferase 1A1 and Association with Breast Cancer among African Americans. Cancer Res. 60: 950-956 [Abstract] [Full Text]  
• Kaplan, M., Hammerman, C. (2000). Glucose-6-Phosphate Dehydrogenase Deficiency: A Worldwide Potential Cause of Severe Neonatal Hyperbilirubinemia. NeoReviews 1: e32-39 [Full Text]  
• Pirulli, D., Giordano, M., Puzzer, D., Crovella, S., Rigato, I., Tiribelli, C., Momigliano-Richiardi, P., Amoroso, A. (2000). Rapid Method for Detection of Extra (TA) in the Promoter of the Bilirubin-UDP-Glucuronosyl Transferase 1 Gene Associated with Gilbert Syndrome. Clin. Chem. 46: 129-131 [Full Text]  
• Trioche, P., Chalas, J., Francoual, J., Capel, L., Lindenbaum, A., Odièvre, M., Labrune, P. (1999). Jaundice with hypertrophic pyloric stenosis as an early manifestation of Gilbert syndrome. Arch. Dis. Child. 81: 301-303 [Abstract] [Full Text]  
• del Giudice, E. M., Perrotta, S., Nobili, B., Specchia, C., d'Urzo, G., Iolascon, A. (1999). Coinheritance of Gilbert Syndrome Increases the Risk for Developing Gallstones in Patients With Hereditary Spherocytosis. Blood 94: 2259-2262 [Abstract] [Full Text]  
• Cheng, L., Guan, Y., Li, L., Legerski, R. J., Einspahr, J., Bangert, J., Alberts, D. S., Wei, Q. (1999). Expression in Normal Human Tissues of Five Nucleotide Excision Repair Genes Measured Simultaneously by Multiplex Reverse Transcription-Polymerase Chain Reaction. Cancer Epidemiol. Biomarkers Prev. 8: 801-807 [Abstract] [Full Text]  
• Bernard, P., Goudonnet, H., Artur, Y., Desvergne, B., Wahli, W. (1999). Activation of the Mouse TATA-less and Human TATA-Containing UDP-Glucuronosyltransferase 1A1 Promoters by Hepatocyte Nuclear Factor 1. Mol. Pharmacol. 56: 526-536 [Abstract] [Full Text]  
• WAKU, S., TAKESHIMA, Y., NAKAMURA, H., NISHIO, H., SUMINO, K. (1999). A variant TATA box in the bilirubin UDP-glucuronosyltransferase 1 gene promoter does not contribute to neonatal jaundice in the Japanese population. Arch. Dis. Child. Fetal Neonatal Ed. 81: 159F-159 [Full Text]  
• Kaplan, M., Beutler, E., Vreman, H. J., Hammerman, C., Levy-Lahad, E., Renbaum, P., Stevenson, D. K. (1999). Neonatal Hyperbilirubinemia in Glucose-6-Phosphate Dehydrogenase-deficient Heterozygotes. Pediatrics 104: 68-74 [Abstract] [Full Text]