Time of Onset of Non-Insulin-Dependent Diabetes Mellitus and Genetic Variation in the ß3-AdrenergicReceptor Gene
Jeremy Walston, M.D., Kristi Silver, M.D., Clifton Bogardus, M.D., William C. Knowler, M.D., Dr.P.H., Francesco S. Celi, M.D., Sharon Austin, M.D., Brian Manning, Ph.D., A. Donny Strosberg, Ph.D., Michael P. Stern, M.D., M.P.H., Nina Raben, M.D., John D. Sorkin, M.D., Jesse Roth, M.D., and Alan R. Shuldiner, M.D.
Background The 3-adrenergic receptor is expressed in visceraladipose tissue and is thought to contribute to the regulationof the resting metabolic rate and lipolysis.
Methods To investigate whether mutations in the gene for the3-adrenergic receptor predispose patients to obesity and non-insulin-dependentdiabetes mellitus (NIDDM), we studied this gene in 10 Pima Indiansby analysis of single-stranded conformational polymorphismsand dideoxy sequence analysis. Association studies were performedin 642 Pima subjects (390 with NIDDM and 252 without NIDDM).
Results A missense mutation was identified in the gene for the3-adrenergic receptor that results in the replacement of tryptophanby arginine (Trp64Arg) in the first intracellular loop of thereceptor. This mutation was detected with allelic frequenciesof 0.31 in Pima Indians, 0.13 in 62 Mexican Americans, 0.12in 49 blacks, and 0.08 in 48 whites in the United States. AmongPimas, the frequency of the Trp64Arg mutation was similar innondiabetic and diabetic subjects. However, in subjects homozygousfor the mutation the mean (±SD) age at the onset of NIDDMwas significantly lower (36±10 years) than in Trp64Argheterozygotes (40±10 years) or normal homozygotes (41±11years; P = 0.02). Furthermore, subjects with the mutation tendedto have a lower adjusted resting metabolic rate (P = 0.14 byanalysis of covariance).
Conclusions Pima subjects homozygous for the Trp64Arg 3-adrenergicreceptormutation have an earlier onset of NIDDM and tend to have a lowerresting metabolic rate. This mutation may accelerate the onsetof NIDDM by altering the balance of energy metabolism in visceraladipose tissue.
Non-insulin-dependent diabetes mellitus (NIDDM) is one of themost common inherited diseases, with an estimated prevalenceof 8 to 10 percent among whites.1 Although most forms of thedisease do not have a simple mendelian pattern of inheritance,the contribution of heredity is well recognized.2 It is likelythat the common forms of NIDDM are complex and heterogeneousand that they result when a pool of mutant genes, each contributingin a small and subtle way, interact with one another and withenvironmental, aging, and behavioral influences to lead to theexpression of the disease.2,3,4
Obesity is a known risk factor for the development of NIDDM5,6and, like NIDDM, has clear genetic determinants.7,8 In humans,resting metabolic rate is a familial trait,9,10 and a low restingmetabolic rate is a risk factor for weight gain and obesity.11,12In rodents, resting metabolic rate is regulated by the sympatheticnervous system and acts through the modulation of lipolysisand thermogenesis in brown adipose tissue.13,14 Although adulthumans do not have anatomically distinct deposits of brown adiposetissue, the identification of uncoupling protein, a marker widelyregarded as specific for such tissue, suggests that modulationof thermogenesis may also be important in human adipose tissue.15
The 3-adrenergic receptor crosses the cell membrane seven times,is coupled to guanine-nucleotidebinding (G) proteins,and is localized in adipose tissue. Stimulation of the receptorby -adrenergic agonists activates adenylate cyclase, which increasesintracellular concentrations of cyclic AMP (cAMP) and resultsin increased lipolysis and thermogenesis.16,17,18 There is evidencethat molecular abnormalities in the 3-adrenergic receptor maylead to obesity and NIDDM. Expression of the receptor is markedlydecreased in rodent models of obesity19,20; mice with knockout(disruption) of the gene for the receptor have marked reductionsin lipolysis stimulated by -agonists,21 and 3-specific agonistshave potent antiobesity and antidiabetic effects in both animals22,23and humans.23,24 To examine further the potential role of inheriteddefects in this gene as contributors to obesity and NIDDM, weevaluated a group of Pima Indians, an ethnic group with a veryhigh prevalence of these disorders, for the presence of mutationsin the 3-adrenergicreceptor gene.
Methods
Study Subjects
All protocols were approved by the ethics committees of theNational Institute of Diabetes and Digestive and Kidney Diseases,the Indian Health Service, and the tribal council of the GilaRiver Indian Community and were performed after written informedconsent was obtained from the subjects. The 642 subjects (390with NIDDM and 252 without NIDDM) who participated in the mainstudy were full-blooded Pima or Tohono O'odham Indians (or amixture of these two closely related tribes) 35 to 87 yearsof age. The selection of subjects was not based on their familialrelationship to any other subject or to the presence of diabetes.NIDDM was diagnosed on the basis of the classification systemof the World Health Organization.25 Anthropometric measurementsand measurements of body composition were made by standard methods.26The relations among the 3-adrenergicreceptor genotype,the resting metabolic rate (which was measured by indirect calorimetrywith the subject in a respiratory chamber), plasma concentrationsof glucose and insulin after oral glucose administration, andsensitivity to insulin (as determined by the hyperinsulinemiceuglycemicclamp technique) were studied in a separate group of 210 nondiabeticPima Indians.9,26 For the estimation of allelic frequencies,3-adrenergicreceptor genotypes were also determined in62 Mexican Americans from San Antonio, Texas,27 and in 49 blacksand 48 whites from the Baltimore metropolitan area.
Analysis of Single-Stranded Conformational Polymorphisms of the 3-AdrenergicReceptor Gene
Genomic DNA was prepared from leukocytes or immortalized celllines by established methods. Genomic DNA was amplified by thepolymerase chain reaction (PCR) as described elsewhere.28 Tenpairs of primers were used to generate 10 overlapping PCR productsencompassing the entire coding region, the 5' untranslated region,the exonintron splice junctions, and 521 base pairs (bp)of the regulatory region of the 3-adrenergicreceptorgene17,20,29 (and data deposited with the National AuxiliaryPublications Service, *). For the analysis of single-strandedconformational polymorphisms, the PCR products were radiolabeledby the addition of [-32P]deoxycytidine triphosphate to the reactionmixture. Denatured PCR products were loaded onto a polyacrylamidegel (MDE, AT Biochemicals, Malvern, Pa.), and subjected to electrophoresisat 4 to 6 W for 18 to 20 hours under four gel conditions: withand without 10 percent glycerol at 4°C and at 25°C.30The gel was vacuum-dried, and autoradiography was performed.
Dideoxy Sequence Analysis
Variants detected by analysis of single-stranded conformationalpolymorphisms were subjected to direct dideoxy sequence analysiswith asymmetric PCR28 and Sequenase Version 2.0 kits (UnitedStates Biochemicals, Cleveland). Changes in bases were confirmedby the sequencing of the opposite strands and by digestion withrestriction enzymes.
Detection of the Mutated Receptor by Hybridization with Allele-Specific Oligonucleotides
A 367-bp fragment of the 3-adrenergicreceptor gene encompassingthe mutation site was amplified by PCR with primers 5'TTCCTTCTTTCCCTACCGCCC3'and 5'GCAGCCAGTGGCGCCCAACGG3'. The PCR products were blottedin duplicate onto nylon membranes. Hybridization was accomplishedwith 32P-radiolabeled oligonucleotides corresponding to eitherthe normal sequence of the 3-adrenergicreceptor gene(5'CATCGCCTGGACTCCGA3'; the probe for Trp64) or the sequenceof the Trp64Arg 3-adrenergicreceptor gene (5'CATCGCCCGGACTCCGA3';the probe for Arg64).31 The membranes were then washed twicein 2x sodium chloridesodium phosphateEDTA (SSPE)(1x SSPE is 150 mM sodium chloride, 10 mM sodium phosphate,and 1.25 mM EDTA; pH 7.4) and 0.05 percent sodium dodecyl sulfateat 60°C (the Trp64 probe) or 62°C (the Arg64 probe)for 15 minutes, and autoradiography was performed.
Statistical Analysis
In the studies of the association of variables with genotype,chi-square tests were performed. In the analysis of quantitativetraits, an analysis of variance was used and, where appropriate,covariates were included in the models.
Results
Analysis of Single-Stranded Conformational Polymorphisms
Ten Pima Indians with obesity and NIDDM, none of whom were first-degreerelatives of each other, were initially screened for variationin the 3-adrenergicreceptor gene. Analysis of single-strandedconformational polymorphisms revealed two variant patterns inthe coding region. Dideoxy sequence analysis of one variant(present in 2 of the 10 Pimas) revealed a silent replacementof cytosine (C) by thymidine (T) at nucleotide position 381(codon 127; i.e., ACCThrACTThr). Sequence analysis of the secondvariant (present in 5 of the 10 Pimas) revealed a heterozygouspattern with a replacement of thymidine (T) by cytosine (C)at nucleotide position 190 (Figure 1A and Figure 1B). This changein bases predicted a replacement of tryptophan (TGG) by arginine(CGG) at position 64 (Trp64Arg), an amino acid in the firstof the three intracellular loops of the receptor (Figure 2).This change in bases was confirmed by restriction-enzyme digestionwith BstNI (Figure 3A and Figure 3B). To screen for mutationsthat may have been missed in the analysis of single-strandedconformational polymorphisms, the entire coding region of the3-adrenergicreceptor gene was sequenced in two additionalPima Indians with NIDDM. No new base changes were identified.
Figure 1. Identification of the Trp64Arg Mutation of the 3-AdrenergicReceptor Gene.
Panel A shows an autoradiograph of an analysis of conformational polymorphisms in a single strand of DNA from a region of the 3-adrenergicreceptor gene in 7 of 10 diabetic Pima Indians. The arrow shows a variant pattern in lanes 2 through 6. Panel B shows autoradiographs obtained by direct sequence analysis of a region of the gene, with the normal sequence on the left. The sequencing of one of the PCR products that revealed a variant pattern in Panel A showed both a thymidine (T) and a cytosine (C) at nucleotide position 190. The patient with this pattern was therefore heterozygous for the nucleotide substitution that alters the predicted sequence of amino acids at codon 64, causing a replacement of tryptophan by arginine (TGGCGG, or Trp64Arg).
Figure 3. Use of Restriction-Enzyme Digestion to Confirm the Presence of the Trp64Arg Mutation.
Panel A shows a restriction map of the 367-bp PCR product used for digestion with BstNI. Digestion of the normal sequence yields fragments of 15, 34, 61, 66, 94, and 97 bp in length, whereas the Trp64Arg mutation eliminates one of the BstNI sites (dashed line), yielding a novel 158-bp product. Panel B shows an ethidium bromidestained gel after the digestion of two DNA samples with BstNI. One subject was heterozygous for the Trp64Arg mutation of the 3-adrenergicreceptor gene (Trp/Arg), and the other was homozygous for the normal receptor (Trp/Trp). As predicted, the mutation eradicated one of the five BstNI sites in the normal sequence, causing a 158-bp product that is not normally present to appear.
Allelic Frequencies of the Trp64Arg Mutation in Pima Indians and Other Subjects
Genomic DNA from 642 Pima Indians (390 subjects with NIDDM and252 without NIDDM) was subjected to genotyping for the Trp64Argmissense mutation in the 3-adrenergic receptor by hybridizationwith allele-specific oligonucleotides (Figure 4). The frequencyof the Trp64Arg allele was 0.31. Nine percent of the subjectswere homozygous for the mutation, 45 percent were heterozygous,and 46 percent lacked the mutation. When the genotypes wereanalyzed according to the subjects' age and sex, there was astatistically significant underrepresentation of Trp64Arg homozygotesamong men 45 or older (P = 0.02) (Table 1).
Figure 4. Detection of Mutated and Normal 3-Adrenergic Receptors by Hybridization with Allele-Specific Oligonucleotides.
The 367-bp PCR products encompassing the Trp64Arg mutation in five Pima Indians were subjected to slot blot analysis in duplicate with oligonucleotide probes that specifically recognize either the normal 3-adrenergic receptor (the Trp64 probe) or the mutation (the Arg64 probe), and autoradiography was performed. Normal homozygotes (Trp/Trp), heterozygotes (Trp/Arg), and Trp64Arg homozygotes (Arg/Arg) could be detected rapidly with this assay.
Table 1. Frequency of Homozygosity for the Trp64Arg Mutation of the b3-AdrenergicReceptor Gene among the Pima Indians Studied, According to Age.
The frequency of the Trp64Arg allele among the 62 Mexican Americans(with 124 alleles) was 0.13. Among the 49 blacks (with 98 alleles)it was 0.12, and among the 48 whites (with 96 alleles) it was0.08.
The Trp64Arg Genotype, NIDDM, and Obesity
Diabetes was not significantly associated with the Trp64Arggenotype in the 642 Pima Indians; the prevalence of NIDDM was72 percent, 60 percent, and 60 percent, respectively, amongTrp64Arg homozygotes, Trp64Arg heterozygotes, and normal homozygotes(P = 0.19). From these data we concluded that the prevalenceof NIDDM was slightly but not significantly higher among Trp64Arghomozygotes than among the Pima subjects with the other twogenotypes (prevalence-rate ratio, 1.2; 95 percent confidenceinterval, 1.0 to 1.5). The mean age of the Trp64Arg homozygotesat the onset of NIDDM was significantly lower than that of theheterozygotes and the normal homozygotes (P = 0.02) (Table 2).In view of this finding, we also examined the prevalence ofdiabetes that was diagnosed before the age of 25 years. Overall,this prevalence did not differ significantly between the threegroups (P = 0.11), although our data showed that the prevalenceof diabetes diagnosed before the age of 25 years was higheramong Trp64Arg homozygotes than among subjects with either ofthe other two genotypes (prevalence-rate ratio, 2.7; 95 percentconfidence interval, 1.1 to 6.8).
Table 2. Characteristics of 642 Pima Indians According to Genotype of the b3-Adrenergic Receptor.
There was a trend toward a higher mean (±SD) body-massindex (the weight in kilograms divided by the square of theheight in meters) among the subjects homozygous for the Trp64Argmutation (35.2±8.0) than among subjects heterozygousfor the mutation (34.1±7.9) or the normal homozygotes(33.9±7.5) (Table 2). Although this trend persisted afteradjustment for age and sex, the differences were not statisticallysignificant; nor were there significant differences in the ratioof the waist to the hip circumference.
The Trp64Arg Mutation and the Resting Metabolic Rate
When we studied the separate group of 210 Pima Indians, we founda trend toward a lower resting metabolic rate in subjects withthe Trp64Arg mutation of the 3-adrenergic receptor (Table 2).After we adjusted for known covariates of the resting metabolicrate (fat-free mass, fat mass, and sex), the 22 subjects homozygousfor the mutation expended an average of 82 kcal per day lessthan the 82 normal homozygotes; in the 106 heterozygotes, theaverage resting metabolic rate (36 kcal per day less than thatof the normal homozygotes) was intermediate between the valuesfor the two other groups (P = 0.14 by analysis of covariance).There were no significant associations of genotype with plasmaconcentrations of glucose or insulin during an oral glucose-tolerancetest or with sensitivity to insulin as measured by the hyperinsulinemiceuglycemicclamp technique in this group.
Discussion
We have identified a mutation in the 3-adrenergicreceptorgene that, although not in itself associated with NIDDM, wasassociated with the onset of NIDDM at an earlier age among PimaIndians homozygous for the mutation. This finding suggests thatthe mutation is not a major determinant of NIDDM in these subjects,but rather acts to accelerate the course of the disease. Theunderrepresentation in the study sample of men 45 or older whowere homozygous for the mutation may indicate early mortality,perhaps due to the long-term complications of diabetes thatwould be expected if the disease had an earlier onset.
Very small decrements in the resting metabolic rate can leadto excess accumulation of energy, weight gain, and obesity.In prospective studies of adult Pima Indians, a small dailydifference in the metabolic rate (70 kcal) was a risk factorfor weight gain and obesity.12 Indeed, subjects with the Trp64Argmutation in the gene for the 3-adrenergic receptor tended tohave lower resting metabolic rates but were no more obese thannormal subjects. Prospective measures of weight gain in youngersubjects and association studies in subjects less geneticallypredisposed to obesity will be needed to define further theinfluence of this mutation on low energy expenditure and thedevelopment of obesity and NIDDM. Indeed, data from Widénand Clément and their colleagues,32,33 in addition toour own studies of Mexican Americans (unpublished data), implicatethis mutation, even in its heterozygous form, as a contributorto central obesity and weight gain, as well as to insulin resistanceand NIDDM with an accelerated onset. These studies provide additionalevidence that this missense mutation contributes to the geneticbasis of the common forms of obesity, insulin resistance, andNIDDM.
The Trp64Arg mutation appears at the beginning of the firstintracellular loop of the 3-adrenergic receptor (Figure 2).On the basis of studies of the related 2-adrenergic receptor34and rhodopsin,35 the first intracellular loop is thought tobe important for the proper movement of the receptor to thecell surface and possibly also for its coupling to G proteins.Defective expression at the cell surface or impaired signalingmay lead to decreased lipolysis and thermogenesis in visceralfat tissue that may contribute to central obesity, insulin resistance,and NIDDM.
Supported by a grant (NIA 5T32AG00120) from the National Institutesof Health and by grants from the Mallinckrodt Foundation (toDr. Shuldiner), the American Federation of Aging Research (toDr. Shuldiner), the Chesapeake Education and Research Trust(to Drs. Walston, Silver, Austin, and Shuldiner), the RobertWood Johnson Foundation (to Dr. Austin), and the Hartford Foundation(to Drs. Walston and Austin). Dr. Walston was supported by aPfizerAmerican Geriatrics Society postdoctoral fellowship.
We are indebted to Drs. John Burton and Philip Zieve for theirsupport; to Drs. Reubin Andres, Terri Beaty, and Chahrzad Rafizadeh-Montrosefor their advice and helpful comments; and to Mr. Keith Tannerand Ms. Amy Patterson for their assistance.
* See NAPS document no. 05233 for one page of supplementary material.To order, contact NAPS c/o Microfiche Publications, 248 HempsteadTpk., West Hempstead, NY 11552.
Source Information
From the Divisions of Geriatric Medicine and Gerontology (J.W., F.S.C., S.A., J.R., A.R.S.) and Endocrinology and Metabolism (K.S.), Johns Hopkins University School of Medicine, Baltimore; the Clinical Diabetes and Nutrition Section (C.B.) and the Diabetes and Arthritis Epidemiology Section (W.C.K.), National Institute of Diabetes and Digestive and Kidney Diseases, Phoenix, Ariz.; the Laboratory of Clinical Physiology, National Institute on Aging, Baltimore (F.S.C., J.D.S.); the Arthritis and Rheumatism Branch, National Institute of Arthritis and Musculoskeletal and Skin Diseases, Bethesda, Md. (N.R.); the Laboratoire d'Immunopharmacologie Moléculaire, Institut Cochin de Génétique Moléculaire, Paris (B.M., A.D.S.); and the Department of Medicine, Division of Clinical Epidemiology, University of Texas Health Science Center, San Antonio (M.P.S.).
Address reprint requests to Dr. Shuldiner at the Johns Hopkins University School of Medicine, 5501 Bayview Cir., Rm. 5A42, Baltimore, MD 21224.
References
Harris MI, Hadden WC, Knowler WC, Bennett PH. Prevalence of diabetes and impaired glucose tolerance and plasma glucose levels in U.S. population aged 20-74 yr. Diabetes 1987;36:523-534. [Abstract]
Rotter JI, Vadheim CM, Rimoin DL. Genetics of diabetes mellitus. In: Rifkin H, Porte D Jr, eds. Ellenberg and Rifkin's diabetes mellitus: theory and practice. 4th ed. New York: Elsevier, 1990:378-413.
Elbein SC, Hoffman MD, Bragg KL, Mayorga RA. The genetics of NIDDM: an update. Diabetes Care 1994;17:1523-1533. [Medline]
Turner RC, Hattersley AT, Shaw JTE, Levy JC. Type II diabetes: clinical aspects of molecular biological studies. Diabetes 1995;44:1-10. [Abstract]
Barrett-Connor E. Epidemiology, obesity, and non-insulin-dependent diabetes mellitus. Epidemiol Rev 1989;11:172-181. [Free Full Text]
Knowler WC, Pettitt D, Saad M, et al. Obesity in the Pima Indians: its magnitude and relationship with diabetes. Am J Clin Nutr 1991;53:Suppl:1543S-1551S. [Free Full Text]
Bouchard C. Genetics of obesity and its prevention. World Rev Nutr Diet 1993;72:68-77. [Medline]
Stunkard AJ, Sørensen TIA, Hanis C, et al. An adoption study of human obesity. N Engl J Med 1986;314:193-198. [Abstract]
Bogardus C, Lillioja S, Ravussin E, et al. Familial dependence of the resting metabolic rate. N Engl J Med 1986;315:96-100. [Abstract]
Bouchard C, Tremblay A, Nadeau A, et al. Genetic effect in resting and exercise metabolic rates. Metabolism 1989;38:364-370. [CrossRef][Medline]
Ravussin E, Lillioja S, Knowler WC, et al. Reduced rate of energy expenditure as a risk factor for body-weight gain. N Engl J Med 1988;318:467-472. [Abstract]
Griffiths M, Payne PR, Stunkard AJ, Rivers JP, Cox M. Metabolic rate and physical development in children at risk of obesity. Lancet 1990;336:76-78. [CrossRef][Medline]
Rothwell NJ, Stock MJ. A role for brown adipose tissue in diet-induced thermogenesis. Nature 1979;281:31-35. [CrossRef][Medline]
Trayhurn P, Mercer SW. Brown adipose tissue thermogenesis in obese animals. Biochem Soc Trans 1986;14:236-239. [Medline]
Cassard AM, Bouillaud F, Mattei MG, et al. Human uncoupling protein gene: structure, comparison with rat gene, and assignment to the long arm of chromosome 4. J Cell Biochem 1990;43:255-264. [CrossRef][Medline]
Emorine LJ, Marullo S, Briend-Sutren M-M, et al. Molecular characterization of the human 3-adrenergic receptor. Science 1989;245:1118-1121. [Free Full Text]
van Spronsen A, Nahmias C, Krief S, Briend-Sutren MM, Strosberg AD, Emorine LJ. The promoter and intron/exon structure of the human and mouse 3-adrenergic-receptor genes. Eur J Biochem 1993;213:1117-1124. [Medline]
Krief S, Lönnqvist F, Raimbault S, et al. Tissue distribution of 3-adrenergic receptor mRNA in man. J Clin Invest 1993;91:344-349.
Collins S, Daniel KW, Rohlfs EM, Ramkumar V, Taylor IL, Gettys TW. Impaired expression and functional activity of the 3- and 1-adrenergic receptors in adipose tissue of congenitally obese (C57BL/6J ob/ob) mice. Mol Endocrinol 1994;8:518-527. [Abstract]
Muzzin P, Revelli J-P, Kuhne F, et al. An adipose tissue-specific -adrenergic receptor: molecular cloning and down-regulation in obesity. J Biol Chem 1991;266:24053-24058. [Free Full Text]
Susulic S, Frederich RC, Lawitts JA, et al. Knockout of the 3-adrenergic receptor gene. In: Program and abstracts of the 77th annual meeting of the Endocrine Society, June 14-17, 1995, Bethesda, Md.: Endocrine Society, 1995:36. abstract.
Himms-Hagen J, Cui J, Danforth E Jr, et al. Effect of CL-316,243, a thermogenic 3-agonist, on energy balance and brown and white adipose tissues in rats. Am J Physiol 1994;266:R1371-R1382. [Free Full Text]
Connacher AA, Bennet WM, Jung RT. Clinical studies with the -adrenoreceptor agonist BRL 26830A. Am J Clin Nutr 1992;55:Suppl:258S-261S. [Free Full Text]
Mitchell TH, Ellis RD, Smith SA, Robb G, Cawthorne MA. Effects of BRL 35135, a -adrenoreceptor agonist with novel selectivity, on glucose tolerance and insulin sensitivity in obese subjects. Int J Obes 1989;13:757-766. [Medline]
Diabetes mellitus: report of a WHO study group. World Health Organ Tech Rep Ser 1985;727:7-113.
Prochazka M, Lillioja S, Tait JF, et al. Linkage of chromosomal markers on 4q with a putative gene determining maximal insulin action in Pima Indians. Diabetes 1993;42:514-519. [Abstract]
Mitchell BD, Kammerer CM, Reinhart LJ, Stern MP. NIDDM in Mexican-American families: heterogeneity by age of onset. Diabetes Care 1994;17:567-573. [Abstract]
Shuldiner AR, Perfetti R. The polymerase chain reaction: applications to endocrine research. In: de Pablo F, Scanes CG, eds. Handbook of endocrine research techniques. San Diego, Calif.: Academic Press, 1993:457-86.
Liggett SB, Schwinn DA. Multiple potential regulatory elements in the 5' flanking region of the 3-adrenergic receptor. DNA Seq 1992;2:61-63.
Orita M, Suzuki Y, Sekiya T, Hayashi K. Rapid and sensitive detection of point mutations and DNA polymorphisms using the polymerase chain reaction. Genomics 1989;5:874-879. [CrossRef][Medline]
Lyons J. Analysis of ras gene point mutations by PCR and oligonucleotide hybridization. In: Innis MA, Gelfand DH, Sninsky JJ, White TJ, eds. PCR protocols: a guide to methods and applications. San Diego, Calif.: Academic Press, 1990.
Widén E, Lehto M, Kanninen T, Walston J, Shuldiner AR, Groop LC. Association of a polymorphism in the 3-adrenergic-receptor gene with features of the insulin resistance syndrome in Finns. N Engl J Med 1995;333:348-351. [Free Full Text]
Clément K, Vaisse C, Manning BSJ, et al. Genetic variation in the 3-adrenergic receptor and an increased capacity to gain weight in patients with morbid obesity. N Engl J Med 1995;333:352-354. [Free Full Text]
Ostrowski J, Kjelsberg MA, Caron MG, Lefkowitz RJ. Mutagenesis of the 2-adrenergic receptor: how structure elucidates function. Annu Rev Pharmacol Toxicol 1992;32:167-183. [Medline]
Sung CH, Davenport CM, Nathans J. Rhodopsin mutations responsible for autosomal dominant retinitis pigmentosa: clustering of functional classes along the polypeptide chain. J Biol Chem 1993;268:26645-26649. [Free Full Text]
Pierola, J., Barcelo, A., de la Pena, M., Barbe, F., Soriano, J. B., Sanchez Armengol, A., Martinez, C., Agusti, A.
(2007). {beta}3-Adrenergic receptor Trp64Arg polymorphism and increased body mass index in sleep apnoea. Eur Respir J
30: 743-747
[Abstract][Full Text]
Marin, C., Perez-Jimenez, F., Gomez, P., Delgado, J., Paniagua, J. A., Lozano, A., Cortes, B., Jimenez-Gomez, Y., Gomez, M. J., Lopez-Miranda, J.
(2005). The Ala54Thr polymorphism of the fatty acid-binding protein 2 gene is associated with a change in insulin sensitivity after a change in the type of dietary fat. Am. J. Clin. Nutr.
82: 196-200
[Abstract][Full Text]
Masuo, K., Katsuya, T., Fu, Y., Rakugi, H., Ogihara, T., Tuck, M. L.
(2005). Lys418Asn Polymorphism of the {alpha}2-Adrenoceptor Gene Relates to Serum Uric Acid Levels But Not to Insulin Sensitivity. Hypertension
46: 144-150
[Abstract][Full Text]
Masuo, K., Katsuya, T., Fu, Y., Rakugi, H., Ogihara, T., Tuck, M. L.
(2005). {beta}2- and {beta}3-Adrenergic Receptor Polymorphisms Are Related to the Onset of Weight Gain and Blood Pressure Elevation Over 5 Years. Circulation
111: 3429-3434
[Abstract][Full Text]
Gomez, P., Perez-Jimenez, F., Marin, C., Moreno, J. A., Gomez, M. J., Bellido, C., Perez-Martinez, P., Fuentes, F., Paniagua, J. A., Lopez-Miranda, J.
(2005). The -514 C/T polymorphism in the hepatic lipase gene promoter is associated with insulin sensitivity in a healthy young population. J Mol Endocrinol
34: 331-338
[Abstract][Full Text]
Wang, X., Cui, Y., Tong, X., Ye, H., Li, S.
(2004). Effects of the Trp64Arg Polymorphism in the {beta}3-Adrenergic Receptor Gene on Insulin Sensitivity in Small for Gestational Age Neonates. J. Clin. Endocrinol. Metab.
89: 4981-4985
[Abstract][Full Text]
Romieu, I., Lazcano-Ponce, E., Sanchez-Zamorano, L. M., Willett, W., Hernandez-Avila, M.
(2004). Carbohydrates and the Risk of Breast Cancer among Mexican Women. Cancer Epidemiol. Biomarkers Prev.
13: 1283-1289
[Abstract][Full Text]
Kirstein, S. L., Insel, P. A.
(2004). Autonomic Nervous System Pharmacogenomics: A Progress Report. Pharmacol. Rev.
56: 31-52
[Abstract][Full Text]
McCole, S. D., Shuldiner, A. R., Brown, M. D., Moore, G. E., Ferrell, R. E., Wilund, K. R., Huberty, A., Douglass, L. W., Hagberg, J. M.
(2004). {beta}2- and {beta}3-Adrenergic receptor polymorphisms and exercise hemodynamics in postmenopausal women. J. Appl. Physiol.
96: 526-530
[Abstract][Full Text]
Matsushita, Y., Yokoyama, T., Yoshiike, N., Matsumura, Y., Date, C., Kawahara, K., Tanaka, H.
(2003). The Trp64Arg Polymorphism of the {beta}3-Adrenergic Receptor Gene Is Not Associated with Body Weight or Body Mass Index in Japanese: A Longitudinal Analysis. J. Clin. Endocrinol. Metab.
88: 5914-5920
[Abstract][Full Text]
Iwamoto, I., Fujino, T., Douchi, T., Nagata, Y.
(2003). Association of Estrogen Receptor {alpha} and {beta}3-Adrenergic Receptor Polymorphisms With Endometrial Cancer. Obstet Gynecol
102: 506-511
[Abstract][Full Text]
Korc, M.
(2003). Diabetes Mellitus in the Era of Proteomics. Mol. Cell. Proteomics
2: 399-404
[Full Text]
Suzuki, N., Matsunaga, T., Nagasumi, K., Yamamura, T., Shihara, N., Moritani, T., Ue, H., Fukushima, M., Tamon, A., Seino, Y., Tsuda, K., Yasuda, K.
(2003). {alpha}2B-Adrenergic Receptor Deletion Polymorphism Associates with Autonomic Nervous System Activity in Young Healthy Japanese. J. Clin. Endocrinol. Metab.
88: 1184-1187
[Abstract][Full Text]
Tang, W., Stearns, R. A., Miller, R. R., Ngui, J. S., Mathvink, R. J., Weber, A. E., Kwei, G. Y., Strauss, J. R., Keohane, C. A., Doss, G. A., Chiu, S.-H. L., Baillie, T. A.
(2002). Metabolism of a Thiazole Benzenesulfonamide Derivative, a Potent and Selective Agonist of the Human beta 3-Adrenergic Receptor, in Rats: Identification of a Novel Isethionic Acid Conjugate. Drug Metab. Dispos.
30: 778-787
[Abstract][Full Text]
Mentuccia, D., Proietti-Pannunzi, L., Tanner, K., Bacci, V., Pollin, T. I., Poehlman, E. T., Shuldiner, A. R., Celi, F. S.
(2002). Association Between a Novel Variant of the Human Type 2 Deiodinase Gene Thr92Ala and Insulin Resistance: Evidence of Interaction With the Trp64Arg Variant of the {beta}-3-Adrenergic Receptor. Diabetes
51: 880-883
[Abstract][Full Text]
Oizumi, T., Daimon, M., Saitoh, T., Kameda, W., Yamaguchi, H., Ohnuma, H., Igarashi, M., Eguchi, H., Manaka, H., Tominaga, M., Kato, T.
(2001). Genotype Arg/Arg, but not Trp/Arg, of the Trp64Arg Polymorphism of the {beta}3-Adrenergic Receptor Is Associated With Type 2 Diabetes and Obesity in a Large Japanese Sample. Diabetes Care
24: 1579-1583
[Abstract][Full Text]
Guimaraes, S., Moura, D.
(2001). Vascular Adrenoceptors: An Update. Pharmacol. Rev.
53: 319-356
[Abstract][Full Text]
Susulic, V. S., LaVallette, L., Duzic, E., Chen, L., Shuey, D., Karathanasis, S. K., Steiner, K. E.
(2001). Expression of the Human {beta}3-Adrenergic Receptor Gene in SK-N-MC Cells Is Under the Control of a Distal Enhancer. Endocrinology
142: 1935-1949
[Abstract][Full Text]
Yamauchi, T., Kuno, T., Takada, H., Mishima, K., Nagura, Y., Takahashi, S., Kanmatsuse, K.
(2001). The impact of Trp64Arg mutation in the {beta}3-adrenergic receptor gene on haemodialysis patients. Nephrol Dial Transplant
16: 641-642
[Full Text]
Barzilai, N., Shuldiner, A. R.
(2001). Searching for Human Longevity Genes: The Future History of Gerontology in the Post-genomic Era. J. Gerontol. A Biol. Sci. Med. Sci.
56: 83M-87
[Abstract][Full Text]
Sharma, A. M., Pischon, T., Hardt, S., Kunz, I., Luft, F. C.
(2001). Hypothesis: {beta}-Adrenergic Receptor Blockers and Weight Gain : A Systematic Analysis. Hypertension
37: 250-254
[Abstract][Full Text]
Dionne, I. J., Turner, A. N., Tchernof, A., Pollin, T. I., Avrithi, D., Gray, D., Shuldiner, A. R., Poehlman, E. T.
(2001). Identification of an Interactive Effect of {beta}3- and {alpha}2b-Adrenoceptor Gene Polymorphisms on Fat Mass in Caucasian Women. Diabetes
50: 91-95
[Abstract][Full Text]
Walston, J., Silver, K., Hilfiker, H., Andersen, R. E., Seibert, M., Beamer, B., Roth, J., Poehlman, E., Shuldiner, A. R.
(2000). Insulin Response to Glucose Is Lower in Individuals Homozygous for the Arg 64 Variant of the {beta}-3-Adrenergic Receptor. J. Clin. Endocrinol. Metab.
85: 4019-4022
[Abstract][Full Text]
Nadler, S. T., Stoehr, J. P., Schueler, K. L., Tanimoto, G., Yandell, B. S., Attie, A. D.
(2000). The expression of adipogenic genes is decreased in obesity and diabetes mellitus. Proc. Natl. Acad. Sci. USA
97: 11371-11376
[Abstract][Full Text]
Urhammer, S. A., Hansen, T., Borch-Johnsen, K., Pedersen, O.
(2000). Studies of the Synergistic Effect of the Trp/Arg64 Polymorphism of the {beta}3-Adrenergic Receptor Gene and the -3826 A->G Variant of the Uncoupling Protein-1 Gene on Features of Obesity and Insulin Resistance in a Population-Based Sample of 379 Young Danish Subjects. J. Clin. Endocrinol. Metab.
85: 3151-3154
[Abstract][Full Text]
Hasegawa, Y., Fujii, K., Yamada, M., Igarashi, Y., Tachibana, K., Tanaka, T., Onigata, K., Nishi, Y., Kato, S., Hasegawa, T.
(2000). Identification of Novel Human GH-1 Gene Polymorphisms that Are Associated with Growth Hormone Secretion and Height. J. Clin. Endocrinol. Metab.
85: 1290-1295
[Abstract][Full Text]
Brodde, O.-E., Michel, M. C.
(1999). Adrenergic and Muscarinic Receptors in the Human Heart. Pharmacol. Rev.
51: 651-690
[Abstract][Full Text]
Büscher, R., Herrmann, V., Ring, K. M., Kailasam, M. T., O'Connor, D. T., Parmer, R. J., Insel, P. A.
(1999). Variability in Phenylephrine Response and Essential Hypertension: A Search for Human alpha 1B-Adrenergic Receptor Polymorphisms. J. Pharmacol. Exp. Ther.
291: 793-798
[Abstract][Full Text]
Carel, J. C., Le Stunff, C., Condamine, L., Mallet, E., Chaussain, J. L., Adnot, P., Garabédian, M., Bougnères, P.
(1999). Resistance to the Lipolytic Action of Epinephrine: A New Feature of Protein Gs Deficiency. J. Clin. Endocrinol. Metab.
84: 4127-4131
[Abstract][Full Text]
Heinonen, P., Koulu, M., Pesonen, U., Karvonen, M. K., Rissanen, A., Laakso, M., Valve, R., Uusitupa, M., Scheinin, M.
(1999). Identification of a Three-Amino Acid Deletion in the {alpha}2B-Adrenergic Receptor That Is Associated with Reduced Basal Metabolic Rate in Obese Subjects. J. Clin. Endocrinol. Metab.
84: 2429-2433
[Abstract][Full Text]
Bogardus, S. T. Jr, Concato, J., Feinstein, A. R.
(1999). Clinical Epidemiological Quality in Molecular Genetic Research: The Need for Methodological Standards. JAMA
281: 1919-1926
[Abstract][Full Text]
Shihara, N., Yasuda, K., Moritani, T., Ue, H., Adachi, T., Tanaka, H., Tsuda, K., Seino, Y.
(1999). The Association between Trp64Arg Polymorphism of the {beta}3-Adrenergic Receptor and Autonomic Nervous System Activity. J. Clin. Endocrinol. Metab.
84: 1623-1627
[Abstract][Full Text]
Festa, A., Krugluger, W., Shnawa, N., Hopmeier, P., Haffner, S. M., Schernthaner, G.
(1999). Trp64Arg Polymorphism of the {beta}3-Adrenergic Receptor Gene in Pregnancy: Association with Mild Gestational Diabetes Mellitus. J. Clin. Endocrinol. Metab.
84: 1695-1699
[Abstract][Full Text]
Story, M., Evans, M., Fabsitz, R. R, Clay, T. E, Rock, B. H., Broussard, B.
(1999). The epidemic of obesity in American Indian communities and the need for childhood obesity-prevention programs. Am. J. Clin. Nutr.
69
: 747S-754S
[Abstract][Full Text]
Jequier, E., Tappy, L.
(1999). Regulation of Body Weight in Humans. Physiol. Rev.
79: 451-480
[Abstract][Full Text]
Fogelholm, M., Valve, R., Kukkonen-Harjula, K., Nenonen, A., Hakkarainen, V., Laakso, M., Uusitupa, M.
(1998). Additive Effects of the Mutations in the {beta}3-Adrenergic Receptor and Uncoupling Protein-1 Genes on Weight Loss and Weight Maintenance in Finnish Women. J. Clin. Endocrinol. Metab.
83: 4246-4250
[Abstract][Full Text]
GarcÍa-Rubi, E., Starling, R. D., Tchernof, A., Matthews, D. E., Walston, J. D., Shuldiner, A. R., Silver, K., Poehlman, E. T., Calles-Escandón, J.
(1998). Trp64Arg Variant of the {beta}3-Adrenoceptor and Insulin Resistance in Obese Postmenopausal Women. J. Clin. Endocrinol. Metab.
83: 4002-4005
[Abstract][Full Text]
Büettner, R., Schäffler, A., Arndt, H., Rogler, G., Nusser, J., Zietz, B., Enger, I., Hügl, S., Cuk, A., Schölmerich, J., Palitzsch, K.-D.
(1998). The Trp64Arg Polymorphism of the {beta} 3-Adrenergic Receptor Gene Is Not Associated with Obesity or Type 2 Diabetes Mellitus in a Large Population-Based Caucasian Cohort. J. Clin. Endocrinol. Metab.
83: 2892-2897
[Abstract][Full Text]
Fujisawa, T., Ikegami, H., Kawaguchi, Y., Ogihara, T.
(1998). Meta-Analysis of the Association of Trp64Arg Polymorphism of {beta}3-Adrenergic Receptor Gene with Body Mass Index. J. Clin. Endocrinol. Metab.
83: 2441-2444
[Abstract][Full Text]
Silver, K., Walston, J., Plotnick, L., Taylor, S. I., Kahn, C. R., Shuldiner, A. R.
(1997). Molecular Scanning of {beta}-3-Adrenergic Receptor Gene in Total Congenital Lipoatrophic Diabetes Mellitus. J. Clin. Endocrinol. Metab.
82: 3395-3398
[Abstract][Full Text]
Elbein, S. C.
(1997). The Genetics of Human Noninsulin-Dependent (Type 2) Diabetes Mellitus. J. Nutr.
127: 1891-1891
[Abstract][Full Text]
Nagase, T., Aoki, A., Yamamoto, M., Yasuda, H., Kado, S., Nishikawa, M., Kugai, N., Akatsu, T., Nagata, N.
(1997). Lack of Association between the Trp64Arg Mutation in the {beta}3-Adrenergic Receptor Gene and Obesity in Japanese Men: A Longitudinal Analysis. J. Clin. Endocrinol. Metab.
82: 1284-1287
[Abstract][Full Text]
Meyers, D. S., Skwish, S., Dickinson, K. E. J., Kienzle, B., Arbeeny, C. M.
(1997). {beta}3-Adrenergic Receptor-Mediated Lipolysis and Oxygen Consumption in Brown Adipocytes from Cynomolgus Monkeys. J. Clin. Endocrinol. Metab.
82: 395-401
[Abstract][Full Text]
Zilberfarb, V, Pietri-Rouxel, F, Jockers, R, Krief, S, Delouis, C, Issad, T, Strosberg, A.
(1997). Human immortalized brown adipocytes express functional beta3-adrenoceptor coupled to lipolysis. J. Cell Sci.
110: 801-807
[Abstract]
Soloveva, V., Graves, R. A., Rasenick, M. M., Spiegelman, B. M., Ross, S. R.
(1997). Transgenic Mice Overexpressing the {beta}1-Adrenergic Receptor in Adipose Tissue Are Resistant to Obesity. Mol. Endocrinol.
11: 27-38
[Abstract][Full Text]
Jezek, P., Hanus, J., Semrad, C., Garlid, K. D.
(1996). Photoactivated Azido Fatty Acid Irreversibly Inhibits Anion and Proton Transport through the Mitochondrial Uncoupling Protein. J. Biol. Chem.
271: 6199-6205
[Abstract][Full Text]
Insel, P. A.
(1996). Adrenergic Receptors -- Evolving Concepts and Clinical Implications. NEJM
334: 580-585
[Full Text]
Susulic, V. S., Frederich, R. C., Lawitts, J., Tozzo, E., Kahn, B. B., Harper, M.-E., Himms-Hagen, J., Flier, J. S., Lowell, B. B.
(1995). Targeted Disruption of the beta(3)-Adrenergic Receptor Gene. J. Biol. Chem.
270: 29483-29492
[Abstract][Full Text]
Widen, E., Lehto, M., Kanninen, T., Walston, J., Shuldiner, A. R., Groop, L. C.
(1995). Association of a Polymorphism in the {beta}3-Adrenergic-Receptor Gene with Features of the Insulin Resistance Syndrome in Finns. NEJM
333: 348-352
[Abstract][Full Text]
Clement, K., Vaisse, C., Manning, B. St. J., Basdevant, A., Guy-Grand, B., Ruiz, J., Silver, K. D., Shuldiner, A. R., Froguel, P., Strosberg, A. D.
(1995). Genetic Variation in the {beta}3-Adrenergic Receptor and an Increased Capacity to Gain Weight in Patients with Morbid Obesity. NEJM
333: 352-354
[Abstract][Full Text]
Arner, P.
(1995). The {beta}3-Adrenergic Receptor -- A Cause and Cure of Obesity?. NEJM
333: 382-383
[Full Text]
Ranade, K., Chang, M.-S., Ting, C.-T., Pei, D., Hsiao, C.-F., Olivier, M., Pesich, R., Hebert, J., Chen, Y.-D. I., Dzau, V. J., Curb, D., Olshen, R., Risch, N., Cox, D. R., Botstein, D.
(2001). High-Throughput Genotyping with Single Nucleotide Polymorphisms. Genome Res
11: 1262-1268
[Abstract][Full Text]