Background Because visceral obesity predicts insulin resistance,we studied whether alterations in the gene encoding for the3-adrenergic receptor in visceral fat are associated with insulinresistance.
Methods We studied the frequency of a cytosine-to-thymidinemutation that results in the replacement of tryptophan by arginineat position 64 (Trp64Arg) of the 3-adrenergic receptor by restriction-enzymedigestion with BstOI in 335 subjects from western Finland, 207of whom were nondiabetic and 128 of whom had non-insulin-dependentdiabetes mellitus (NIDDM). We also determined the frequencyof the mutation in 156 subjects from southern Finland. Sensitivityto insulin was measured by the hyperinsulinemic–euglycemicclamp technique in 66 randomly selected nondiabetic subjects.
Results In the subjects from western Finland, the frequencyof the mutated allele was similar in the nondiabetic subjectsand the subjects with NIDDM (12 vs. 11 percent). The mean ageof the subjects at the onset of diabetes was lower among thosewith the mutation than those without it (56 vs. 61 years, P= 0.04). Among the nondiabetic subjects, those with the mutationhad a higher ratio of waist to hip circumference (P = 0.02),a greater increase in the serum insulin response after the oraladministration of glucose (P = 0.05), a higher diastolic bloodpressure (82 vs. 78 mm Hg, P = 0.01), and a lower rate of glucosedisposal during the clamp study (5.3 vs. 6.5 mg [29 vs. 36 µmol]per kilogram of body weight per minute; P = 0.04) than the subjectswithout the mutated allele. In an analysis of sibling pairs,the siblings with the mutation generally had higher waist:hipratios (P = 0.05) and higher responses of blood glucose andserum insulin after the oral administration of glucose thantheir siblings without the mutation (P = 0.02 and P = 0.005,respectively).
Conclusions The Trp64Arg allele of the 3-adrenergic receptoris associated with abdominal obesity and resistance to insulinand may contribute to the early onset of NIDDM.
Resistance to insulin in skeletal muscle has often been attributedto concomitant obesity, particularly abdominal obesity,1,2,3,4,5and associated with glucose intolerance, hypertension, and dyslipidemia.6Whether abdominal obesity leads to insulin resistance or thereverse, or whether both conditions are a consequence of a thirdfactor, possibly genetic, is not known. The theory of a geneticbasis is supported by findings of insulin resistance and increasedabdominal obesity in first-degree family members of patientswith non-insulin-dependent diabetes mellitus (NIDDM)7 (and unpublisheddata). There are several putative candidates for this geneticfactor, including the recently cloned ob gene,8 tumor necrosisfactor-,9 and the 3-adrenergic–receptor gene.10
The 3-adrenergic receptor is expressed in visceral fat in humans11and is considered responsible for increases in lipolysis andthe delivery of free fatty acid into the portal vein.12 An increasein visceral fat mass, in turn, correlates with resistance toinsulin in skeletal muscle.13 An abnormality in the 3-adrenergicreceptor could therefore explain the link between abdominalobesity and insulin resistance. To test this hypothesis, westudied nondiabetic subjects and subjects with NIDDM to detectpolymorphism in the gene for the 3-adrenergic receptor, whichis described by Walston et al. in this issue of the Journal,14and related the receptor genotypes to estimates of insulin sensitivityand abdominal obesity.
Methods
Study Subjects
All the subjects were participants in the ongoing Bothnia Studyin western Finland, which began in 1990 with the goal of identifyingearly metabolic defects and genetic alterations in familieswith NIDDM. In this study, 128 subjects with NIDDM (67 womenand 61 men) among whom there were no first-degree relationshipsand 207 similarly unrelated nondiabetic subjects (108 womenand 99 men) were randomly selected from the population of westernFinland. We studied the polymorphism of the 3-adrenergic receptorthat results in the replacement of tryptophan with arginineat position 64 (Trp64Arg) in 17 normoglycemic pairs of siblingsof the same sex, one of each pair being homozygous for the Trp64allele and the other being heterozygous for the mutation, andcompared the effect of the polymorphism on obesity and glucosemetabolism within each pair. The allelic frequencies associatedwith the 3-adrenergic receptor were also determined in a groupof 79 subjects with NIDDM and 77 nondiabetic subjects, all fromsouthern Finland. The study was approved by the local ethicscommittees, and all subjects gave their informed consent.
Metabolic Characterization of the Subjects
Glucose tolerance was assessed by administering 75 g of glucoseorally after an overnight fast. Venous-blood samples were drawn10 minutes before the glucose ingestion, at the time of theingestion, and 30, 60, and 120 minutes thereafter for the determinationof blood glucose and serum insulin concentrations. Fat-freemass was measured by infrared spectroscopy of the outer layerof the biceps on the dominant arm with a Futrex 5000 device(Futrex, Gaithersburg, Md.). The subject's waist was measuredwith a soft tape midway between the lowest rib and the iliaccrest. The hip circumference was measured at the widest partof the gluteal region. Blood pressure was measured in the rightarm after 30 minutes of rest, with the subject seated. A subgroupof subjects randomly selected from the group from western Finlandwere studied by the hyperinsulinemic–euglycemic clamptechnique (in which the insulin concentration was raised by80 µU per milliliter), as described elsewhere.7
Assays
Blood glucose concentrations after oral glucose administrationwere measured by a hexokinase method (Boehringer–Mannheim,Mannheim, Germany). Plasma glucose concentrations during theclamp study were measured by a glucose oxidase method (BeckmanGlucose Analyzer II, Beckman Instruments, Fullerton, Calif.).Serum insulin concentrations were measured by a radioimmunoassay(Pharmacia, Uppsala, Sweden) with an interassay coefficientof variation of 7.5 percent. The increased area under the curvefor the concentrations of glucose and insulin was calculatedby the trapezoidal rule. Serum concentrations of total cholesterol,high-density lipoprotein (HDL) cholesterol (after precipitation),and triglycerides were measured with a Cobas Mira analyzer (Hoffmann–LaRoche,Basel, Switzerland).
Detection of the Trp64Arg Polymorphism
The polymerase chain reaction (PCR) was carried out in a volumeof 15 µl containing 25 ng of genomic DNA from leukocytes;10 pmol each of the primers BSTNUP (5'CGCCCAATACCGCCAACAC) andBSTNDOWN (5'CCACCAGGAGTCCCATCACC); 200 µM each of deoxyadenosinetriphosphate, deoxycytidine triphosphate, deoxyguanosine triphosphate,and deoxythymidine triphosphate, in 1.5 mM magnesium chloride;10 mM TRIS–hydrochloric acid (pH 9.0); 50 mM potassiumchloride; 0.1 percent Triton x-100; 4 percent formamide (pH8.0); and 0.5 unit of Taq polymerase (Promega, Madison, Wis.).The PCR reactions (Perkin-Elmer 9600, Norwalk, Conn.) beganwith denaturation at 94°C for 5 minutes, followed by 35cycles of denaturation at 94°C for 30 seconds, annealingat 61°C for 30 seconds, extension at 72°C for 30 seconds,with a final extension at 72°C for 10 minutes.
The amplified PCR products were digested with the addition of5 µl of a mixture containing 30 mM TRIS–hydrochloricacid (pH 7.9), 30 mM magnesium chloride, 150 mM sodium chloride,and 5 units of BstOI, a restriction enzyme specific for thesequence CC(A/T)GG (Promega); this mixture was incubated at60°C for two hours. The digested samples were separatedby electrophoresis through a 3 percent agarose gel (Multipurposeagarose, Appligene, Illkirch, France) and visualized by stainingwith ethidium bromide.
Statistical Analysis
The results are presented as means ±SD. Differences betweengroup means were tested by Student's t-test, and for variablesthat were not normally distributed, by the Mann–WhitneyU test. The chi-square test was used to compare frequencies.Differences between sibling pairs were tested by the nonparametricWilcoxon's test. Correlations were calculated with Spearman'srank-correlation test.
Results
Frequency of the Trp64Arg Polymorphism among 3-Adrenergic–Receptor Alleles
Digestion of the 210-base-pair (bp) PCR product with BstOI producedfragments of the following sizes: 99, 62, 30, 12, and 7 bp inTrp64 homozygotes; 161, 99, 62, 30, 12, and 7 bp in Trp64/Arg64heterozygotes; and 161, 30, 12, and 7 bp in Arg64 homozygotes(Figure 1). The smallest of these fragments (30, 12, and 7 bp)were too small to be resolved on the gel. There was no differencebetween the diabetic and nondiabetic subjects in the frequencyof the Trp64 and Arg64 alleles (Table 1). Two nondiabetic subjectsfrom western Finland were homozygous for Arg64, as were twodiabetic subjects from southern Finland.
Figure 1. Detection of Trp64Arg Polymorphism of the 3-Adrenergic Receptor by PCR and Analysis of Restriction-Fragment–Length Polymorphism.
The PCR products (210 bp) were digested with the restriction enzyme BstOI and visualized by staining with ethidium bromide. Lane 1 shows a molecular-weight marker (pBr322/Hae III); lane 2, a Trp64 homozygote; lane 3, a Trp64/Arg64 heterozygote; and lane 4, an Arg64 homozygote.
Table 1. Frequency of the Trp64 and Arg64 Alleles among Nondiabetic Subjects and Subjects with NIDDM in Two Areas of Finland.
Association between the Trp64Arg Polymorphism, Sensitivity to Insulin, and Obesity
Nondiabetic subjects with the Arg64 allele generally had higherratios of waist to hip circumference than nondiabetic Trp64homozygotes (P = 0.02), despite similar values for body-massindex (the weight in kilograms divided by the square of theheight in meters) and fat mass (Table 2). This difference wasprimarily due to differences among women. Nondiabetic subjectswith the Arg64 mutation also had higher concentrations of bloodglucose and serum insulin two hours after the oral ingestionof glucose than did the nondiabetic Trp64 homozygotes and hadhigher diastolic blood pressures than the Trp64 homozygotes(P = 0.01). Sensitivity to insulin was assessed in 66 randomlyselected nondiabetic subjects, 16 of whom were heterozygotesand 50 of whom were Trp64 homozygotes. The rate of insulin-stimulatedglucose disposal was 18 percent less in the subjects with theArg64 allele than in the Trp64 homozygotes (mean [±SD],5.3±2.3 vs. 6.5±2.5 mg [29±13 vs. 36±14µmol] per kilogram of body weight per minute; P = 0.04).
Table 2. Clinical Characteristics of Nondiabetic Subjects and Subjects with NIDDM, According to the Presence of the Arg64 Mutation.
The onset of diabetes occurred at an earlier age in the subjectswith NIDDM who had the Arg64 allele than in those who did nothave that allele (P = 0.04). The two groups were similar withrespect to body-mass index, fat mass, and waist:hip ratio (Table 2).
In the analysis of sibling pairs, the heterozygotes tended tobe more obese than the Trp64 homozygotes (mean difference inweight, 6 kg; in body-mass index, 2.3; P = 0.18 and P = 0.20,respectively). The ratio of waist to hip circumference was generallyhigher in the member of each pair who had the Arg64 allele thanin the one who did not (mean difference, 0.04; P = 0.05) (Figure 2).In addition, the areas under the curves for both the bloodglucose and the serum insulin concentrations 120 minutes afterthe ingestion of glucose were larger for the siblings who hadthe Arg64 allele than for those who did not (mean differencefor glucose, 2124 mg per deciliter [118 mmol per liter]; forinsulin, 4071 mU per liter [24,430 pmol per liter]; P = 0.02and P = 0.005, respectively) (Figure 2).
Figure 2. Differences between Siblings in the Ratio of the Waist to the Hip Circumference and in the Area under the Curve for the Serum Insulin Concentration 120 Minutes after the Oral Administration of Glucose.
In each sibling pair, one member of the pair was a Trp64/Arg64 heterozygote, and the other was a Trp64 homozygote. The value in the latter was subtracted from the value in the former to yield the difference. Positive values for the difference (shaded bars) indicate that the sibling with the Arg64 mutation was the more obese (upper panel) or the more resistant to insulin (lower panel). Only pairs for which complete data were available are shown. To convert values for insulin to picomoles per liter, multiply by 6.
Discussion
The nondiabetic subjects with the Arg64 mutation of the genefor the 3-adrenergic receptor had several characteristics ofthe insulin resistance syndrome6 — increased ratio ofwaist to hip circumference, glucose intolerance, hyperinsulinemia,and elevated blood pressure. The presence of insulin resistancewas further established by measuring insulin sensitivity directlyin a subgroup of the subjects. The findings of an increasedratio of waist to hip circumference and a decreased sensitivityto insulin were confirmed by an analysis of sibling pairs.
How could the 3-adrenergic receptor be pathogenically involvedin the development of insulin resistance in muscle? Increaseddeposits of abdominal fat could provide more free fatty acidsfor the synthesis of very-low-density lipoproteins in the liver,which could result in changes in the fatty-acid compositionof skeletal-muscle membranes15 or higher concentrations of triglyceridesin muscle. In rats, the accumulation of triglycerides in muscleis related to the impaired action of insulin.16 In humans, visceralobesity is associated with the enhanced sensitivity of visceralfat to catecholamine-induced lipolysis,12 primarily mediatedthrough effects on the 3-adrenergic receptor. Visceral obesityis also associated with decreased uptake of free fatty acidby muscle and with insulin resistance in skeletal muscle —in particular, impaired synthesis of insulin-stimulated glycogen.13The putative role of the 3-adrenergic receptor in this scenarioremains to be elucidated.
Insulin resistance is a major predictor of NIDDM.17 In the subjectswith NIDDM who had the Arg64 allele, the onset of diabetes wassignificantly earlier than in the subjects who did not havethis allele. These findings are consistent with those in PimaIndians, although diabetes had its onset about 20 years earlierin the Pima Indians than in our subjects.14 In contrast to thenondiabetic subjects, the diabetic subjects were not found todiffer in the ratio of waist to hip circumference accordingto the genotype of the 3-adrenergic receptor. Possibly, potentialdifferences among these patients were masked by their concomitanthyperglycemia and its treatment.
The Arg64 allele could have been expected to be more frequentin subjects with NIDDM than in nondiabetic subjects. This wasnot the case, however, either in this study or in the studyof the Pima Indians.14 If anything, the Arg64 allele was underrepresentedamong the subjects with diabetes, especially the men (risk ratio,0.6; P = 0.23). In the Pima Indians, there was an age-dependentdecrease in the frequency of the Arg64 allele among men.14 Oneexplanation for this finding is that insulin resistance is associatedwith increased mortality from cardiovascular causes in men withNIDDM.
In conclusion, the presence of the Arg64 allele in the firstintracellular loop of the 3-adrenergic–receptor gene maypredispose patients to abdominal obesity, which may in turnpredispose them to insulin resistance and the earlier onsetof NIDDM. Determining the molecular mechanisms by which thischange in amino acids in the 3-adrenergic receptor exerts thisaction should provide important insights into the genetic basisof abdominal obesity and insulin resistance.
Supported by a grant (10858) from the Swedish Medical ResearchCouncil and by the Sigrid Juselius Foundation, the Novo NordiskFoundation, the Crafoord Foundation, the Medical Society ofFinland, the Påhlsson Foundation, and the PerklénFoundation.
We are indebted to the research team of the Bothnia Study fortheir skillful assistance.
Source Information
From the Department of Endocrinology, University of Lund, Lund, Sweden (E.W., M.L., T.K., L.C.G.); the Fourth Department of Medicine, Helsinki University Hospital, Helsinki, Finland (E.W.); and the Division of Geriatric Medicine and Gerontology, Johns Hopkins University School of Medicine, Baltimore (J.W., A.R.S.).
Address reprint requests to Dr. Groop at the Department of Endocrinology, Malmö University Hospital, 205 02 Malmö, Sweden.
References
DeFronzo RA. The triumvirate: -cell, muscle, liver: a collusion responsible for NIDDM. Diabetes 1988;37:667-687. [Medline]
Ferrannini E, Haffner SM, Mitchell BD, Stern MP. Hyperinsulinaemia: the key feature of a cardiovascular and metabolic syndrome. Diabetologia 1991;34:416-422. [CrossRef][Medline]
Caro JF. Insulin resistance in obese and nonobese man. J Clin Endocrinol Metab 1991;73:691-695. [Free Full Text]
Mårin P, Andersson B, Ottosson M, et al. The morphology and metabolism of intraabdominal adipose tissue in men. Metabolism 1992;41:1242-1248. [CrossRef][Medline]
Pouliot M-C, Desprès J-P, Nadeau A, et al. Visceral obesity in men: associations with glucose tolerance, plasma insulin, and lipoprotein levels. Diabetes 1992;41:826-834. [Abstract]
Reaven GM. Role of insulin resistance in human disease. Diabetes 1988;37:1595-1607. [Abstract]
Eriksson J, Franssila-Kallunki A, Ekstrand A, et al. Early metabolic defects in persons at increased risk for non-insulin-dependent diabetes mellitus. N Engl J Med 1989;321:337-343. [Abstract]
Zhang Y, Proenca R, Maffei M, Barone M, Leopold L, Friedman JM. Positional cloning of the mouse obese gene and its human homologue. Nature 1994;372:425-432. [CrossRef][Medline]
Hotamisligil GS, Shargill NS, Spiegelman BM. Adipose expression of tumor necrosis factor-: direct role in obesity-linked insulin resistance. Science 1993;259:87-91. [Free Full Text]
Emorine LJ, Marullo S, Briend-Sutren M-M, et al. Molecular characterization of the human 3-adrenergic receptor. Science 1989;245:1118-1121. [Free Full Text]
Krief S, Lönnqvist F, Raimbault S, et al. Tissue distribution of 3-adrenergic receptor mRNA in man. J Clin Invest 1993;91:344-349.
Lönnqvist F, Thörne A, Nilsell K, Hoffstedt J, Arner P. A pathogenetic role of visceral fat 3-adrenoreceptors in obesity. J Clin Invest 1995;95:1109-1116.
Colberg SR, Simoneau J-A, Thaete FL, Kelley DE. Skeletal muscle utilization of free fatty acids in women with visceral obesity. J Clin Invest 1995;95:1846-1853.
Walston J, Silver K, Bogardus C, et al. Time of onset of non-insulin-dependent diabetes mellitus and genetic variation in the 3-adrenergic-receptor gene. N Engl J Med 1995;333:343-347. [Free Full Text]
Borkman M, Storlien LH, Pan DA, Jenkins AB, Chisholm DJ, Campbell LV. The relationship between insulin sensitivity and the fatty-acid composition of skeletal-muscle phospholipids. N Engl J Med 1993;328:238-244. [Free Full Text]
Storlien LH, Jenkins AB, Chisholm DJ, Pascoe WS, Khouri S, Kraegen EW. Influence of dietary fat composition on development of insulin resistance in rats: relationship to muscle triglyceride and -3 fatty acids in muscle phospholipid. Diabetes 1991;40:280-289. [Abstract]
Martin BC, Warram JH, Krolewski AS, Bergman RN, Soeldner JS, Kahn CR. Role of glucose and insulin resistance in development of type 2 diabetes mellitus: results of a 25-year follow-up study. Lancet 1992;340:925-929. [CrossRef][Medline]
Fallucca, S., Vasta, M., Sciullo, E., Balducci, S., Fallucca, F.
(2009). Birth Weight: Genetic and Intrauterine Environment in Normal Pregnancy. Diabetes Care
32: e149-e149
[Full Text]
Kotani, K., Sakane, N., Gugliucci, A.
(2009). The association between Trp64Arg polymorphisms of beta3-adrenergic receptor gene and systemic disorders: a possibility of prevention. Ann Clin Biochem
46: 83-84
[Full Text]
Pierola, J., Barcelo, A., de la Pena, M., Barbe, F., Soriano, J. B., Sanchez Armengol, A., Martinez, C., Agusti, A.
(2007). {beta}3-Adrenergic receptor Trp64Arg polymorphism and increased body mass index in sleep apnoea. Eur Respir J
30: 743-747
[Abstract][Full Text]
Rouget, C., Barthez, O., Goirand, F., Leroy, M.J., Breuiller-Fouche, M., Rakotoniaina, Z., Guerard, P., Morcillo, E.J., Advenier, C., Sagot, P., Cabrol, D., Dumas, M., Bardou, M.
(2006). Stimulation of the ADRB3 Adrenergic Receptor Induces Relaxation of Human Placental Arteries: Influence of Preeclampsia. Biol. Reprod.
74: 209-216
[Abstract][Full Text]
Escobar-Morreale, H. F., Luque-Ramirez, M., San Millan, J. L.
(2005). The Molecular-Genetic Basis of Functional Hyperandrogenism and the Polycystic Ovary Syndrome. Endocr. Rev.
26: 251-282
[Abstract][Full Text]
Wang, X., Cui, Y., Tong, X., Ye, H., Li, S.
(2004). Effects of the Trp64Arg Polymorphism in the {beta}3-Adrenergic Receptor Gene on Insulin Sensitivity in Small for Gestational Age Neonates. J. Clin. Endocrinol. Metab.
89: 4981-4985
[Abstract][Full Text]
McCole, S. D., Shuldiner, A. R., Brown, M. D., Moore, G. E., Ferrell, R. E., Wilund, K. R., Huberty, A., Douglass, L. W., Hagberg, J. M.
(2004). {beta}2- and {beta}3-Adrenergic receptor polymorphisms and exercise hemodynamics in postmenopausal women. J. Appl. Physiol.
96: 526-530
[Abstract][Full Text]
Vieira-Filho, J. P. B., Reis, A. F., Kasamatsu, T. S., Tavares, E. F., Franco, L. J., Matioli, S. R., Moises, R. S.
(2004). Influence of the Polymorphisms Tpr64Arg in the {beta}3-Adrenergic Receptor Gene and Pro12Ala in the PPAR{gamma}2 Gene on Metabolic Syndrome-Related Phenotypes in an Indigenous Population of the Brazilian Amazon. Diabetes Care
27: 621-622
[Full Text]
Matsushita, Y., Yokoyama, T., Yoshiike, N., Matsumura, Y., Date, C., Kawahara, K., Tanaka, H.
(2003). The Trp64Arg Polymorphism of the {beta}3-Adrenergic Receptor Gene Is Not Associated with Body Weight or Body Mass Index in Japanese: A Longitudinal Analysis. J. Clin. Endocrinol. Metab.
88: 5914-5920
[Abstract][Full Text]
Suzuki, N., Matsunaga, T., Nagasumi, K., Yamamura, T., Shihara, N., Moritani, T., Ue, H., Fukushima, M., Tamon, A., Seino, Y., Tsuda, K., Yasuda, K.
(2003). {alpha}2B-Adrenergic Receptor Deletion Polymorphism Associates with Autonomic Nervous System Activity in Young Healthy Japanese. J. Clin. Endocrinol. Metab.
88: 1184-1187
[Abstract][Full Text]
Sakaue, M., Fuke, Y., Katsuyama, T., Kawabata, M., Taniguchi, H.
(2003). Austronesian-Speaking People in Papua New Guinea have Susceptibility to Obesity and Type 2 Diabetes. Diabetes Care
26: 955-956
[Full Text]
Ridderstrale, M., Carlsson, E., Klannemark, M., Cederberg, A., Kosters, C., Tornqvist, H., Storgaard, H., Vaag, A., Enerback, S., Groop, L.
(2002). FOXC2 mRNA Expression and a 5' Untranslated Region Polymorphism of the Gene Are Associated With Insulin Resistance. Diabetes
51: 3554-3560
[Abstract][Full Text]
Bloomgarden, Z. T.
(2002). Obesity, Hypertension, and Insulin Resistance. Diabetes Care
25: 2088-2097
[Full Text]
Elbein, S. C.
(2002). Perspective: The Search for Genes for Type 2 Diabetes in the Post-Genome Era. Endocrinology
143: 2012-2018
[Abstract][Full Text]
Mentuccia, D., Proietti-Pannunzi, L., Tanner, K., Bacci, V., Pollin, T. I., Poehlman, E. T., Shuldiner, A. R., Celi, F. S.
(2002). Association Between a Novel Variant of the Human Type 2 Deiodinase Gene Thr92Ala and Insulin Resistance: Evidence of Interaction With the Trp64Arg Variant of the {beta}-3-Adrenergic Receptor. Diabetes
51: 880-883
[Abstract][Full Text]
Froguel, P., Boutin, P.
(2001). Genetics of Pathways Regulating Body Weight in the Development of Obesity in Humans. Exp. Biol. Med.
226: 991-996
[Abstract][Full Text]
Lindgren, C. M., Nilsson, A., Orho-Melander, M., Almgren, P., Groop, L. C.
(2001). Characterization of the Annexin I Gene and Evaluation of Its Role in Type 2 Diabetes. Diabetes
50: 2402-2405
[Abstract][Full Text]
Oizumi, T., Daimon, M., Saitoh, T., Kameda, W., Yamaguchi, H., Ohnuma, H., Igarashi, M., Eguchi, H., Manaka, H., Tominaga, M., Kato, T.
(2001). Genotype Arg/Arg, but not Trp/Arg, of the Trp64Arg Polymorphism of the {beta}3-Adrenergic Receptor Is Associated With Type 2 Diabetes and Obesity in a Large Japanese Sample. Diabetes Care
24: 1579-1583
[Abstract][Full Text]
Guimaraes, S., Moura, D.
(2001). Vascular Adrenoceptors: An Update. Pharmacol. Rev.
53: 319-356
[Abstract][Full Text]
Susulic, V. S., LaVallette, L., Duzic, E., Chen, L., Shuey, D., Karathanasis, S. K., Steiner, K. E.
(2001). Expression of the Human {beta}3-Adrenergic Receptor Gene in SK-N-MC Cells Is Under the Control of a Distal Enhancer. Endocrinology
142: 1935-1949
[Abstract][Full Text]
Yamauchi, T., Kuno, T., Takada, H., Mishima, K., Nagura, Y., Takahashi, S., Kanmatsuse, K.
(2001). The impact of Trp64Arg mutation in the {beta}3-adrenergic receptor gene on haemodialysis patients. Nephrol Dial Transplant
16: 641-642
[Full Text]
Barzilai, N., Shuldiner, A. R.
(2001). Searching for Human Longevity Genes: The Future History of Gerontology in the Post-genomic Era. Journals of Gerontology Series A: Biological Sciences and Medical Sciences
56: 83M-87
[Abstract][Full Text]
Dionne, I. J., Turner, A. N., Tchernof, A., Pollin, T. I., Avrithi, D., Gray, D., Shuldiner, A. R., Poehlman, E. T.
(2001). Identification of an Interactive Effect of {beta}3- and {alpha}2b-Adrenoceptor Gene Polymorphisms on Fat Mass in Caucasian Women. Diabetes
50: 91-95
[Abstract][Full Text]
Wajchenberg, B. L.
(2000). Subcutaneous and Visceral Adipose Tissue: Their Relation to the Metabolic Syndrome. Endocr. Rev.
21: 697-738
[Abstract][Full Text]
Walston, J., Silver, K., Hilfiker, H., Andersen, R. E., Seibert, M., Beamer, B., Roth, J., Poehlman, E., Shuldiner, A. R.
(2000). Insulin Response to Glucose Is Lower in Individuals Homozygous for the Arg 64 Variant of the {beta}-3-Adrenergic Receptor. J. Clin. Endocrinol. Metab.
85: 4019-4022
[Abstract][Full Text]
Urhammer, S. A., Hansen, T., Borch-Johnsen, K., Pedersen, O.
(2000). Studies of the Synergistic Effect of the Trp/Arg64 Polymorphism of the {beta}3-Adrenergic Receptor Gene and the -3826 A->G Variant of the Uncoupling Protein-1 Gene on Features of Obesity and Insulin Resistance in a Population-Based Sample of 379 Young Danish Subjects. J. Clin. Endocrinol. Metab.
85: 3151-3154
[Abstract][Full Text]
Devlin, M. J., Yanovski, S. Z., Wilson, G. T.
(2000). Obesity: What Mental Health Professionals Need to Know. Am. J. Psychiatry
157: 854-866
[Abstract][Full Text]
Hasegawa, Y., Fujii, K., Yamada, M., Igarashi, Y., Tachibana, K., Tanaka, T., Onigata, K., Nishi, Y., Kato, S., Hasegawa, T.
(2000). Identification of Novel Human GH-1 Gene Polymorphisms that Are Associated with Growth Hormone Secretion and Height. J. Clin. Endocrinol. Metab.
85: 1290-1295
[Abstract][Full Text]
Brodde, O.-E., Michel, M. C.
(1999). Adrenergic and Muscarinic Receptors in the Human Heart. Pharmacol. Rev.
51: 651-690
[Abstract][Full Text]
Carel, J. C., Le Stunff, C., Condamine, L., Mallet, E., Chaussain, J. L., Adnot, P., Garabédian, M., Bougnères, P.
(1999). Resistance to the Lipolytic Action of Epinephrine: A New Feature of Protein Gs Deficiency. J. Clin. Endocrinol. Metab.
84: 4127-4131
[Abstract][Full Text]
Bogardus, S. T. Jr, Concato, J., Feinstein, A. R.
(1999). Clinical Epidemiological Quality in Molecular Genetic Research: The Need for Methodological Standards. JAMA
281: 1919-1926
[Abstract][Full Text]
Shihara, N., Yasuda, K., Moritani, T., Ue, H., Adachi, T., Tanaka, H., Tsuda, K., Seino, Y.
(1999). The Association between Trp64Arg Polymorphism of the {beta}3-Adrenergic Receptor and Autonomic Nervous System Activity. J. Clin. Endocrinol. Metab.
84: 1623-1627
[Abstract][Full Text]
Festa, A., Krugluger, W., Shnawa, N., Hopmeier, P., Haffner, S. M., Schernthaner, G.
(1999). Trp64Arg Polymorphism of the {beta}3-Adrenergic Receptor Gene in Pregnancy: Association with Mild Gestational Diabetes Mellitus. J. Clin. Endocrinol. Metab.
84: 1695-1699
[Abstract][Full Text]
Jequier, E., Tappy, L.
(1999). Regulation of Body Weight in Humans. Physiol. Rev.
79: 451-480
[Abstract][Full Text]
Fogelholm, M., Valve, R., Kukkonen-Harjula, K., Nenonen, A., Hakkarainen, V., Laakso, M., Uusitupa, M.
(1998). Additive Effects of the Mutations in the {beta}3-Adrenergic Receptor and Uncoupling Protein-1 Genes on Weight Loss and Weight Maintenance in Finnish Women. J. Clin. Endocrinol. Metab.
83: 4246-4250
[Abstract][Full Text]
GarcÍa-Rubi, E., Starling, R. D., Tchernof, A., Matthews, D. E., Walston, J. D., Shuldiner, A. R., Silver, K., Poehlman, E. T., Calles-Escandón, J.
(1998). Trp64Arg Variant of the {beta}3-Adrenoceptor and Insulin Resistance in Obese Postmenopausal Women. J. Clin. Endocrinol. Metab.
83: 4002-4005
[Abstract][Full Text]
Büettner, R., Schäffler, A., Arndt, H., Rogler, G., Nusser, J., Zietz, B., Enger, I., Hügl, S., Cuk, A., Schölmerich, J., Palitzsch, K.-D.
(1998). The Trp64Arg Polymorphism of the {beta} 3-Adrenergic Receptor Gene Is Not Associated with Obesity or Type 2 Diabetes Mellitus in a Large Population-Based Caucasian Cohort. J. Clin. Endocrinol. Metab.
83: 2892-2897
[Abstract][Full Text]
Fujisawa, T., Ikegami, H., Kawaguchi, Y., Ogihara, T.
(1998). Meta-Analysis of the Association of Trp64Arg Polymorphism of {beta}3-Adrenergic Receptor Gene with Body Mass Index. J. Clin. Endocrinol. Metab.
83: 2441-2444
[Abstract][Full Text]
Toft, I., Bonaa, K. H., Jenssen, T.
(1998). Insulin Resistance in Hypertension Is Associated With Body Fat Rather Than Blood Pressure. Hypertension
32: 115-122
[Abstract][Full Text]
Sun, L., Ishibashi, S., Osuga, J.-i., Harada, K., Ohashi, K., Gotoda, T., Fukuo, Y., Yazaki, Y., Yamada, N.
(1998). Clinical Features Associated With the Homozygous Trp64Arg Mutation of the ß3-Adrenergic Receptor : No Evidence for Its Association With Obesity in Japanese. Arterioscler. Thromb. Vasc. Bio.
18: 941-946
[Abstract][Full Text]
Esterbauer, H., Oberkofler, H., Liu, Y.-M., Breban, D., Hell, E., Krempler, F., Patsch, W.
(1998). Uncoupling protein-1 mRNA expression in obese human subjects: the role of sequence variations at the uncoupling protein-1 gene locus. J. Lipid Res.
39: 834-844
[Abstract][Full Text]
Rosenbaum, M., Leibel, R. L.
(1998). The Physiology of Body Weight Regulation: Relevance to the Etiology of Obesity in Children. Pediatrics
101: 525-539
[Abstract][Full Text]
Elbein, S. C.
(1997). The Genetics of Human Noninsulin-Dependent (Type 2) Diabetes Mellitus. J. Nutr.
127: 1891-1891
[Abstract][Full Text]
Nagase, T., Aoki, A., Yamamoto, M., Yasuda, H., Kado, S., Nishikawa, M., Kugai, N., Akatsu, T., Nagata, N.
(1997). Lack of Association between the Trp64Arg Mutation in the {beta}3-Adrenergic Receptor Gene and Obesity in Japanese Men: A Longitudinal Analysis. J. Clin. Endocrinol. Metab.
82: 1284-1287
[Abstract][Full Text]
Kennedy, A., Gettys, T. W., Watson, P., Wallace, P., Ganaway, E., Pan, Q., Garvey, W. T.
(1997). The Metabolic Significance of Leptin in Humans: Gender-Based Differences in Relationship to Adiposity, Insulin Sensitivity, and Energy Expenditure. J. Clin. Endocrinol. Metab.
82: 1293-1300
[Abstract][Full Text]
Zilberfarb, V, Pietri-Rouxel, F, Jockers, R, Krief, S, Delouis, C, Issad, T, Strosberg, A.
(1997). Human immortalized brown adipocytes express functional beta3-adrenoceptor coupled to lipolysis. J. Cell Sci.
110: 801-807
[Abstract]
Soloveva, V., Graves, R. A., Rasenick, M. M., Spiegelman, B. M., Ross, S. R.
(1997). Transgenic Mice Overexpressing the {beta}1-Adrenergic Receptor in Adipose Tissue Are Resistant to Obesity. Mol. Endocrinol.
11: 27-38
[Abstract][Full Text]
Insel, P. A.
(1996). Adrenergic Receptors -- Evolving Concepts and Clinical Implications. NEJM
334: 580-585
[Full Text]
Susulic, V. S., Frederich, R. C., Lawitts, J., Tozzo, E., Kahn, B. B., Harper, M.-E., Himms-Hagen, J., Flier, J. S., Lowell, B. B.
(1995). Targeted Disruption of the beta(3)-Adrenergic Receptor Gene. J. Biol. Chem.
270: 29483-29492
[Abstract][Full Text]
Walston, J., Silver, K., Bogardus, C., Knowler, W. C., Celi, F. S., Austin, S., Manning, B., Strosberg, A. D., Stern, M. P., Raben, N., Sorkin, J. D., Roth, J., Shuldiner, A. R.
(1995). Time of Onset of Non-Insulin-Dependent Diabetes Mellitus and Genetic Variation in the {beta}3-Adrenergic-Receptor Gene. NEJM
333: 343-347
[Abstract][Full Text]
Arner, P.
(1995). The {beta}3-Adrenergic Receptor -- A Cause and Cure of Obesity?. NEJM
333: 382-383
[Full Text]
3-adrenergic receptor in visceral fat are associated with insulin resistance. 
,9 and the 
-3 fatty acids in muscle phospholipid. Diabetes 1991;40:280-289. [Abstract]
Previous
