Mutations in the Gene for the Granulocyte Colony-StimulatingFactor Receptor in Patients with Acute Myeloid Leukemia Preceded by Severe Congenital Neutropenia
Fan Dong, M.D., Ph.D., Russell K. Brynes, M.D., Nicola Tidow, Ph.D., Karl Welte, M.D., Ph.D., Bob Löwenberg, M.D., Ph.D., and Ivo P. Touw, Ph.D.
Background In severe congenital neutropenia the maturation ofmyeloid progenitor cells is arrested. The myelodysplastic syndromeand acute myeloid leukemia develop in some patients with severecongenital neutropenia. Abnormalities in the signal-transductionpathways for granulocyte colony-stimulating factor (G-CSF) mayplay a part in the progression to acute myeloid leukemia.
Methods We isolated genomic DNA and RNA from hematopoietic cellsobtained from two patients with acute myeloid leukemia and historiesof severe congenital neutropenia. The nucleotide sequences encodingthe cytoplasmic domain of the G-CSF receptor were amplifiedby means of the polymerase chain reaction and sequenced. Murinemyeloid 32D.C10 cells were transfected with complementary DNAencoding the wild-type or mutant G-CSF receptors and testedfor their responses to G-CSF.
Results Point mutations in the gene for the G-CSF receptor wereidentified in both patients. The mutations, a substitution ofthymine for cytosine at the codon for glutamine at position718 (Gln718) in one patient and at the codon for glutamine atposition 731 (Gln731) in the other, caused a truncation of theC-terminal cytoplasmic region of the receptor. Both mutant andwild-type genes for the G-CSF receptor were present in leukemiccells from the two patients. In one patient, the mutation wasalso found in the neutropenic stage, before the progressionto acute myeloid leukemia. The 32D.C10 cells expressing mutantreceptors had abnormally high proliferative responses but failedto mature when cultured in G-CSF. The mutant G-CSF receptorsalso interfered with terminal maturation mediated by the wild-typeG-CSF receptor in the 32D.C10 cells that coexpressed the wild-typeand mutant receptors.
Conclusions Mutations in the gene for the G-CSF receptor thatinterrupt signals required for the maturation of myeloid cellsare involved in the pathogenesis of severe congenital neutropeniaand associated with the progression to acute myeloid leukemia.
Severe congenital neutropenia (Kostmann's syndrome) comprisesa heterogeneous group of disorders with variable inheritancewhose main features are recurrent bacterial infections and severeneutropenia (fewer than 200 neutrophils per cubic millimeter).The bone marrow almost invariably shows an arrest of granulocyticmaturation at the promyelocytic or myelocytic stage.1,2,3,4,5,6Patients with severe congenital neutropenia have an increasedsusceptibility to acute myeloid leukemia.7,8,9,10
An abnormal response of granulocytic progenitor cells to granulocytecolony-stimulating factor (G-CSF) may play a part in the pathogenesisof severe congenital neutropenia. The in vitro response to G-CSFof myeloid progenitor cells from patients with this disorderis often reduced.11,12 Pharmacologic doses of G-CSF increasethe neutrophil count in the majority of patients with severecongenital neutropenia.12,13,14
The G-CSF receptor, a single polypeptide containing 813 aminoacids,15,16 transduces signals that regulate the proliferation,maturation, and survival of myeloid progenitor cells.17 Thecytoplasmic region proximal to the membrane of the receptortransduces proliferative and survival signals, whereas the distalC-terminal region transduces maturation signals and suppressesthe receptor's proliferative signals.18,19,20
A truncated G-CSF receptor, lacking the C-terminal maturationdomain as a consequence of a point mutation, has recently beenreported in a patient with severe congenital neutropenia.21We report here on point mutations in the gene for the G-CSFreceptor in two patients with acute myeloid leukemia and historiesof severe congenital neutropenia. These mutations also truncatethe C-terminal cytoplasmic region of the G-CSF receptor. Themutation in one of the patients was already present in the neutropenicphase that preceded the development of acute myeloid leukemia.Our results suggest that the development of acute myeloid leukemiain patients with severe congenital neutropenia may involve adisruption of the maturation-signaling function of the G-CSFreceptor.
Case Reports
Patient 1
The clinical and laboratory features of Patient 1 have beendescribed previously.9 In brief, severe congenital neutropeniawas diagnosed in this boy when he was two years and nine monthsold. There was no family history of an increased susceptibilityto infection. When the boy was 12 years old, when the infectionsbecame more frequent and severe, G-CSF therapy was initiated;the absolute neutrophil count increased to 6000 per cubic millimeter.Eight months later, while the patient was receiving G-CSF therapy,peripheral-blood tests revealed approximately 30 percent blasts.Bone marrow studies consistently showed a predominance of myeloblasts.Analysis revealed a karyotype of 49,XY,+3,+der(5),t(1;5)(q21;q21),+22.The patient died seven months later.
Patient 2
Severe congenital neutropenia was diagnosed in Patient 2 duringthe first year of life, when he had severe mastoiditis. Therewas no family history of hematologic disorders or an increasedfrequency of infections. During the first 20 years of his life,he had frequent episodes of pneumonitis, otitis, tonsillitis,and severe gingivitis. At the age of 20 years, he was enrolledin a phase 12 study of G-CSF (Filgrastim) in Hannover,Germany. At that time, bone marrow studies revealed an arrestof myelopoiesis at the promyelocytic or myelocytic stage, withan absence of bands and segmented neutrophils. There were nosigns of myelodysplasia, and the cellularity of the bone marrowwas normal. Treatment with G-CSF (3 µg per kilogram ofbody weight per day) increased the neutrophil count to a levelabove 2000 per cubic millimeter within two weeks. During thenext two years, the neutrophil count was maintained at thislevel with the same dose of G-CSF, and the patient had no severeinfections.
Two years after the start of G-CSF treatment, a routine bonemarrow examination demonstrated monosomy 7 in the myeloid lineage,but there was no sign of dysplasia or leukemia. G-CSF treatmentwas immediately discontinued, but it was restarted two monthslater, at the patient's request, because of severe stomatitis.Eleven months later, the myelodysplastic syndrome (the subtypecharacterized by refractory anemia and an excess of blasts)and thrombocytopenia developed. After an additional eight months,the patient presented with acute myeloid leukemia (subtype M1according to the FrenchAmericanBritish classification)and subsequently died.
Methods
Polymerase-Chain-Reaction Amplification
Genomic DNA was isolated from different cellular sources, asdescribed elsewhere.22 Total RNA was isolated from leukemiccells from Patient 2 by the method of Chomczynski and Sacchi.23RNA was reverse-transcribed into complementary DNA (cDNA) withthe use of the reverse transcriptase of Moloney murine leukemiavirus (GIBCO-BRL, Breda, the Netherlands). Amplification withthe polymerase chain reaction (PCR) was performed as previouslydescribed.21 The following primers were used: FW2, 5'tgtgatcatcgtgactccctt3'(forward); FW3, 5'ctgctgttgttaacctgcctc3' (forward); FW4, 5'ccaagagcagtttccacccaggcc3'(forward); FWI16, 5'accctttgtgttccaccaGT3' (forward); RV1, 5'caagatctagtttacaatactgaag3'(reverse); RV2, 5'gtagatcttagtcatgggcttatgg3' (reverse); andRV3, 5'tctcaggggagatagtgccc3' (reverse). The underlined nucleotidesindicate the introduced mismatches.
Nucleotide Sequencing
After electrophoresis on agarose gels, PCR fragments were purifiedwith the Geneclean II kit (Bio 101, La Jolla, Calif.) and sequenceddirectly or after subcloning in the pBluescript vector (Stratagene,La Jolla, Calif.), with the use of the T7 Sequencing Kit (PharmaciaP-L Biochemicals, Milwaukee).
Expression Vectors for G-CSF Receptor
A cDNA encoding a truncated G-CSF receptor (mutant DA18) wascloned at the EcoRI restriction site of the pBabe-puro retroviralexpression vector that contains a puromycin-resistance gene,24giving rise to the pBabe-DA construct. To constitute the full-lengthcDNA encoding the truncated G-CSF receptors in the two patients,PCR fragments obtained from Patients 1 and 2 with primer setsFWI16RV1 and FW2RV1, respectively, were insertedinto the HincII restriction site of the pBluescript vector andthen cleaved with Cfr10I and XhoI. The resulting Cfr10I andXhoI fragments were used to replace the Cfr10ISalI fragmentof the pBabe-DA construct, thus creating the pBabe-1 and pBabe-2expression vectors for Patients 1 and 2, respectively. The pLNCXexpression vector containing the wild-type G-CSF receptor cDNA(pLNCX-WT) has been described previously.18
Cell-Line and Gene Transfection
A subline of the murine myeloid cell line 32D,25 called 32D.C10,was fully dependent on murine interleukin-3 for proliferationand was unresponsive to G-CSF.18 The 32D.C10 cells were maintainedin RPMI medium supplemented with 10 percent fetal-calf serumand 10 ng of interleukin-3 per milliliter. The expression constructspBabe-1, pBabe-2, and pLNCX-WT were linearized with PvuI andintroduced into the 32D.C10 cells by electroporation. After48 hours of incubation, cells were selected with puromycin (1µg per milliliter) or G418 (0.8 mg per milliliter) insemisolid culture medium containing 0.9 percent methylcellulose.Single colonies were subsequently expanded in liquid culturefor further analyses.
Antibodies to the G-CSF Receptor
Antiserum was raised by immunizing rabbits with a fusion proteinconsisting of a 6-histidineresidue tag and G-CSF receptorcontaining the extracellular domain of the receptor from aminoacid 17 to amino acid 345. A corresponding BamHI fragment ofthe G-CSF receptor cDNA was inserted into the BamHI restrictionsite of the bacteria expressing vector pQE-10 (Qiagen, Düsseldorf,Germany). A purified immunoglobulin fraction was obtained byprotein A Sepharose affinity chromatography.
Western Blotting and Assays of Cell Proliferation
Cell lysates were prepared as described elsewhere26 and analyzedby a standard method of Western blotting. Tritium-labeledthymidineuptake and long-term cell proliferation in response to G-CSFwere measured as described elsewhere.18
Morphologic and Cytochemical Analyses
Cells were spun onto glass slides, and the morphologic featureswere examined after MayGrünwaldGiemsa staining.Myeloperoxidase staining was performed as described elsewhere.27In each case, at least 400 cells were examined for staining.
Results
Mutations in the Gene for the G-CSF Receptor
The entire exon 17,28 which encodes the 156 amino acids of theC-terminal cytoplasmic region, and part of intron 16 of theG-CSFreceptor gene were amplified by PCR from genomicDNA isolated from bone marrow cells obtained from Patient 1with primers FWI16 and RV1. The PCR product was subcloned, anda pool of 18 clones was sequenced. This sequence contained acytosine-to-thymine (C-to-T) transition at nucleotide 2390 ofthe G-CSF receptor cDNA15 (Figure 1A). Direct sequencing ofPCR products confirmed the presence of the point mutation (datanot shown). This mutation changes the CAA codon for glutamineat position 718 (Gln718) to the TAA stop codon, thus truncatinga C-terminal region of 96 amino acids, including the conservedbox-3 segment of the receptor's cytoplasmic domain30 (Figure 1B).
Figure 1. Mutations in the Gene for the G-CSF Receptor in Patients 1 and 2.
Panel A shows the sequences flanking the point mutations and the wild-type sequence. The numbers indicate the nucleotide positions (upper numbers) and amino acid positions (lower numbers). The point mutations are underlined. Panel B shows the structures of the wild-type and truncated G-CSF receptors. Boxes 1, 2, and 3 represent cytoplasmic subdomains conserved in several members of the hematopoietin-receptor superfamily.29 The horizontal lines in the cytoplasmic domains for Patients 1 and 2 indicate the C-terminal regions that have been deleted because of the point mutations. The numbers denote amino acid positions.
Enzyme-restriction analysis was used to confirm the sequencingdata and to examine the ratio of mutant-to-normal genes forthe G-CSF receptor in bone marrow cells from Patient 1. A singlemismatch was introduced in primer FW4; it created a StuI restrictionsite in the PCR product if the point mutation was present inthe DNA (Figure 2A). Analysis of eight individual clones showedthat five contained the mutation (Figure 2B). StuI digestionof the PCR product obtained from DNA of bone marrow cells collectedat various times during the course of leukemia showed that themutated gene made up a minor proportion of the DNA. The mutationwas not detected in the liver or the spleen by StuI digestionand nucleotide sequencing (data not shown). These results indicatethat the mutation did not occur in the germ line.
Figure 2.Stu I Restriction-Enzyme Analysis of the PCR Product.
In Panel A, the point mutation in the template DNA (in the antisense orientation) is boxed. A mismatch (underlined) introduced in the forward primer, together with the point mutation in the template DNA, creates a Stu I restriction site in the PCR product. The arrows indicate the direction of the primers. Panel B shows Stu I digestion of individual clones of the PCR product obtained from leukemic cells from Patient 1. The nondigested product (116 base pairs [bp]) was derived from normal G-CSFreceptor sequences; the digested product (94 bp and 22 bp) was derived from the mutated allele. PCR products were separated on a 3 percent NuSieve agarose gel. M denotes the molecular-size markers.
Only RNA samples were available from leukemic cells in peripheralblood obtained from Patient 2. Reverse-transcriptase PCR withprimers FW2 and RV1 was used to amplify the entire transmembraneand cytoplasmic domains, as well as part of the extracellulardomain, of the G-CSFreceptor cDNA. After subcloning ofthe PCR product, nucleotide sequencing was performed with apool of 16 clones. A C-to-T point mutation was identified atnucleotide 2429 (Figure 1A). This mutation, which changes theCAG codon for glutamine at position 731 (Gln731) to the TAGstop codon, deleted the 83 C-terminal amino acids of the G-CSFreceptor (Figure 1B). The mutation destroys a PvuII restrictionsite in the G-CSF receptor cDNA. PvuII digestion of PCR productsobtained with primers FW3 and RV2 revealed transcripts of boththe normal and mutated G-CSF receptor alleles (Figure 3A andFigure 3B). To determine whether the point mutation was presentbefore acute myeloid leukemia developed in Patient 2, DNA wasisolated from a bone marrow smear prepared when the patientwas in the neutropenic phase, before the acquisition of monosomy7. A minor proportion of the DNA contained the mutation (Figure 3Aand Figure 3B), indicating that it had arisen from a somaticevent.
Figure 3.Pvu II Restriction-Enzyme Analysis of PCR Products.
Panel A shows the PCR products amplified from cDNA (top) and genomic DNA (bottom). The relative positions of the Pvu II restriction sites and the expected sizes of the DNA fragments (in base pairs) after Pvu II digestion are indicated. The PCR primers are also indicated. The open boxes denote the sequences derived from cDNA and exon 17; the sequence derived from intron 16 is shown as a bold line. The arrows indicate the direction of the primers. P denotes the PvuII restriction site, and an asterisk indicates that the site was eliminated by the point mutation.
Panel B shows the detection of the point mutation by PvuII digestion of PCR products. Amplification was performed on genomic DNA prepared from bone marrow cells obtained from healthy persons (lanes 1 and 2) and from Patient 2 during the neutropenic phase (lane 3), as well as on RNA isolated from normal granulocytes in peripheral blood (lanes 4 and 5) and leukemic cells from Patient 2 (lane 6). PCR products were separated on a 2 percent NuSieve agarose gel. The 553-bp fragment (arrow) derived from the mutant G-CSF receptor is present in lane 3 (the neutropenic phase) and in lane 6 (the leukemic phase) but not in the lanes containing products from normal marrow. Partial digestion does not account for the results, since there was complete digestion of the other PvuII sites in the PCR products. M denotes the molecular-size markers.
Transduction of Proliferative and Maturation Signals by Wild-Type and Mutant G-CSF Receptors
The function of the mutant G-CSF receptors from the two patientswas tested in murine myeloid 32D.C10 cells that were transfectedwith cDNA encoding the wild-type or mutated G-CSF receptors.The expression of the G-CSFreceptor proteins in the transfected32D.C10 cells was examined by Western blot analysis. The wild-typeG-CSFreceptor protein had an apparent molecular weightof 140,000 to 150,000, whereas the mutant proteins from Patients1 and 2 had a molecular weight of 115,000 to 135,000 and 120,000to 140,000, respectively (data not shown). These variationsin molecular weight were probably due to differences in proteinglycosylation.15
The capacities of the G-CSF receptors to transduce proliferativesignals were analyzed in assays with tritium-labeled thymidine.The 32D.C10 cells expressing the wild-type receptor (32D.WT)had a dose-dependent response to G-CSF and proliferated mostefficiently at the level of 3 ng of G-CSF per milliliter, whichis about 75 percent of the response to interleukin-3 (Figure 4A).The 32D.C10 cells that expressed the mutant receptors fromPatient 1 (32D.1) or Patient 2 (32D.2) had a considerably increasedsensitivity to G-CSF, requiring concentrations of the factorthat were approximately 10 times lower than the concentrationsrequired by the 32D.WT cells for maximal proliferation. Unlikethe cells transfected with the wild-type cDNA, the 32D.1 and32D.2 cells had maximal responses to G-CSF that were similarto the responses to interleukin-3 (Figure 4A).
Figure 4. G-CSFInduced Proliferative Responses of 32D.C10 Clones Expressing Various G-CSF Receptors.
Panel A shows the response to G-CSF in comparison with the response to interleukin-3. DNA synthesis was determined by the uptake of tritium-labeled thymidine. Data are presented as the percentage of the maximal response to 10 ng of murine interleukin-3 per milliliter for each clone. Analogous results were obtained with at least three independent clones for each form of receptor. Panel B shows the level of cell proliferation induced by G-CSF, according to the number of days in culture. Cells were cultured in medium containing 10 ng of G-CSF per milliliter. The number of viable cells was determined on the basis of trypan-blue exclusion. 32D.WT denotes cells expressing the wild-type receptor, 32D.1 cells expressing the mutant receptor from Patient 1, 32D.2 cells expressing the mutant receptor from Patient 2, 32D.WT-1 cells expressing the wild-type receptor and mutant receptor from Patient 1, and 32D.WT-2 cells expressing the wild-type receptor and mutant receptor from Patient 2.
In long-term cultures, the 32D.WT cells proliferated transientlyin medium containing G-CSF. The cells gradually lost viabilityafter 4 to 6 days in the medium (Figure 4B) and died after 12to 14 days. In contrast, the 32D.1 and 32D.2 cells proliferatedcontinuously and could be maintained in G-CSFcontainingculture medium for at least one month.
When cultured in medium containing interleukin-3, the 32D.WTcells had morphologic features that were typical of those ofimmature myeloid cells, and 50 to 60 percent of the cells displayedweak myeloperoxidase staining. Despite the death of substantialnumbers of cells after 8 to 12 days of culture in G-CSFcontainingmedium, the surviving 32D.WT cells exhibited morphologic featurescharacteristic of terminal granulocytic maturation (Figure 5A),and nearly all the cells showed strong myeloperoxidase staining.In striking contrast, G-CSF treatment of 32D.1 and 32D.2 cellsinduced neither morphologic changes indicative of granulocyticmaturation nor an increase in the expression of myeloperoxidaseprotein as indicated by myeloperoxidase staining (data not shown).
Figure 5. Morphologic Features of 32D.C10 Clones Expressing Wild-Type and Mutant G-CSF Receptors (MayGrünwaldGiemsa Stain, x630).
The cells were cultured for 10 days in medium containing G-CSF (10 ng per milliliter). Panel A shows cells expressing the wild-type receptor (32D.WT), Panel B cells expressing the wild-type receptor and the mutant receptor from Patient 1 (32D.WT-1), and Panel C cells expressing the wild-type receptor and the mutant receptor from Patient 2 (32D.WT-2). The 32D.WT cells matured into neutrophilic granulocytes in response to G-CSF, whereas the 32D.WT-1 and 32D.WT-2 cells retained a myeloblastic appearance.
Effect of Mutant Receptors on Granulocytic Maturation Mediated by the Wild-Type G-CSF Receptor
Because the leukemic cells from both patients expressed notonly the mutated genes for the G-CSF receptor but also the normalalleles of the gene, we performed studies to determine whetherthe mutant receptors interfere with the function of the wild-typereceptor. Two 32D.WT clones were transfected with pBabe-puroexpression vector carrying the cDNAs of the mutant receptorsfrom Patient 1 and Patient 2 or only empty pBabe-puro vector(the negative control). Expression of the wild-type and mutantG-CSFreceptor proteins in single clones was verifiedby Western blot analysis, and those that expressed approximatelyequal levels of the wild-type and mutant G-CSFreceptorproteins were examined. Transfection of 32D.WT cells with theempty vector did not alter G-CSFinduced proliferationand maturation (data not shown). The 32D.WT cells coexpressingthe mutant receptor from Patient 1 (32D.WT-1) or Patient 2 (32D.WT-2)had increased proliferative responses to G-CSF (Figure 4A) andproliferated continuously in culture medium containing G-CSFalone (Figure 4B). Both the 32D.WT-1 cells and the 32D.WT-2cells were unable to mature terminally in response to G-CSF(Figure 5B and Figure 5C). In fact, the responses of the 32D.WT-1cells and the 32D.WT-2 cells to G-CSF were indistinguishablefrom the response of the 32D.1 and 32D.2 cells.
Discussion
In this study, we have detected point mutations in the genefor the G-CSF receptor in two patients with acute myeloid leukemiaand histories of severe congenital neutropenia. The mutationstruncate the C-terminal cytoplasmic region of the receptor thatparticipates in the transduction of maturation signals.18,19In one patient the mutation was already present in the neutropenicphase, before the progression to acute myeloid leukemia. Whenexpressed in murine 32D.C10 cells, the truncated G-CSF receptorsfrom the two patients transduced stronger proliferative signalsthan the wild-type receptor but were defective in inducing maturation.Moreover, the mutant receptors blocked granulocytic maturationeven in the presence of wild-type G-CSF receptors, presumablyby forming heterodimers with the wild-type receptors.31,32 Takentogether, our data suggest that disruption of the maturation-signalingfunction of the G-CSF receptor contributes to leukemogenesis.
Not all patients with severe congenital neutropenia have mutationsin the G-CSF receptor.21,33,34 No such mutations correspondingto the cytoplasmic domain were found in three patients withsevere congenital neutropenia who were members of the Swedishfamilies in which the disease was originally described (unpublisheddata). However, a point mutation in the gene for the G-CSF receptor,causing truncation of the C-terminal region, has been identifiedin a patient with severe congenital neutropenia and monosomy7 but no signs of the myelodysplastic syndrome or acute myeloidleukemia (unpublished data). The mutation was detected in myeloidcells from this patient but not in B lymphocytes, indicatingits acquisition by a committed progenitor cell. Thus far, wehave found mutations in the gene for the G-CSF receptor in 4of 14 patients with severe congenital neutropenia; in all 4,the mutation truncated the C-terminal region. Patients withsevere congenital neutropenia and such truncated receptors mayrepresent a subgroup of patients in whom the neutropenia isa preleukemic disorder.
Recombinant human G-CSF, now used frequently in the treatmentof severe congenital neutropenia,12,13,14 can have favorableresults. However, acute myeloid leukemia or the myelodysplasticsyndrome has developed after the administration of G-CSF inpatients with severe congenital neutropenia.35,36,37 It remainsuncertain whether G-CSF therapy contributes to the progressionto acute myeloid leukemia in such patients. Analysis of theG-CSF receptor in a large series of patients with severe congenitalneutropenia will help elucidate the relation among defectiveG-CSFreceptor structures, the progression to acute myeloidleukemia, and the contribution of G-CSF therapy to leukemogenesis.
Supported by the Dutch Cancer Society.
We are indebted to Anita Schelen, Marleen van Paassen, and BirgitTeichmann for excellent technical assistance; and to Dr. HartmutLand (Imperial Cancer Research Fund, London) for the pBabe-puroexpression vector.
Source Information
From the Department of Hematology, Dr. Daniel den Hoed Cancer Center and Institute of Hematology, Erasmus University, Rotterdam, the Netherlands (F.D., B.L., I.P.T.); the Department of Clinical Pathology, City of Hope National Medical Center, Duarte, Calif. (R.K.B.); and the Department of Pediatric Hematology and Oncology, Hannover Medical School, Hannover, Germany (N.T., K.W.).
Address reprint requests to Dr. Touw at the Dr. Daniel den Hoed Cancer Center, P.O. Box 5201, 3008 AE Rotterdam, the Netherlands.
References
Kostmann R. Infantile genetic agranulocytosis: a new recessive lethal disease in man. Acta Paediatr 1956;105:1-78.
Wriedt K, Kauder E, Mauer AM. Defective myelopoiesis in congenital neutropenia. N Engl J Med 1970;283:1072-1077.
Rodin AE, Haggard ME, Nichols MM, Gustavson LP. Infantile genetic agranulocytosis: two cases occurring in siblings and one in a distant relative. Am J Dis Child 1973;126:818-821. [Medline]
Kostmann R. Infantile genetic agranulocytosis: a review with presentation of ten new cases. Acta Paediatr Scand 1975;64:362-368. [Medline]
Amato D, Freedman MH, Saunders EF. Granulopoiesis in severe congenital neutropenia. Blood 1976;47:531-538. [Free Full Text]
Kawaguchi Y, Kobayashi M, Tanabe A, et al. Granulopoiesis in patients with congenital neutropenia. Am J Hematol 1985;20:223-234. [Medline]
Gilman PA, Jackson DP, Guild HG. Congenital agranulocytosis: prolonged survival and terminal acute leukemia. Blood 1970;36:576-585. [Free Full Text]
Rosen RB, Kang S-J. Congenital agranulocytosis terminating in acute myelomonocytic leukemia. J Pediatr 1979;94:406-408. [CrossRef][Medline]
Wong W-Y, Williams D, Slovak ML, et al. Terminal acute myelogenous leukemia in a patient with congenital agranulocytosis. Am J Hematol 1993;43:133-138. [Medline]
Gillio AP, Gabrilove JL. Cytokine treatment of inherited bone marrow failure syndromes. Blood 1993;81:1669-1674. [Free Full Text]
Kobayashi M, Yumiba C, Kawaguchi Y, et al. Abnormal responses of myeloid progenitor cells to recombinant human colony-stimulating factors in congenital neutropenia. Blood 1990;75:2143-2149. [Free Full Text]
Welte K, Zeidler C, Reiter A, et al. Differential effects of granulocyte-macrophage colony-stimulating factor and granulocyte colony-stimulating factor in children with severe congenital neutropenia. Blood 1990;75:1056-1063. [Free Full Text]
Bonilla MA, Gillio AP, Ruggeiro M, et al. Effects of recombinant human granulocyte colony-stimulating factor on neutropenia in patients with congenital agranulocytosis. N Engl J Med 1989;320:1574-1580. [Abstract]
Dale DC, Bonilla MA, Davis MW, et al. A randomized controlled phase III trial of recombinant human granulocyte colony-stimulating factor (filgrastim) for treatment of severe chronic neutropenia. Blood 1993;81:2496-2502. [Free Full Text]
Fukunaga R, Seto Y, Mizushima S, Nagata S. Three different mRNAs encoding human granulocyte colony-stimulating factor receptor. Proc Natl Acad Sci U S A 1990;87:8702-8706. [Free Full Text]
Larsen A, Davis T, Curtis BM, et al. Expression cloning of a human granulocyte colony-stimulating factor receptor: a structural mosaic of hematopoietin receptor: immunoglobulin, and fibronectin domains. J Exp Med 1990;172:1559-1570. [Free Full Text]
Demetri GD, Griffin JD. Granulocyte colony-stimulating factor and its receptor. Blood 1991;78:2791-2808. [Free Full Text]
Dong F, van Buitenen C, Pouwels K, Hoefsloot LH, Löwenberg B, Touw IP. Distinct cytoplasmic regions of the human granulocyte colony-stimulating factor receptor involved in induction of proliferation and maturation. Mol Cell Biol 1993;13:7774-7781. [Free Full Text]
Fukunaga R, Ishizaka-Ikeda E, Nagata S. Growth and differentiation signals mediated by different regions in the cytoplasmic domain of granulocyte colony-stimulating factor receptor. Cell 1993;74:1079-1087. [CrossRef][Medline]
Ziegler SF, Bird TA, Morella KK, Mosley B, Gearing DP, Baumann H. Distinct regions of the human granulocyte-colony-stimulating factor receptor cytoplasmic domain are required for proliferation and gene induction. Mol Cell Biol 1993;13:2384-2390. [Free Full Text]
Dong F, Hoefsloot LH, Schelen AM, et al. Identification of a nonsense mutation in the granulocyte-colony-stimulating factor receptor in severe congenital neutropenia. Proc Natl Acad Sci U S A 1994;91:4480-4484. [Free Full Text]
Miller SA, Dykes DD, Polesky HF. A simple salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Res 1988;16:1215-1215. [Free Full Text]
Chomczynski P, Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal Biochem 1987;162:156-159. [Medline]
Morgenstern JP, Land H. Advanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line. Nucleic Acids Res 1990;18:3587-3596. [Free Full Text]
Greenberger JS, Sakakeeny MA, Humphries RK, Eaves CJ, Eckner RJ. Demonstration of permanent factor-dependent multipotential (erythroid/neutrophil/basophil) hematopoietic progenitor cell lines. Proc Natl Acad Sci U S A 1983;80:2931-2935. [Free Full Text]
Dong F, van Paassen M, van Buitenen C, Hoefsloot LH, Löwenberg B, Touw IP. A point mutation in the granulocyte colony-stimulating factor receptor (G-CSF-R) gene in a case of acute myeloid leukemia in the overexpression of a novel G-CSF-R isoform. Blood 1995;85:902-911. [Free Full Text]
Seto Y, Fukunaga R, Nagata S. Chromosomal gene organization of the human granulocyte colony-stimulating factor receptor. J Immunol 1992;148:259-266. [Abstract]
Cosman D. The hematopoietin receptor superfamily. Cytokine 1993;5:95-106. [CrossRef][Medline]
Fukunaga R, Ishizaka-Ikeda E, Pan C-X, Seto Y, Nagata S. Functional domains of the granulocyte colony-stimulating factor receptor. EMBO J 1991;10:2855-2865. [Medline]
Heldin C-H. Dimerization of cell surface receptors in signal transduction. Cell 1995;80:213-223. [CrossRef][Medline]
Hiraoka O, Anaguchi H, Ota Y. Evidence of the ligand-induced conversion from a dimer to a tetramer of the granulocyte colony-stimulating factor receptor. FEBS Lett 1994;356:255-260. [CrossRef][Medline]
Guba SC, Boxer LA, Emerson SG. G-CSF receptor transmembrane and intracytosolic structure in patients with congenital neutropenia. Blood 1993;82:Suppl 1:23a-23a.abstract
Sandoval C, Adams-Graves P, Parganas E, Wang W, Ihle JN. The cytoplasmic portion of the G-CSF receptor is normal in patients with Kostmann syndrome. Blood 1993;82:Suppl 1:185a-185a.abstract
Bonilla MA, Dale D, Zeidler C, et al. Long-term safety of treatment with recombinant human granulocyte colony-stimulating factor (r-metHuG-CSF) in patients with severe congenital neutropenias. Br J Haematol 1994;88:723-730. [Medline]
Imashuku S, Hibi S, Kataoka-Morimoto Y, et al. Myelodysplasia and acute myeloid leukaemia in cases of aplastic anaemia and congenital neutropenia following G-CSF administration. Br J Haematol 1995;89:188-190. [Medline]
Weinblatt ME, Scimeca P, James-Herry A, Sahdev I, Kochen J. Transformation of congenital neutropenia into monosomy 7 and acute nonlymphoblastic leukemia in a child treated with granulocyte colony-stimulating factor. J Pediatr 1995;126:263-265. [CrossRef][Medline]
Berliner, N.
(2008). Lessons from congenital neutropenia: 50 years of progress in understanding myelopoiesis. Blood
111: 5427-5432
[Abstract][Full Text]
Anderlini, P., Champlin, R. E.
(2008). Biologic and molecular effects of granulocyte colony-stimulating factor in healthy individuals: recent findings and current challenges. Blood
111: 1767-1772
[Abstract][Full Text]
Lee, J., Kim, Y., Lim, J., Kim, M., Han, K.
(2008). G-CSF and GM-CSF Concentrations and Receptor Expression in Peripheral Blood Leukemic Cells from Patients with Chronic Myelogenous Leukemia. Annals of Clinical & Laboratory Science
38: 331-337
[Abstract][Full Text]
Matsubara, K., Imai, K., Okada, S., Miki, M., Ishikawa, N., Tsumura, M., Kato, T., Ohara, O., Nonoyama, S., Kobayashi, M.
(2007). Severe developmental delay and epilepsy in a Japanese patient with severe congenital neutropenia due to HAX1 deficiency. haematol
92: e123-e125
[Abstract][Full Text]
Miranda, M. B., Redner, R. L., Johnson, D. E.
(2007). Inhibition of Src family kinases enhances retinoic acid induced gene expression and myeloid differentiation. Molecular Cancer Therapeutics
6: 3081-3090
[Abstract][Full Text]
Link, D. C., Kunter, G., Kasai, Y., Zhao, Y., Miner, T., McLellan, M. D., Ries, R. E., Kapur, D., Nagarajan, R., Dale, D. C., Bolyard, A. A., Boxer, L. A., Welte, K., Zeidler, C., Donadieu, J., Bellanne-Chantelot, C., Vardiman, J. W., Caligiuri, M. A., Bloomfield, C. D., DiPersio, J. F., Tomasson, M. H., Graubert, T. A., Westervelt, P., Watson, M., Shannon, W., Baty, J., Mardis, E. R., Wilson, R. K., Ley, T. J.
(2007). Distinct patterns of mutations occurring in de novo AML versus AML arising in the setting of severe congenital neutropenia. Blood
110: 1648-1655
[Abstract][Full Text]
Horwitz, M. S., Duan, Z., Korkmaz, B., Lee, H.-H., Mealiffe, M. E., Salipante, S. J.
(2007). Neutrophil elastase in cyclic and severe congenital neutropenia. Blood
109: 1817-1824
[Abstract][Full Text]
Touw, I. P., Bontenbal, M.
(2007). Granulocyte Colony-Stimulating Factor: Key (F)actor or Innocent Bystander in the Development of Secondary Myeloid Malignancy?. JNCI J Natl Cancer Inst
99: 183-186
[Full Text]
Emanuel, P. D.
(2007). Drifting precariously due to lost tyrosines. Blood
109: 7-8
[Full Text]
Germeshausen, M., Ballmaier, M., Welte, K.
(2007). Incidence of CSF3R mutations in severe congenital neutropenia and relevance for leukemogenesis: results of a long-term survey. Blood
109: 93-99
[Abstract][Full Text]
Mermel, C. H., McLemore, M. L., Liu, F., Pereira, S., Woloszynek, J., Lowell, C. A., Link, D. C.
(2006). Src family kinases are important negative regulators of G-CSF-dependent granulopoiesis. Blood
108: 2562-2568
[Abstract][Full Text]
Sloand, E. M., Yong, A. S. M., Ramkissoon, S., Solomou, E., Bruno, T. C., Kim, S., Fuhrer, M., Kajigaya, S., Barrett, A. J., Young, N. S.
(2006). Granulocyte colony-stimulating factor preferentially stimulates proliferation of monosomy 7 cells bearing the isoform IV receptor. Proc. Natl. Acad. Sci. USA
103: 14483-14488
[Abstract][Full Text]
Rosenberg, P. S., Alter, B. P., Bolyard, A. A., Bonilla, M. A., Boxer, L. A., Cham, B., Fier, C., Freedman, M., Kannourakis, G., Kinsey, S., Schwinzer, B., Zeidler, C., Welte, K., Dale, D. C., for the Severe Chronic Neutropenia International R,
(2006). The incidence of leukemia and mortality from sepsis in patients with severe congenital neutropenia receiving long-term G-CSF therapy. Blood
107: 4628-4635
[Abstract][Full Text]
Zhuang, D., Qiu, Y., Kogan, S. C., Dong, F.
(2006). Increased CCAAT Enhancer-binding Protein {epsilon} (C/EBP{epsilon}) Expression and Premature Apoptosis in Myeloid Cells Expressing Gfi-1 N382S Mutant Associated with Severe Congenital Neutropenia. J. Biol. Chem.
281: 10745-10751
[Abstract][Full Text]
Liu, H., Qiu, Y., Xiao, L., Dong, F.
(2006). Involvement of Protein Kinase C{epsilon} in the Negative Regulation of Akt Activation Stimulated by Granulocyte Colony-Stimulating Factor. J. Immunol.
176: 2407-2413
[Abstract][Full Text]
Zhuang, D., Qiu, Y., Haque, S. J., Dong, F.
(2005). Tyrosine 729 of the G-CSF receptor controls the duration of receptor signaling: involvement of SOCS3 and SOCS1. J. Leukoc. Biol.
78: 1008-1015
[Abstract][Full Text]
Wolfler, A., Erkeland, S. J., Bodner, C., Valkhof, M., Renner, W., Leitner, C., Olipitz, W., Pfeilstocker, M., Tinchon, C., Emberger, W., Linkesch, W., Touw, I. P., Sill, H.
(2005). A functional single-nucleotide polymorphism of the G-CSF receptor gene predisposes individuals to high-risk myelodysplastic syndrome. Blood
105: 3731-3736
[Abstract][Full Text]
Druhan, L. J., Ai, J., Massullo, P., Kindwall-Keller, T., Ranalli, M. A., Avalos, B. R.
(2005). Novel mechanism of G-CSF refractoriness in patients with severe congenital neutropenia. Blood
105: 584-591
[Abstract][Full Text]
Andritsos, L. A., Adkins, D., Vij, R., DiPersio, J. F., Devine, S. M.
(2004). Late Development of Acute Myeloid Leukemia in Two Peripheral Blood Stem Cell Donors Mobilized with G-CSF.. ASH ANNUAL MEETING ABSTRACTS
104: 1842-1842
[Abstract]
Hunter, M. G., Jacob, A., O'Donnell, L. C., Agler, A., Druhan, L. J., Coggeshall, K. M., Avalos, B. R.
(2004). Loss of SHIP and CIS Recruitment to the Granulocyte Colony-Stimulating Factor Receptor Contribute to Hyperproliferative Responses in Severe Congenital Neutropenia/Acute Myelogenous Leukemia. J. Immunol.
173: 5036-5045
[Abstract][Full Text]
van de Geijn, G.-J. M., Gits, J., Aarts, L. H. J., Heijmans-Antonissen, C., Touw, I. P.
(2004). G-CSF receptor truncations found in SCN/AML relieve SOCS3-controlled inhibition of STAT5 but leave suppression of STAT3 intact. Blood
104: 667-674
[Abstract][Full Text]
Kuramoto, K., Follmann, D. A., Hematti, P., Sellers, S., Agricola, B. A., Metzger, M. E., Donahue, R. E., von Kalle, C., Dunbar, C. E.
(2004). Effect of chronic cytokine therapy on clonal dynamics in nonhuman primates. Blood
103: 4070-4077
[Abstract][Full Text]
Aarts, L. H. J., Roovers, O., Ward, A. C., Touw, I. P.
(2004). Receptor activation and 2 distinct COOH-terminal motifs control G-CSF receptor distribution and internalization kinetics. Blood
103: 571-579
[Abstract][Full Text]
Relling, M. V., Boyett, J. M., Blanco, J. G., Raimondi, S., Behm, F. G., Sandlund, J. T., Rivera, G. K., Kun, L. E., Evans, W. E., Pui, C.-H.
(2003). Granulocyte colony-stimulating factor and the risk of secondary myeloid malignancy after etoposide treatment. Blood
101: 3862-3867
[Abstract][Full Text]
Hermans, M. H. A., van de Geijn, G.-J., Antonissen, C., Gits, J., van Leeuwen, D., Ward, A. C., Touw, I. P.
(2003). Signaling mechanisms coupled to tyrosines in the granulocyte colony-stimulating factor receptor orchestrate G-CSF-induced expansion of myeloid progenitor cells. Blood
101: 2584-2590
[Abstract][Full Text]
Grenda, D. S., Johnson, S. E., Mayer, J. R., McLemore, M. L., Benson, K. F., Horwitz, M., Link, D. C.
(2002). Mice expressing a neutrophil elastase mutation derived from patients with severe congenital neutropenia have normal granulopoiesis. Blood
100: 3221-3228
[Abstract][Full Text]
Hortner, M., Nielsch, U., Mayr, L. M., Johnston, J. A., Heinrich, P. C., Haan, S.
(2002). Suppressor of Cytokine Signaling-3 Is Recruited to the Activated Granulocyte-Colony Stimulating Factor Receptor and Modulates its Signal Transduction. J. Immunol.
169: 1219-1227
[Abstract][Full Text]
Dong, F., Qiu, Y., Yi, T., Touw, I. P., Larner, A. C.
(2001). The Carboxyl Terminus of the Granulocyte Colony- Stimulating Factor Receptor, Truncated in Patients with Severe Congenital Neutropenia/Acute Myeloid Leukemia, Is Required for SH2-Containing Phosphatase-1 Suppression of Stat Activation. J. Immunol.
167: 6447-6452
[Abstract][Full Text]
Magnusson, M. K., Meade, K. E., Brown, K. E., Arthur, D. C., Krueger, L. A., Barrett, A. J., Dunbar, C. E.
(2001). Rabaptin-5 is a novel fusion partner to platelet-derived growth factor {beta} receptor in chronic myelomonocytic leukemia. Blood
98: 2518-2525
[Abstract][Full Text]
Hermans, M. H. A., Touw, I. P., Dale, D. C., Aprikyan, A.
(2001). Significance of neutrophil elastase mutations versus G-CSF receptor mutations for leukemic progression of congenital neutropenia. Blood
97: 2185-2186
[Full Text]
Tschan, C. A., Pilz, C., Zeidler, C., Welte, K., Germeshausen, M.
(2001). Time course of increasing numbers of mutations in the granulocyte colony-stimulating factor receptor gene in a patient with congenital neutropenia who developed leukemia. Blood
97: 1882-1884
[Abstract][Full Text]
Lakshman, R, Finn, A
(2001). Neutrophil disorders and their management. J. Clin. Pathol.
54: 7-19
[Abstract][Full Text]
Jeha, S., Chan, K. W., Aprikyan, A. G., Hoots, W. K., Culbert, S., Zietz, H., Dale, D. C., Albitar, M.
(2000). Spontaneous remission of granulocyte colony-stimulating factor-associated leukemia in a child with severe congenital neutropenia. Blood
96: 3647-3649
[Abstract][Full Text]
Dale, D. C., Person, R. E., Bolyard, A. A., Aprikyan, A. G., Bos, C., Bonilla, M. A., Boxer, L. A., Kannourakis, G., Zeidler, C., Welte, K., Benson, K. F., Horwitz, M.
(2000). Mutations in the gene encoding neutrophil elastase in congenital and cyclic neutropenia. Blood
96: 2317-2322
[Abstract][Full Text]
Modi, N., Carr, R.
(2000). Promising stratagems for reducing the burden of neonatal sepsis. Arch. Dis. Child. Fetal Neonatal Ed.
83: 150F-153
[Full Text]
Katsuki, K., Shinohara, K., Takeda, K., Ariyoshi, K., Yamada, T., Kameda, N., Takahashi, T., Nawata, R., Shibata, S., Asano, Y., Okamura, S.
(2000). Chronic Neutrophilic Leukemia with Acute Myeloblastic Transformation. Jpn J Clin Oncol
30: 362-365
[Abstract][Full Text]
Freedman, M. H., Bonilla, M. A., Fier, C., Bolyard, A. A., Scarlata, D., Boxer, L. A., Brown, S., Cham, B., Kannourakis, G., Kinsey, S. E., Mori, P. G., Cottle, T., Welte, K., Dale, D. C.
(2000). Myelodysplasia syndrome and acute myeloid leukemia in patients with congenital neutropenia receiving G-CSF therapy. Blood
96: 429-436
[Abstract][Full Text]
Sawai, N., Koike, K., Mwamtemi, H. H., Ito, S., Kurokawa, Y., Sakashita, K., Kinoshita, T., Higuchi, T., Takeuchi, K., Shiohara, M., Kamijo, T., Higuchi, Y., Miyazaki, H., Kato, T., Kobayashi, M., Miyake, M., Yasui, K., Komiyama, A.
(2000). Thrombopoietin enhances neutrophil production by bone marrow hematopoietic progenitors with the aid of stem cell factor in congenital neutropenia. J. Leukoc. Biol.
68: 137-143
[Abstract][Full Text]
Shimizu, K., Kitabayashi, I., Kamada, N., Abe, T., Maseki, N., Suzukawa, K., Ohki, M.
(2000). AML1-MTG8 leukemic protein induces the expression of granulocyte colony-stimulating factor (G-CSF) receptor through the up-regulation of CCAAT/enhancer binding protein epsilon. Blood
96: 288-296
[Abstract][Full Text]
White, S. M., Alarcon, M. H., Tweardy, D. J.
(2000). Inhibition of granulocyte colony-stimulating factor-mediated myeloid maturation by low level expression of the differentiation-defective class IV granulocyte colony-stimulating factor receptor isoform. Blood
95: 3335-3340
[Abstract][Full Text]
Fujio, K., Nosaka, T., Kojima, T., Kawashima, T., Yahata, T., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Yamamoto, K., Nishimura, T., Kitamura, T.
(2000). Molecular cloning of a novel type 1 cytokine receptor similar to the common gamma chain. Blood
95: 2204-2210
[Abstract][Full Text]
Hunter, M. G., Avalos, B. R.
(2000). Granulocyte colony-stimulating factor receptor mutations in severe congenital neutropenia transforming to acute myelogenous leukemia confer resistance to apoptosis and enhance cell survival. Blood
95: 2132-2137
[Abstract][Full Text]
Dong, F., Larner, A. C.
(2000). Activation of Akt kinase by granulocyte colony-stimulating factor (G-CSF): evidence for the role of a tyrosine kinase activity distinct from the janus kinases. Blood
95: 1656-1662
[Abstract][Full Text]
Zeidler, C., Welte, K., Barak, Y., Barriga, F., Bolyard, A. A., Boxer, L., Cornu, G., Cowan, M. J., Dale, D. C., Flood, T., Freedman, M., Gadner, H., Mandel, H., O'Reilly, R. J., Ramenghi, U., Reiter, A., Skinner, R., Vermylen, C., Levine, J. E.
(2000). Stem cell transplantation in patients with severe congenital neutropenia without evidence of leukemic transformation. Blood
95: 1195-1198
[Abstract][Full Text]
Dinauer, M. C., Lekstrom-Himes, J. A., Dale, D. C.
(2000). Inherited Neutrophil Disorders: Molecular Basis and New Therapies. ASH Education Book
2000: 303-318
[Abstract][Full Text]
Ward, A. C., Touw, I., Yoshimura, A.
(2000). The Jak-Stat pathway in normal and perturbed hematopoiesis. Blood
95: 19-29
[Full Text]
Konishi, N., Kobayashi, M., Miyagawa, S.-i., Sato, T., Katoh, O., Ueda, K.
(1999). Defective Proliferation of Primitive Myeloid Progenitor Cells in Patients With Severe Congenital Neutropenia. Blood
94: 4077-4083
[Abstract][Full Text]
Moliterno, A. R., Spivak, J. L.
(1999). Posttranslational Processing of the Thrombopoietin Receptor Is Impaired in Polycythemia Vera. Blood
94: 2555-2561
[Abstract][Full Text]
Lowenberg, B., Downing, J. R., Burnett, A.
(1999). Acute Myeloid Leukemia. NEJM
341: 1051-1062
[Full Text]
Ward, A. C., van Aesch, Y. M., Gits, J., Schelen, A. M., de Koning, J. P., van Leeuwen, D., Freedman, M. H., Touw, I. P.
(1999). Novel Point Mutation in the Extracellular Domain of the Granulocyte Colony-stimulating Factor (G-CSF) Receptor in a Case of Severe Congenital Neutropenia Hyporesponsive to G-CSF Treatment. JEM
190: 497-508
[Abstract][Full Text]
Bogardus, S. T. Jr, Concato, J., Feinstein, A. R.
(1999). Clinical Epidemiological Quality in Molecular Genetic Research: The Need for Methodological Standards. JAMA
281: 1919-1926
[Abstract][Full Text]
Ward, A. C., Smith, L., de Koning, J. P., van Aesch, Y., Touw, I. P.
(1999). Multiple Signals Mediate Proliferation, Differentiation, and Survival from the Granulocyte Colony-stimulating Factor Receptor in Myeloid 32D Cells. J. Biol. Chem.
274: 14956-14962
[Abstract][Full Text]
Carr, R., Modi, N., Doré, C. J., El-Rifai, R., Lindo, D.
(1999). A Randomized, Controlled Trial of Prophylactic Granulocyte-Macrophage Colony-Stimulating Factor in Human Newborns Less Than 32 Weeks Gestation. Pediatrics
103: 796-802
[Abstract][Full Text]
Hermans, M. H.A., Antonissen, C., Ward, A. C., Mayen, A. E.M., Ploemacher, R. E., Touw, I. P.
(1999). Sustained Receptor Activation and Hyperproliferation in Response to Granulocyte Colony-stimulating Factor (G-CSF) in Mice with a Severe Congenital Neutropenia/Acute Myeloid Leukemia-derived Mutation in the G-CSF Receptor Gene. JEM
189: 683-692
[Abstract][Full Text]
Hunter, M. G., Avalos, B. R.
(1999). Deletion of a Critical Internalization Domain in the G-CSFR in Acute Myelogenous Leukemia Preceded by Severe Congenital Neutropenia. Blood
93: 440-446
[Abstract][Full Text]
Ward, A. C., van Aesch, Y. M., Schelen, A. M., Touw, I. P.
(1999). Defective Internalization and Sustained Activation of Truncated Granulocyte Colony-Stimulating Factor Receptor Found in Severe Congenital Neutropenia/Acute Myeloid Leukemia. Blood
93: 447-458
[Abstract][Full Text]
Ward, A. C., Hermans, M. H.A., Smith, L., van Aesch, Y. M., Schelen, A. M., Antonissen, C., Touw, I. P.
(1999). Tyrosine-Dependent and -Independent Mechanisms of STAT3 Activation by the Human Granulocyte Colony-Stimulating Factor (G-CSF) Receptor Are Differentially Utilized Depending on G-CSF Concentration. Blood
93: 113-124
[Abstract][Full Text]
Dong, F., Liu, X., de Koning, J. P., Touw, I. P., Henninghausen, L., Larner, A., Grimley, P. M.
(1998). Stimulation of Stat5 by Granulocyte Colony-Stimulating Factor (G-CSF) Is Modulated by Two Distinct Cytoplasmic Regions of the G-CSF Receptor. J. Immunol.
161: 6503-6509
[Abstract][Full Text]
Solder, B., Weiss, M., Jager, A., Belohradsky, B. H.
(1998). Dyskeratosis Congenita: Multisystemic Disorder with Special Consideration of Immunologic Aspects: A Review of the Literature. CLIN PEDIATR
37: 521-530
[Abstract]
Harris, K. W., Hu, X.-J., Schultz, S., Arcasoy, M. O., Forget, B. G., Clare, N.
(1998). The Distal Cytoplasmic Domain of the Erythropoietin Receptor Induces Granulocytic Differentiation in 32D Cells. Blood
92: 1219-1224
[Abstract][Full Text]
Jacob, J., Haug, J. S., Raptis, S., Link, D. C.
(1998). Specific Signals Generated by the Cytoplasmic Domain of the Granulocyte Colony-Stimulating Factor (G-CSF) Receptor Are Not Required for G-CSF-Dependent Granulocytic Differentiation. Blood
92: 353-361
[Abstract][Full Text]
Hermans, M. H.A., Ward, A. C., Antonissen, C., Karis, A., Lowenberg, B., Touw, I. P.
(1998). Perturbed Granulopoiesis in Mice With a Targeted Mutation in the Granulocyte Colony-Stimulating Factor Receptor Gene Associated With Severe Chronic Neutropenia. Blood
92: 32-39
[Abstract][Full Text]
Socolovsky, M., Lodish, H. F., Daley, G. Q.
(1998). Control of hematopoietic differentiation: Lack of specificity in signaling by cytokine receptors. Proc. Natl. Acad. Sci. USA
95: 6573-6575
[Full Text]
Hunter, M. G., Avalos, B. R.
(1998). Phosphatidylinositol 3'-Kinase and SH2-Containing Inositol Phosphatase (SHIP) Are Recruited by Distinct Positive and Negative Growth-Regulatory Domains in the Granulocyte Colony-Stimulating Factor Receptor. J. Immunol.
160: 4979-4987
[Abstract][Full Text]
de Koning, J. P., Soede-Bobok, A. A., Schelen, A. M., Smith, L., van Leeuwen, D., Santini, V., Burgering, B. M.T., Bos, J. L., Lowenberg, B., Touw, I. P.
(1998). Proliferation Signaling and Activation of Shc, p21Ras, and Myc Via Tyrosine 764 of Human Granulocyte Colony-Stimulating Factor Receptor. Blood
91: 1924-1933
[Abstract][Full Text]
Gale, R. E., Freeburn, R. W., Khwaja, A., Chopra, R., Linch, D. C.
(1998). A Truncated Isoform of the Human beta Chain Common to the Receptors for Granulocyte-Macrophage Colony-Stimulating Factor, Interleukin-3 (IL-3), and IL-5 With Increased mRNA Expression in Some Patients With Acute Leukemia. Blood
91: 54-63
[Abstract][Full Text]
Kasper, B., Herbst, A., Pilz, C., Germeshausen, M., Tidow, N., Hadam, M. R., Welte, K.
(1997). Severe Congenital Neutropenia Patients With Point Mutations in the Granulocyte Colony-Stimulating Factor (G-CSF ) Receptor mRNA Express a Normal G-CSF Receptor Protein. Blood
90: 2839-2840
[Full Text]
Pui, C.-H., Boyett, J. M., Hughes, W. T., Rivera, G. K., Hancock, M. L., Sandlund, J. T., Synold, T., Relling, M. V., Ribeiro, R. C., Crist, W. M., Evans, W. E.
(1997). Human Granulocyte Colony-Stimulating Factor after Induction Chemotherapy in Children with Acute Lymphoblastic Leukemia. NEJM
336: 1781-1787
[Abstract][Full Text]
Tidow, N., Pilz, C., Teichmann, B., Muller-Brechlin, A., Germeshausen, M., Kasper, B., Rauprich, P., Sykora, K.-W., Welte, K.
(1997). Clinical Relevance of Point Mutations in the Cytoplasmic Domain of the Granulocyte Colony-Stimulating Factor Receptor Gene in Patients With Severe Congenital Neutropenia. Blood
89: 2369-2375
[Abstract][Full Text]
Carr, R., Modi, N.
(1997). Haemopoietic colony stimulating factors for preterm neonates. Arch. Dis. Child. Fetal Neonatal Ed.
76: 128F-133
[Full Text]
Calhoun, D. A., Christensen, R. D.
(1997). The Occurrence of Kostmann Syndrome in Preterm Neonates. Pediatrics
99: 259-259
[Full Text]
Alter, B. P.
(1996). Aplastic Anemia, Pediatric Aspects. The Oncologist
1: 361-366
[Abstract][Full Text]
Naparstek, E.
(1995). Granulocyte Colony-Stimulating Factor, Congenital Neutropenia, and Acute Myeloid Leukemia. NEJM
333: 516-518
[Full Text]
Dong, F., Gutkind, J. S., Larner, A. C.
(2001). Granulocyte Colony-stimulating Factor Induces Erk5 Activation, Which Is Differentially Regulated by Protein-tyrosine Kinases and Protein Kinase C. REGULATION OF CELL PROLIFERATION AND SURVIVAL. J. Biol. Chem.
276: 10811-10816
[Abstract][Full Text]
Li, F.-Q., Horwitz, M.
(2001). Characterization of Mutant Neutrophil Elastase in Severe Congenital Neutropenia. J. Biol. Chem.
276: 14230-14241
[Abstract][Full Text]
Kroll, S. L., Barth-Baus, D., Hensold, J. O.
(2001). The Carboxyl-terminal Domain of the Granulocyte Colony-stimulating Factor Receptor Uncouples Ribosomal Biogenesis from Cell Cycle Progression in Differentiating 32D Myeloid Cells. J. Biol. Chem.
276: 49410-49418
[Abstract][Full Text]