| |||||||||||||||||||||||||||||||||||||||
Case Report
A 4 1/2-year-old boy was admitted to our hospital because of muscle weakness and premature muscle fatigue: he was unable to walk for more than 10 minutes or climb more than 20 steps at a time. Two days previously, fever and symptoms of an upper respiratory tract infection had developed.
The boy weighed 2.75 kg at birth and was 48 cm long. He was born after an uneventful pregnancy and delivery. Phototherapy was required for postnatal unconjugated hyperbilirubinemia. Several unexplained episodes of jaundice and anemia requiring blood transfusions occurred during the first year of life. Examination of the family history revealed no cases of chronic hemolytic anemia or myopathy. The boy's parents were healthy and nonconsanguineous.
On physical examination, the patient had slight jaundice, diminished muscle mass, reduced muscle tone, and proximal muscle weakness. The liver was 3 cm below the right costal margin, and the spleen was palpable 2 cm below the left costal margin. He weighed 12.8 kg (3.4 SD below the normal mean for age), was 100.2 cm tall (1.8 SD below the normal mean for age), and had a head circumference of 49.1 cm (2.2 SD below the normal mean for age). Motor development and language acquisition were slightly delayed.
Laboratory examinations revealed the following values: hemoglobin, 9.7 g per deciliter; hematocrit, 26.8 percent; mean corpuscular volume, 86.7 µm3; mean corpuscular hemoglobin, 31.4 pg; reticulocyte count, 6.5 percent; white-cell count, 19,800 per cubic millimeter; and platelet count, 242,000 per cubic millimeter. The creatine kinase concentration was markedly elevated (2620 U per liter; normal, <60). The levels of the following were also abnormal: aspartate aminotransferase, 71 U per liter (normal, <30); alanine aminotransferase, 39 U per liter (normal, <35); lactate dehydrogenase, 535 U per liter (normal, <300); total bilirubin, 2.9 mg per deciliter (49.6 µmol per liter; normal, <1.0 mg per deciliter [18 µmol per liter]); and haptoglobin, 0.3 g per liter (normal, 0.4 to 2.2). Coombs' test and a test for antierythrocytic antibodies were negative; osmotic resistance was normal. Urinalysis revealed mild hemoglobinuria and myoglobinuria. The results of electromyography, studies of nerve-conduction velocities, and electroencephalography were normal.
The boy's creatine kinase concentration dropped to 186 U per liter two weeks after he recovered from the febrile illness, and the hemoglobin level increased to 14.6 g per deciliter six weeks after his recovery. The size of the liver and spleen became normal. On follow-up, several episodes of rhabdomyolysis with creatine kinase elevations of up to 6480 U per liter were observed during febrile illnesses. Less severe elevations of creatine kinase were also seen after exercise and general anesthesia for tonsillectomy. The hemoglobin level and red-cell count were normal on repeated measurements during illness-free periods.
Methods
The research proposal for this study was approved by the ethics committee of the Justus-Liebig University, Giessen, Germany. Informed consent was obtained from the boy's parents.
Morphologic and Biochemical Studies
Histologic and histochemical studies were performed on muscle tissue obtained from the patient's left quadriceps muscle by standard techniques.6 Muscle enzymes were extracted and their activities determined as previously described.7
Enzyme activities and levels of ATP, 2,3-diphosphoglycerate, and reduced glutathione in red cells were determined according to the methods of the International Committee for Standardization in Haematology.8,9 Levels of erythrocyte metabolites, rates of glucose consumption and lactate formation, and glutathione stability were determined as previously described.10,11,12 The metabolic studies included eight control subjects without any hematologic abnormalities and, as reticulocyte-rich controls, two patients with hereditary spherocytosis (reticulocyte counts, 11.8 and 18 percent). All control values are means ±2 SD.
The thermostability of aldolase activity was studied by incubation of hemolysates of red cells at 56°C for 30 minutes. The Michaelis constant (the substrate concentration yielding half-maximal activity) of aldolase for fructose-1,6-bisphosphate was determined by the conventional assay, with final substrate concentrations ranging from 0.1 to 50 µM. Electrophoresis and staining were carried out with partially purified aldolase (Sephacryl S-300, Pharmacia, Freiburg, Germany).13 All substrates and standard enzyme preparations were purchased commercially (BoehringerMannheim, Mannheim, Germany).
Molecular Studies
Total cellular RNA from muscle tissue and peripheral-blood mononuclear cells frozen in liquid nitrogen was purified by a single-step method.14,15 After reverse transcription, the entire coding sequence (positions 168 to 1262) of the aldolase A messenger RNA16 was amplified by a nested polymerase chain reaction (PCR) with a 5'GGATTTCCAAGGAAGAATTTCCTCTG3' sense primer (positions 113 to 138) and a 5'GGCAGGGCCTGGAGTTGTTGG3' antisense primer (positions 1306 to 1286) during the first round and a 5'GCACCGGAACTTGCTACTACCAG3' sense primer (positions 141 to 163) and a 5'GGCAGCCTGGGAACACCTCCG3' antisense primer (positions 1284 to 1264) during the second round. The second-round PCR primers carried recognition sites for the restriction enzymes SacI and EcoRI to facilitate cloning of the PCR products into the pBluescript vector (Stratagene, La Jolla, Calif.). Plasmid preparations from single colonies were subjected to dideoxy sequencing17 with an automatic DNA sequencer (model ABI 373A, Taq DyeDeoxy Terminator cycle-sequencing kit, Perkin-Elmer, Applied Biosystems Division, Foster City, Calif.). From each sample two different PCR runs were carried out, followed by sequencing of three clones each in both directions. Apart from the universal M13 sequencing primers (BoehringerMannheim), six specific oligonucleotides (sense primer: positions 391 to 413, 671 to 694, and 977 to 998; antisense primer: positions 487 to 466, 764 to 747, and 1079 to 1058) were used to prime overlapping sequencing reactions. Solid-phase direct sequencing of PCR products was carried out as previously described in order to demonstrate heterozygosity of the patient's relatives.14 Sequence-homology scans were performed with PC/Gene computer software (IntelliGenetics, Geneva).
Results
Morphologic and Biochemical Studies
On light microscopy, the patient's muscle tissue showed a well-preserved fascicular architecture but a remarkable range of diameters of both type 1 and type 2 fibers (Figure 1A). Some fibers showed intracytoplasmic fiber splitting with increased activity of acid phosphatase (Figure 1B). The results of staining with periodic acidSchiff, oil red O, NADH dehydrogenase, cytochrome-c-oxidase, phosphorylase, and myosin ATPase were normal.
|
There was a profound reduction of aldolase activity in muscle tissue (9.8 U per gram of wet weight; mean [±2 SD] value in 11 controls, 92±46). The activities of myophosphorylase and distal glycolysis enzymes were as follows: phosphorylase, 7.6 U per gram of wet weight (normal value in 53 controls, 13.9±4.4); phosphoglycerate kinase, 160 U per gram of wet weight (normal value in 20 controls, 253±105); phosphoglycerate mutase, 375 U per gram of wet weight (normal value in 14 controls, 290±104); and lactate dehydrogenase, 304 U per gram of wet weight (normal value in 40 controls, 300±165).
In the patient's red cells, the residual aldolase activity was 4 percent of the normal level (Table 1). The activities of other enzymes were normal or even increased, mainly reflecting the young age of the erythrocytes. In order to eliminate the influence of reticulocytosis, the mean control values were corrected for the patient's reticulocyte count.18 The ratios of the patient's enzyme activities to the corrected control values exceeded 1 for the enzymes whose actions in the glycolytic pathway occur before those of aldolase (1.23 for hexokinase, 1.40 for glucose phosphate isomerase, and 1.26 for phosphofructokinase), but were less than 1 for the enzyme whose actions occur after those of aldolase (0.60 for pyruvate kinase). The aldolase activity of erythrocytes from the patient's parents and brother was about half the normal activity (Table 1).
|
The ATP content of fresh erythrocytes from the patient was lower than normal (4.13 µmol per gram of hemoglobin; normal, 4.46±0.28). The glucose consumption of the patient's red cells was also lower than normal after incubation at 37°C for two hours (2.85 µmol per milliliter of erythrocytes; normal, 4.32±1.30) and four hours (4.10 µmol per milliliter of erythrocytes; normal, 6.93±2.05). The corresponding values for lactate formation were 6.15 µmol per milliliter of erythrocytes (normal, 5.70±2.31) and 12.1 µmol per milliliter of erythrocytes (normal, 11.4±3.42).
The level of reduced glutathione in the patient's red cells was 79.8 mg per deciliter (normal, 68.9±10.74). In the presence of acetylphenylhydrazine, the level of reduced glutathione decreased by 14.1 percent from base-line levels (normal decrease, 10.3±6.8 percent) after two hours of incubation and by 26.3 percent (normal decrease, 21.9±13.3 percent) after four hours of incubation at 37°C.
The aldolase activity in the patient's hemolysates was decreased to 10 percent of the base-line level after incubation for 30 minutes at 56°C. The activity of the enzyme was completely stable in hemolysates from the patient's parents and controls. The Michaelis constant of the patient's aldolase was 16.8 µmol per liter (normal, 11.4±5.0). Because of the instability of the enzyme, the electrophoretic pattern of purified aldolase from the patient's erythrocytes could not be determined. The Michaelis constants and the electrophoretic patterns of the aldolase from the parents were normal, a finding that probably reflects the presence of wild-type aldolase A.
Molecular Studies
Within the coding region of aldolase A obtained both from the patient's peripheral-blood mononuclear cells and from muscle tissue, there was a single-base transversion from guanine to adenine at position 619, resulting in a change in the amino acid from glutamic acid (GAG) to lysine (AAG) at residue 206 (Glu206Lys). In contrast, peripheral-blood mononuclear cells from the patient's parents and his brother revealed a heterozygous pattern in which both guanine and adenine occurred at position 619, suggesting an autosomal recessive mode of inheritance.
Discussion
Human aldolase A is composed of four identical subunits encoded by a single gene located on chromosome 16 (16q22q24).3,19 Our patient carries a new homozygous germ-line mutation (Glu206Lys) in which the negatively charged glutamic acid is changed to the positively charged lysine at residue 206. This amino acid is conserved in all known aldolase isozymes from different species, including drosophila.20 Amino acid residues 196 to 218 represent helix E in the secondary structure of human aldolase and show complete homology with the corresponding enzymes in rats, rabbits, and mice. Helixes E and F from adjacent subunits together form the more extensive of two subunit interfaces providing the tetrahedral-like configuration of the aldolase enzyme. Helix E interacts with its equivalent helix E in the other subunit virtually all along its length.21 The integrity of the quaternary structure has been suggested as the basis for the thermal stability of aldolase A.22 Therefore, we assume that the lability of this essential subunit-interaction site is the main reason for the impaired thermostability of the Glu206Lys mutant. The finding of only a single nucleotide change in our patient and the biochemical importance of the resulting amino acid substitution in this highly conserved region of aldolase A clearly argue against the possibility of a DNA polymorphism.
The findings of impaired glucose consumption and reduced ATP levels suggest a severe disturbance of energy production as a cause of hemolysis and myopathy in our patient. These metabolic alterations become even more evident if the higher levels of glycolytic flux and ATP formation that occur in populations of young erythrocytes are taken into account.23 The findings of normal glutathione levels and glutathione stability suggest that the activity of the hexose monophosphate pathway is unaffected, providing stability of the redox potential against oxidizing agents. Clinical and morphologic signs of myopathy reflect the occurrence of substantial damage to muscle tissue as a result of aldolase deficiency. Similar nonspecific myopathic signs have also been observed in patients with myopathy and other glycolytic defects in addition to more specific findings such as glycogen deposits.1,12 However, the aggravation of rhabdomyolysis by fever, as occurred in our patient, is quite an unusual finding in metabolic myopathies, possibly reflecting the thermolability of this mutant enzyme.
Erythrocyte aldolase deficiency has been described previously in three patients with chronic hemolytic anemia but no signs of myopathy.2,4,5 In one of these patients the underlying mutation was identified as a change from aspartic acid to glycine at position 128.24 This mutation, affecting the less extensive interaction site between aldolase A subunits, also causes thermolability of the enzyme.4,21,22,24 The absence of myopathic symptoms in this patient, however, was assumed to be due to ongoing protein synthesis in muscle tissue.2,4,24 In our patient, the extent of impairment of the main subunit interface of the aldolase tetramer probably exceeds the capacity of transcriptional factors to compensate for the muscular enzyme deficiency and may explain the myopathy.
Glycolytic enzyme deficiencies may cause multisystem disease with predominant neurologic and myopathic abnormalities, including a variable degree of hemolysis as one component. Even in cases without marked alteration of red-cell function or life span, erythrocyte-enzyme assays may still provide a simple means of detection and diagnosis of these multisystem disorders.2,25 Our findings suggest that deficiency of fructose-1,6-bisphosphate aldolase A in muscles should be included in the diagnostic spectrum of inherited metabolic myopathies characterized by exercise intolerance and rhabdomyolysis.
Supported by the Forschungshilfe Station Peiper and the Deutsche Forschungsgemeinschaft (Re 265/8-2).
We are indebted to Ms. Ursula Buchen, Ms. Margret Lützen, and Dr. N. Katz for excellent technical assistance and laboratory support.
Source Information
From the Department of Pediatrics (J.K., A.B., R.R., B.G., F.L.) and the Institutes of Neuropathology (W.S.) and Clinical Chemistry (K.S.), Justus-Liebig University, Giessen; the Department of Pediatrics, Georg-August University, Göttingen (A.P., U.G.); and the Department of Neurology, Julius-Maximilians University, Würzburg (H.R.) all in Germany.
Address reprint requests to Dr. Lampert at Abteilung Allgemeine Pädiatrie, Hämatologie und Onkologie, Zentrum für Kinderheilkunde, Justus-Liebig-Universität, Feulgenstraße 12, D-35385 Giessen, Germany.
References
| |||||||||||||||||||||||||||||||||||||||
Related Letters:
Inherited Metabolic Myopathy and Hemolysis Due to a Mutation in Aldolase A
Kopp A., Bistrian B. R., Kreuder J., Repp R., Lampert F.
Extract |
Full Text
N Engl J Med 1996;
335:1242-1243, Oct 17, 1996.
Correspondence
This article has been cited by other articles:
HOME | SUBSCRIBE | SEARCH | CURRENT ISSUE | PAST ISSUES | COLLECTIONS | PRIVACY | TERMS OF USE | HELP | beta.nejm.org Comments and questions? Please contact us. The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved. |