Background A region associated with sensitivity to interferonhas been identified in the nonstructural protein 5A (NS5A) ofhepatitis C virus (HCV) genotype 1b. The region spans aminoacid residues 2209 to 2248 (NS5A2209–2248) of HCV-J, astrain of HCV-1b whose complete genomic sequence has been identified.We examined whether the NS5A2209–2248 sequence presentbefore therapy could be used as a predictor of the responseto interferon therapy in patients with chronic HCV-1b infection.
Methods We retrospectively analyzed 84 patients with chronicHCV-1b infection who had received interferon alfa (total dose,516 million to 880 million units) for six months. Pretreatmentserum samples were analyzed. The amino acid sequence of NS5A2209–2248was determined by direct sequencing of the HCV genome amplifiedby the polymerase chain reaction (PCR) and was compared withthe established sequence for HCV-J.
Results A complete response, as evidenced by the absence ofHCV RNA in serum on nested reverse-transcription PCR for sixmonths after therapy, did not occur in any of the 30 patientswhose NS5A2209–2248 sequences were identical to that ofHCV-J (wild type). Five of 38 patients (13 percent) with 1 to3 changes in NS5A2209–2248 (intermediate type) had completeresponses, as did all 16 patients with 4 to 11 amino acid substitutions(mutant type), indicating that the mutant type was significantlyassociated with a complete response (P<0.001). Although base-lineserum HCV RNA levels, as measured by a branched-chain DNA assay,were lower in patients with the mutant type of NS5A2209–2248than in those with the other types (P<0.001), multivariateanalyses revealed that the number of amino acid substitutionsin NS5A2209–2248 was the only variable associated withan independent effect on the outcome of interferon therapy (oddsratio, 5.3; 95 percent confidence interval, 1.6 to 18; P = 0.007).
Conclusions In patients with chronic HCV-1b infection, thereis a substantial correlation between responses to interferonand mutations in the NS5A gene.
Hepatitis C virus (HCV), which has a positive-sense, single-strandedRNA genome with approximately 9400 nucleotides, causes mostcases of chronic non-A, non-B hepatitis.1,2 Chronic hepatitisC infection can progress to liver cirrhosis and hepatocellularcarcinoma over the course of 20 to 30 years.3
Interferon is the sole therapy for chronic hepatitis C, althoughonly 25 percent of patients treated for 6 to 12 months havesustained remissions, with the eradication of HCV (completeresponse).4 The effects of interferon differ among the variousHCV genotypes.5 Because HCV genotype 1b (HCV-1b) is resistantto interferon,6 the rate of complete response is only 10 to40 percent, which is much lower than those of the other genotypes,such as HCV-2a or HCV-2b, with rates of complete response of60 to 90 percent.7-10 HCV-1b is the most frequent variant worldwide,with a high incidence (37 to 80 percent) in Asian, American,and European countries studied to date.11-14 Patients with HCV-1binfection have more active disease and are more likely to haveprogression to liver cirrhosis and hepatocellular carcinomathan patients with other HCV genotypes.13,15-18 Therefore, theresistance of HCV-1b to interferon is a serious problem in themanagement of chronic hepatitis infection. Since interferontherapy is expensive19 and may cause serious adverse effects,4it would be useful to be able to predict the efficacy of interferonin HCV-1b infection.
The HCV genome encodes structural proteins that constitute theviral particle and nonstructural proteins that are expressedonly in hepatocytes.1 Nonstructural protein 5A (NS5A) is theamino-terminal half of nonstructural protein 5; the carboxyl-terminalhalf (NS5B) contains RNA-dependent RNA polymerase that replicatesthe HCV RNA genome.13 The function of NS5A is not known. Recently,using comparative analysis of the full-length HCV genome,20we showed that a small region of NS5A (NS5A2209–2248)of HCV-1b is associated with sensitivity to interferon. Thenumbering of the amino acid sequence, 2209 to 2248, was basedon that of HCV-J, a strain of HCV-1b, whose complete genomicsequence has been determined.21 In the interferon-resistantstrains that remained after therapy, the NS5A2209–2248sequence was the same as that in the prototypical HCV-1b strains(HCV-J, HC-J4,22 and HCV-JTa23), whereas interferon-sensitivestrains had multiple amino acid substitutions in this region.In that study, interferon-resistant HCV-1b sequences were determinedonly after interferon therapy. Thus, we did not evaluate theimportance of the NS5A2209–2248 sequences present beforetreatment with respect to the prediction of the efficacy ofinterferon. Other clinical factors that may influence the efficacyof interferon, such as serum HCV RNA concentrations16 or histologicfactors affecting the liver,8 have also not been evaluated simultaneouslywith the NS5A2209–2248 region. Therefore, we tested thehypothesis that the NS5A2209–2248 sequence present beforetreatment predicts the response to interferon therapy in patientsinfected with HCV-1b. We also investigated the relation amongthe response to interferon, pretreatment NS5A2209–2248sequences, and other clinical factors.
Methods
Patients
We retrospectively analyzed patients with chronic HCV-1b infectionwho had been treated with interferon alfa between January 1992and December 1993. During this period, we treated 107 patients(67 men and 40 women) who were positive for anti-HCV antibodieson a second-generation assay (Ortho Diagnostic Systems, Raritan,N.J.) and for HCV RNA on the basis of a nested reverse-transcriptionpolymerase chain reaction (PCR) targeted to the 5' noncodingregion.24 All patients had detectable HCV RNA with the 1b genotype,as determined by a mixed-primer PCR targeted to the core regionof the HCV genome.25 We studied 84 of these patients (57 menand 27 women).
To be eligible for the study, the patients had to have biopsy-provedchronic hepatitis, to have received interferon alfa for sixmonths in a dose of 6 million to 10 million units intramuscularlythree times a week (total dose, 516 million to 880 million units),and to have been followed for at least six months before andafter therapy. Twenty-two patients had received recombinantinterferon alfa-2a (Roferon-A, Hoffmann–LaRoche, Basel,Switzerland), 38 recombinant interferon alfa-2b (Intron A, Schering-Plough,Kenilworth, N.J.), and 24 human lymphoblastoid interferon alfa(Sumiferon, Sumitomo Pharmaceuticals, Osaka, Japan). Patientswith a positive test for serum hepatitis B surface antigen,coinfection with other HCV genotypes, histologic findings ofliver cirrhosis, other causes of hepatocellular injury (suchas alcoholism, autoimmune hepatitis, primary biliary cirrhosis,or a history of treatment with hepatotoxic drugs), and a needfor hemodialysis were excluded. The amino acid sequences ofNS5A in five patients were included in our earlier report,21but no other clinical or virologic information was given (thesepatients were identified as 12, 13, 14, 17, and 18 in the previousreport and are referred to as patients 76, 78, 52, 73, and 84,respectively, in this report).
The protocol for interferon treatment of chronic hepatitis Cfollowed the guidelines approved by National Health Insuranceof Japan and was in accordance with the Helsinki Declarationof 1975, as revised in 1983. Written informed consent was obtainedfrom all patients before they underwent liver biopsy and receivedinterferon therapy.
Analytic Methods
The following factors were analyzed to determine whether theywere related to the efficacy of interferon: age, sex, historyof transfusion, duration of infection, stage of fibrosis onliver biopsy, total dose of interferon, type of interferon given,pretreatment serum alanine aminotransferase level, serum HCVRNA level, and amino acid sequence of NS5A2209–2248 beforetreatment. The duration of infection was estimated as the intervalfrom blood transfusion to interferon therapy in 28 patientswith a history of blood transfusion. The remaining 56 patientshad sporadic infection without any identifiable source of transmissionof HCV, such as occupational exposure to blood or blood productsor intravenous-drug abuse, and these patients were excludedfrom the analysis of the duration of infection. Liver-biopsyspecimens were evaluated blindly by an independent interpreteraccording to the stage of fibrosis (mild, moderate, or severe).26Serum HCV RNA levels were determined by a branched-chain DNAassay27 (Quantiplex HCV RNA, Chiron, Emeryville, Calif.). Thelimit of detection of this assay was 0.5 million genome equivalentsper milliliter.
Patients were monitored monthly with serial determinations ofalanine aminotransferase. Serum was tested for HCV RNA justbefore therapy was started and every three months thereafterwith the use of nested reverse-transcription PCR targeted tothe 5' noncoding region, the detection limit of which was 100copies of viral genome per milliliter of serum.28 Patients wereconsidered to have had a complete response to interferon ifserum alanine aminotransferase levels were normal for six monthsafter therapy, with no evidence of serum HCV RNA on nested reverse-transcriptionPCR at the cessation of treatment and three and six months thereafter.Otherwise, patients were considered to have had no response.To ensure the optimal detection and quantitation of HCV RNA,29serum was separated from blood samples within two hours afterthey were obtained and then stored at -80°C without thawinguntil use.
Nucleotide Sequencing of the NS5A Gene
Extraction of RNA from serum and reverse-transcription PCR wereperformed as described previously.30 The PCR primers and sequencingprimers were synthesized with a DNA synthesizer (model 391,Applied Biosystems Japan, Chiba, Japan). To determine the nucleotidesequence of the NS5A region, we amplified nucleotides 6703 to7320 (numbered on the basis of the sequence of HCV-J) of HCVcomplementary DNA using the outer set of primers. One microliterof the first PCR product was transferred to the second PCR reactionalong with nested 5' and 3' primers. An M13 forward primer (5'TGTAAAACGACGGCCAGT3')and an M13 reverse primer (5'CAGGAAACAGCTATGACC3') were attachedto the 5' terminal of the 5' and 3' nested primers, respectively,to facilitate direct sequencing by an automated DNA sequencer(model 373S, Applied Biosystems Japan). Both strands of thePCR products were sequenced with the Prism dye termination kit(Applied Biosystems Japan), according to the manufacturer'sinstructions. The sequencing primer was the M13 forward primerfor the sense strand and the M13 reverse primer for the antisensestrand. The resulting amino acid sequences of NS5A2209–2248were compared with the NS5A2209–2248 sequence identifiedin HCV-J.
The sequences of the primers used for the nested PCR were asfollows: 5' outer set, 5'TGGATGGAGTGCGGTTGCACAGGTA3' (nucleotides6703 to 6727); 3' outer set, 5'TCTTTCTCCGTGGAGGTGGTATTGG3' (nucleotides7296 to 7320); 5' inner set, 5'TGTAAAACGACGGCCAGTCAGGTACGCTCCGGCGTGCA3'(nucleotides6722 to 6741), with the sequence of the M13 forward primer underlined;and 3' inner set, 5'CAGGAAACAGCTATGACCGGGGCCTTGGTAGGTGGCAA3'(nucleotides7275 to 7294), with the sequence of the M13 reverse primer underlined.
Statistical Analysis
Categorical data were compared by the chi-square test or Fisher'sexact test. Distributions of continuous variables were analyzedby the Mann–Whitney U test or Student's t-test with twogroups (i.e., no response and complete response), by Kruskal–Wallistest or parametric analysis of variance with adjustment formultiple comparison by Scheffé's method with three groups(i.e., wild, intermediate, and mutant types of NS5A2209–2248),as appropriate, with Statview 4.0 software (Abacus Concepts,Berkeley, Calif.). Multivariate analysis was performed by multiplelogistic-regression analysis (JMP program, SAS Institute, Cary,N.C.). All tests of significance were two-tailed, with P valuesof less than 0.05 considered to indicate statistical significance.
Results
Twenty-one of the 84 patients (25 percent) had complete responses,whereas 63 (75 percent) had no response (Table 1). Patientswith complete responses had more changes in the NS5A2209–2248sequence than those with no response (median number of changes,5 vs. 1; P<0.001). They also had lower serum HCV RNA levelsbefore treatment, as determined by a branched-chain DNA assay(median, <0.5 million vs. 4.4 million genome equivalentsper milliliter; P<0.001). There were no statistically significantdifferences between groups in the other variables examined.
Table 1. Clinical Characteristics of 84 Patients with Chronic Hepatitis C, According to Their Responses to Interferon Therapy.
The amino acid sequences of NS5A2209–2248 in the 84 patientsare shown in Figure 1. Thirty patients (36 percent) had thewild-type sequence, with no amino acid changes; 16 (19 percent)had the mutant type, with 4 to 11 amino acid changes; and 38(45 percent) had an intermediate type, with 1 to 3 amino acidchanges. All 16 patients with the mutant type of NS5A2209–2248sequence had complete responses, whereas all 30 with the wildtype had no response (P<0.001). Thirty-three of the 38 patientswith the intermediate type of NS5A2209–2248 sequence hadno response (P<0.001 for the comparison with the patientswith the mutant type).
Figure 1. Sequence of Amino Acid Residues 2209 to 2248 in Nonstructural Protein 5A (NS5A2209–2248) of HCV in 84 Patients Infected with HCV-1b and Treated with Interferon Alfa.
Amino acid residues are indicated by the standard single-letter codes, and dashes indicate residues identical to those in HCV-J, a strain of HCV-1b whose genomic sequence has been determined.21 The NS5A2209–2248 sequences of two other HCV-1b strains (HC-J4 and HCV-JTa) whose sequences have been published are shown at the top. The sequences are classified into three types: wild, with no amino acid substitutions; intermediate, with 1 to 3 amino acid substitutions; and mutant, with 4 to 11 amino acid substitutions. The outcome of interferon therapy is shown on the right side. The vertical bar in the bottom-most sequence indicates the position of the insertion shown below the bar. The sequences for Patients 1 through 84 are shown consecutively.
Clinical variables were analyzed according to the type of NS5A2209–2248sequence (Table 2). Serum HCV RNA levels before treatment weresignificantly lower in the patients with the mutant type thanin those with the wild type (median, <0.5 million vs. 4.7million genome equivalents per milliliter; P<0.001) or theintermediate type (median, 4.0 million genome equivalents permilliliter; P<0.001). The other variables examined were notsignificantly different among the three groups.
Table 2. Clinical Characteristics of 84 patients with Chronic Hepatitis C, According to the Type of NS5A2209–2248 Sequence Identified.
The relations among serum HCV RNA levels, NS5A2209–2248types, and responses to interferon are shown in Figure 2. The63 percent rate of complete response in the 24 patients withHCV RNA levels below 0.5 million genome equivalents per milliliterwas significantly higher than the rate of 10 percent (P<0.001)in the 60 patients with HCV RNA levels of at least 0.5 milliongenome equivalents per milliliter. However, three patients withthe mutant type of NS5A2209–2248 had complete responsesdespite having HCV RNA levels of at least 0.5 million genomeequivalents per milliliter, and six patients with the wild typehad no response despite having HCV RNA levels below 0.5 milliongenome equivalents per milliliter. In the patients with theintermediate type of NS5A2209–2248 sequence, there wereno significant differences between the 33 patients with no responsesto interferon and the 5 patients with complete responses withrespect to serum HCV RNA levels (median, 4.1 million vs. 0.8million genome equivalents per milliliter; P = 0.31), the numberof amino acid changes in NS5A2209–2248 (median, 1 in bothgroups; P = 0.69) (Figure 1), or other variables (data not shown).
Figure 2. Serum HCV RNA Levels in Relation to the Type of NS5A2209–2248 Sequence Present before Treatment and the Response to Interferon Therapy.
Serum levels of HCV RNA were significantly lower in patients with the mutant type of NS5A2209–2248 than in those with the wild type or the intermediate type. The horizontal bar in each column indicates the median. The broken line indicates the limit of detection of the branched-chain DNA assay.
We used multiple logistic-regression analysis to examine a varietyof variables (Table 3) that might contribute to a complete responseto interferon. Serum HCV RNA levels were stratified into threecategories: values below 0.5 million genome equivalents permilliliter (the limit of detection), values of 0.5 million to15 million genome equivalents per milliliter, and values above15 million genome equivalents per milliliter. The number ofamino acid changes in NS5A2209–2248 was the only variableassociated with an independent effect on the outcome of interferontherapy (odds ratio, 5.3; 95 percent confidence interval, 1.6to 18; P = 0.007). Although serum HCV RNA levels were correlatedwith the response to interferon and the number of amino acidchanges in NS5A2209–2248 in univariate analyses, in multivariateanalyses they were not an independent predictor of the responseto interferon, even when patients with HCV RNA levels below0.5 million genome equivalents per milliliter were comparedwith patients with levels above 15 million genome equivalentsper milliliter (P = 0.23).
Table 3. Multivariate Analysis of the Effect of Variables on the Response to Interferon.
Discussion
We found a significant correlation between the response to interferonin patients with chronic HCV-1b infection and the number ofamino acid substitutions that were present before therapy ina small region of NS5A. All patients with 4 to 11 amino acidchanges in the NS5A2209–2248 sequence of HCV-1b (mutanttype) had complete responses to interferon therapy, whereasall the patients with no amino acid changes (wild type) and87 percent of those with 1 to 3 amino acid changes (intermediatetype) had no responses. Thus, interferon therapy as currentlyoffered is insufficient for patients with interferon-resistantHCV-1b with wild-type or intermediate-type NS5A2209–2248sequences.
Of the various clinical variables examined, the number of aminoacid substitutions in NS5A2209–2248 was the only independentpredictor of the response to interferon. Among patients infectedwith the same genotype of HCV, those with higher serum HCV RNAlevels are more resistant to interferon.10,14,27,31 In our study,univariate analysis confirmed the relation between serum HCVRNA levels and the response to interferon; however, multivariateanalysis showed that the serum HCV RNA level was not an independentpredictor. Our data suggest that serum HCV RNA levels are indirectlyassociated with the response to interferon through their relationto the sequence of NS5A2209–2248 and that the NS5A2209–2248sequence itself is a more accurate predictor of response.
The mechanism by which NS5A2209–2248 affects the responseto interferon or serum HCV RNA level is not known. The relationbetween the type of NS5A2209–2248 sequence and the HCVRNA level suggests that NS5A2209–2248 has an importantrole in HCV replication. Thus, mutations in NS5A2209–2248may suppress the replication of HCV and increase susceptibilityto interferon. It was recently reported that amino acid residues2200 to 2250, which encompass NS5A2209–2248, are essentialfor the phosphorylation of NS5A.32 Alternatively, NS5A2209–2248may be a direct target of antiviral proteins induced by interferon.
Supported by grants in aid (05454243 and 06670525) from theMinistry of Education, Science, Sports, and Culture and by agrant from the Viral Hepatitis Research Foundation.
Source Information
From the Second Department of Internal Medicine (N.E., I.S., Y.A., M.K., T.M., C.Y., Y.O., F.M., C.S.) and Division of Health Science (C.S.), Faculty of Medicine, Tokyo Medical and Dental University, and the Department of Internal Medicine, Musashino Red Cross Hospital (N.I.) — both in Tokyo, Japan.
Address reprint requests to Dr. Sato at the Second Department of Internal Medicine, Faculty of Medicine, Tokyo Medical and Dental University, 1-5-45 Yushima, Bunkyo-ku, Tokyo 113, Japan.
References
Houghton M, Weiner A, Han J, Kuo G, Choo QL. Molecular biology of the hepatitis C viruses: implications for diagnosis, development and control of viral disease. Hepatology 1991;14:381-388. [CrossRef][Medline]
Choo QL, Kuo G, Weiner AJ, Overby LR, Bradley DW, Houghton M. Isolation of a cDNA clone derived from a blood-borne non-A, non-B viral hepatitis genome. Science 1989;244:359-362. [Free Full Text]
Kiyosawa K, Sodeyama T, Tanaka E, et al. Interrelationship of blood transfusion, non-A, non-B hepatitis and hepatocellular carcinoma: analysis by detection of antibody to hepatitis C virus. Hepatology 1990;12:671-675. [Medline]
Hoofnagle JH. Therapy of acute and chronic viral hepatitis. Adv Intern Med 1994;39:241-275. [Medline]
Simmonds P. Variability of hepatitis C virus. Hepatology 1995;21:570-583. [CrossRef][Medline]
Takada N, Takase S, Enomoto N, Takada A, Date T. Clinical backgrounds of the patients having different types of hepatitis C virus genomes. J Hepatol 1992;14:35-40. [Erratum, J Hepatol 1992;14:435.] [CrossRef][Medline]
Yoshioka K, Kakumu S, Wakita T, et al. Detection of hepatitis C virus by polymerase chain reaction and response to interferon-alpha therapy: relationship to genotypes of hepatitis C virus. Hepatology 1992;16:293-299. [Medline]
Mita E, Hayashi N, Hagiwara H, et al. Predicting interferon therapy efficacy from hepatitis C virus genotype and RNA titer. Dig Dis Sci 1994;39:977-982. [CrossRef][Medline]
Hino K, Sainokami S, Shimoda K, et al. Genotypes and titers of hepatitis C virus for predicting response to interferon in patients with chronic hepatitis C. J Med Virol 1994;42:299-305. [Medline]
Tsubota A, Chayama K, Ikeda K, et al. Factors predictive of response to interferon-alpha therapy in hepatitis C virus infection. Hepatology 1994;19:1088-1094. [CrossRef][Medline]
Enomoto N, Takada A, Nakao T, Date T. There are two major types of hepatitis C virus in Japan. Biochem Biophys Res Commun 1990;170:1021-1025. [CrossRef][Medline]
Nakao T, Enomoto N, Takada N, Takada A, Date T. Typing of hepatitis C virus genomes by restriction fragment length polymorphism. J Gen Virol 1991;72:2105-2112. [Free Full Text]
van Doorn LJ. Review: molecular biology of the hepatitis C virus. J Med Virol 1994;43:345-356. [Medline]
Mahaney K, Tedeschi V, Maertens G, et al. Genotypic analysis of hepatitis C virus in American patients. Hepatology 1994;20:1405-1411. [Medline]
van der Poel CL, Cuypers HT, Reesink HW. Hepatitis C virus six years on. Lancet 1994;344:1475-1479. [CrossRef][Medline]
Nousbaum J-P, Pol S, Nalpas B, Landais P, Berthelot P, Brechot C. Hepatitis C virus type 1b (II) infection in France and Italy. Ann Intern Med 1995;122:161-168. [Free Full Text]
Silini E, Bono F, Cividini A, et al. Differential distribution of hepatitis C virus genotypes in patients with and without liver function abnormalities. Hepatology 1995;21:285-290. [CrossRef][Medline]
Takada N, Takase S, Takada A, Date T. Differences in the hepatitis C virus genotypes in different countries. J Hepatol 1993;17:277-283. [CrossRef][Medline]
Davis GL. Recombinant alpha-interferon treatment of non-A, non-B (type C) hepatitis: review of studies and recommendations for treatment. J Hepatol 1990;11:Suppl 1:S72-S77.
Enomoto N, Sakuma I, Asahina Y, et al. Comparison of full-length sequences of interferon-sensitive and resistant hepatitis C virus 1b: sensitivity to interferon is conferred by amino acid substitutions in the NS5A region. J Clin Invest 1995;96:224-230.
Kato N, Hijikata M, Ootsuyama Y, et al. Molecular cloning of the human hepatitis C virus genome from Japanese patients with non-A, non-B hepatitis. Proc Natl Acad Sci U S A 1990;87:9524-9528. [Free Full Text]
Okamoto H, Kojima M, Okada S, et al. Genetic drift of hepatitis C virus during an 8.2-year infection in a chimpanzee: variability and stability. Virology 1992;190:894-899. [CrossRef][Medline]
Tanaka T, Kato N, Nakagawa M, et al. Molecular cloning of hepatitis C virus genome from a single Japanese carrier: sequence variation within the same individual and among infected individuals. Virus Res 1992;23:39-53. [CrossRef][Medline]
Okamoto H, Okada S, Sugiyama Y, et al. Detection of hepatitis C virus RNA by a two-stage polymerase chain reaction with two pairs of primers deduced from the 5'-noncoding region. Jpn J Exp Med 1990;60:215-222. [Medline]
Okamoto H, Sugiyama Y, Okada S, et al. Typing hepatitis C virus by polymerase chain reaction with type-specific primers: application to clinical surveys and tracing infectious sources. J Gen Virol 1992;73:673-679. [Free Full Text]
Desmet VJ, Gerber M, Hoofnagle JH, Manns M, Scheuer PJ. Classification of chronic hepatitis: diagnosis, grading and staging. Hepatology 1994;19:1513-1520. [CrossRef][Medline]
Lau JY, Davis GL, Kniffen J, et al. Significance of serum hepatitis C virus RNA levels in chronic hepatitis C. Lancet 1993;341:1501-1504. [Erratum, Lancet 1993;342:504.] [CrossRef][Medline]
Sakamoto N, Enomoto N, Kurosaki M, Marumo F, Sato C. Detection and quantification of hepatitis C virus RNA replication in the liver. J Hepatol 1994;20:593-597. [CrossRef][Medline]
Davis GL, Lau JY, Urdea MS, et al. Quantitative detection of hepatitis C virus RNA with a solid-phase amplification method: definition of optimal conditions for specimen collection and clinical application in interferon-treated patients. Hepatology 1994;19:1337-1341. [CrossRef][Medline]
Enomoto N, Kurosaki M, Tanaka Y, Marumo F, Sato C. Fluctuation of hepatitis C virus quasispecies in persistent infection and interferon treatment revealed by single-strand conformation polymorphism analysis. J Gen Virol 1994;75:1361-1369. [Free Full Text]
Hagiwara H, Hayashi N, Mita E, et al. Quantitative analysis of hepatitis C virus RNA in serum during interferon alfa therapy. Gastroenterology 1993;104:877-883. [Medline]
Tanji Y, Kaneko T, Satoh S, Shimotohno K. Phosphorylation of hepatitis C virus-encoded nonstructural protein NS5A. J Virol 1995;69:3980-3986. [Abstract]
Xu, Z., Fan, X., Xu, Y., Di Bisceglie, A. M.
(2008). Comparative Analysis of Nearly Full-Length Hepatitis C Virus Quasispecies from Patients Experiencing Viral Breakthrough during Antiviral Therapy: Clustered Mutations in Three Functional Genes, E2, NS2, and NS5a. J. Virol.
82: 9417-9424
[Abstract][Full Text]
Kimura, T., Imamura, M., Hiraga, N., Hatakeyama, T., Miki, D., Noguchi, C., Mori, N., Tsuge, M., Takahashi, S., Fujimoto, Y., Iwao, E., Ochi, H., Abe, H., Maekawa, T., Arataki, K., Tateno, C., Yoshizato, K., Wakita, T., Okamoto, T., Matsuura, Y., Chayama, K.
(2008). Establishment of an infectious genotype 1b hepatitis C virus clone in human hepatocyte chimeric mice. J. Gen. Virol.
89: 2108-2113
[Abstract][Full Text]
Munoz de Rueda, P., Casado, J., Paton, R., Quintero, D., Palacios, A., Gila, A., Quiles, R., Leon, J., Ruiz-Extremera, A., Salmeron, J.
(2008). Mutations in E2-PePHD, NS5A-PKRBD, NS5A-ISDR, and NS5A-V3 of Hepatitis C Virus Genotype 1 and Their Relationships to Pegylated Interferon-Ribavirin Treatment Responses. J. Virol.
82: 6644-6653
[Abstract][Full Text]
Torres-Puente, M., Cuevas, J. M., Jimenez-Hernandez, N., Bracho, M. A., Garcia-Robles, I., Carnicer, F., del Olmo, J., Ortega, E., Moya, A., Gonzalez-Candelas, F.
(2007). Contribution of insertions and deletions to the variability of hepatitis C virus populations. J. Gen. Virol.
88: 2198-2203
[Abstract][Full Text]
Wohnsland, A., Hofmann, W. P., Sarrazin, C.
(2007). Viral Determinants of Resistance to Treatment in Patients with Hepatitis C. Clin. Microbiol. Rev.
20: 23-38
[Abstract][Full Text]
Garcia, M. A., Gil, J., Ventoso, I., Guerra, S., Domingo, E., Rivas, C., Esteban, M.
(2006). Impact of Protein Kinase PKR in Cell Biology: from Antiviral to Antiproliferative Action. Microbiol. Mol. Biol. Rev.
70: 1032-1060
[Abstract][Full Text]
Puig-Basagoiti, F., Forns, X., Furcic, I., Ampurdanes, S., Gimenez-Barcons, M., Franco, S., Sanchez-Tapias, J. M., Saiz, J.-C.
(2005). Dynamics of hepatitis C virus NS5A quasispecies during interferon and ribavirin therapy in responder and non-responder patients with genotype 1b chronic hepatitis C. J. Gen. Virol.
86: 1067-1075
[Abstract][Full Text]
Chambers, T. J., Fan, X., Droll, D. A., Hembrador, E., Slater, T., Nickells, M. W., Dustin, L. B., DiBisceglie, A. M.
(2005). Quasispecies Heterogeneity within the E1/E2 Region as a Pretreatment Variable during Pegylated Interferon Therapy of Chronic Hepatitis C Virus Infection. J. Virol.
79: 3071-3083
[Abstract][Full Text]
Pfeiffer, J. K., Kirkegaard, K.
(2005). Ribavirin Resistance in Hepatitis C Virus Replicon-Containing Cell Lines Conferred by Changes in the Cell Line or Mutations in the Replicon RNA. J. Virol.
79: 2346-2355
[Abstract][Full Text]
Fimia, G. M., Evangelisti, C., Alonzi, T., Romani, M., Fratini, F., Paonessa, G., Ippolito, G., Tripodi, M., Piacentini, M.
(2004). Conventional Protein Kinase C Inhibition Prevents Alpha Interferon-Mediated Hepatitis C Virus Replicon Clearance by Impairing STAT Activation. J. Virol.
78: 12809-12816
[Abstract][Full Text]
Tellinghuisen, T. L., Marcotrigiano, J., Gorbalenya, A. E., Rice, C. M.
(2004). The NS5A Protein of Hepatitis C Virus Is a Zinc Metalloprotein. J. Biol. Chem.
279: 48576-48587
[Abstract][Full Text]
Macdonald, A., Harris, M.
(2004). Hepatitis C virus NS5A: tales of a promiscuous protein. J. Gen. Virol.
85: 2485-2502
[Abstract][Full Text]
Pascu, M, Martus, P, Hohne, M, Wiedenmann, B, Hopf, U, Schreier, E, Berg, T
(2004). Sustained virological response in hepatitis C virus type 1b infected patients is predicted by the number of mutations within the NS5A-ISDR: a meta-analysis focused on geographical differences. Gut
53: 1345-1351
[Abstract][Full Text]
Kalinina, O., Norder, H., Magnius, L. O.
(2004). Full-length open reading frame of a recombinant hepatitis C virus strain from St Petersburg: proposed mechanism for its formation. J. Gen. Virol.
85: 1853-1857
[Abstract][Full Text]
Martell, M., Briones, C., de Vicente, A., Piron, M., Esteban, J. I., Esteban, R., Guardia, J., Gomez, J.
(2004). Structural analysis of hepatitis C RNA genome using DNA microarrays. Nucleic Acids Res
32: e90-e90
[Abstract][Full Text]
Cooray, S.
(2004). The pivotal role of phosphatidylinositol 3-kinase-Akt signal transduction in virus survival. J. Gen. Virol.
85: 1065-1076
[Abstract][Full Text]
Taguchi, T., Nagano-Fujii, M., Akutsu, M., Kadoya, H., Ohgimoto, S., Ishido, S., Hotta, H.
(2004). Hepatitis C virus NS5A protein interacts with 2',5'-oligoadenylate synthetase and inhibits antiviral activity of IFN in an IFN sensitivity-determining region-independent manner. J. Gen. Virol.
85: 959-969
[Abstract][Full Text]
Coito, C., Diamond, D. L., Neddermann, P., Korth, M. J., Katze, M. G.
(2004). High-Throughput Screening of the Yeast Kinome: Identification of Human Serine/Threonine Protein Kinases That Phosphorylate the Hepatitis C Virus NS5A Protein. J. Virol.
78: 3502-3513
[Abstract][Full Text]
Shimakami, T., Hijikata, M., Luo, H., Ma, Y. Y., Kaneko, S., Shimotohno, K., Murakami, S.
(2004). Effect of Interaction between Hepatitis C Virus NS5A and NS5B on Hepatitis C Virus RNA Replication with the Hepatitis C Virus Replicon. J. Virol.
78: 2738-2748
[Abstract][Full Text]
Zeuzem, S.
(2004). Heterogeneous Virologic Response Rates to Interferon-Based Therapy in Patients with Chronic Hepatitis C: Who Responds Less Well?. ANN INTERN MED
140: 370-381
[Abstract][Full Text]
Ye, J., Wang, C., Sumpter, R. Jr., Brown, M. S., Goldstein, J. L., Gale, M. Jr.
(2003). Disruption of hepatitis C virus RNA replication through inhibition of host protein geranylgeranylation. Proc. Natl. Acad. Sci. USA
100: 15865-15870
[Abstract][Full Text]
Guo, J.-T., Zhu, Q., Seeger, C.
(2003). Cytopathic and Noncytopathic Interferon Responses in Cells Expressing Hepatitis C Virus Subgenomic Replicons. J. Virol.
77: 10769-10779
[Abstract][Full Text]
Ogata, S., Huab Florese, R., Nagano-Fujii, M., Hidajat, R., Deng, L., Ku, Y., Yoon, S., Saito, T., Kawata, S., Hotta, H.
(2003). Identification of Hepatitis C Virus (HCV) Subtype 1b Strains That Are Highly, or Only Weakly, Associated with Hepatocellular Carcinoma on the Basis of the Secondary Structure of an Amino-Terminal Portion of the HCV NS3 Protein. J. Clin. Microbiol.
41: 2835-2841
[Abstract][Full Text]
Geiss, G. K., Carter, V. S., He, Y., Kwieciszewski, B. K., Holzman, T., Korth, M. J., Lazaro, C. A., Fausto, N., Bumgarner, R. E., Katze, M. G.
(2003). Gene Expression Profiling of the Cellular Transcriptional Network Regulated by Alpha/Beta Interferon and Its Partial Attenuation by the Hepatitis C Virus Nonstructural 5A Protein. J. Virol.
77: 6367-6375
[Abstract][Full Text]
Elazar, M., Cheong, K. H., Liu, P., Greenberg, H. B., Rice, C. M., Glenn, J. S.
(2003). Amphipathic Helix-Dependent Localization of NS5A Mediates Hepatitis C Virus RNA Replication. J. Virol.
77: 6055-6061
[Abstract][Full Text]
Dimitrova, M., Imbert, I., Kieny, M. P., Schuster, C.
(2003). Protein-Protein Interactions between Hepatitis C Virus Nonstructural Proteins. J. Virol.
77: 5401-5414
[Abstract][Full Text]
Lam, A. M. I., Keeney, D., Eckert, P. Q., Frick, D. N.
(2003). Hepatitis C Virus NS3 ATPases/Helicases from Different Genotypes Exhibit Variations in Enzymatic Properties. J. Virol.
77: 3950-3961
[Abstract][Full Text]
Zech, B., Kurtenbach, A., Krieger, N., Strand, D., Blencke, S., Morbitzer, M., Salassidis, K., Cotten, M., Wissing, J., Obert, S., Bartenschlager, R., Herget, T., Daub, H.
(2003). Identification and characterization of amphiphysin II as a novel cellular interaction partner of the hepatitis C virus NS5A protein. J. Gen. Virol.
84: 555-560
[Abstract][Full Text]
Bukh, J., Pietschmann, T., Lohmann, V., Krieger, N., Faulk, K., Engle, R. E., Govindarajan, S., Shapiro, M., St. Claire, M., Bartenschlager, R.
(2002). Mutations that permit efficient replication of hepatitis C virus RNA in Huh-7 cells prevent productive replication in chimpanzees. Proc. Natl. Acad. Sci. USA
99: 14416-14421
[Abstract][Full Text]
Rivas-Estilla, A. M., Svitkin, Y., Lopez Lastra, M., Hatzoglou, M., Sherker, A., Koromilas, A. E.
(2002). PKR-Dependent Mechanisms of Gene Expression from a Subgenomic Hepatitis C Virus Clone. J. Virol.
76: 10637-10653
[Abstract][Full Text]
Sarrazin, C., Herrmann, E., Bruch, K., Zeuzem, S.
(2002). Hepatitis C Virus Nonstructural 5A Protein and Interferon Resistance: a New Model for Testing the Reliability of Mutational Analyses. J. Virol.
76: 11079-11090
[Abstract][Full Text]
Ogata, S., Nagano-Fujii, M., Ku, Y., Yoon, S., Hotta, H.
(2002). Comparative Sequence Analysis of the Core Protein and Its Frameshift Product, the F Protein, of Hepatitis C Virus Subtype 1b Strains Obtained from Patients with and without Hepatocellular Carcinoma. J. Clin. Microbiol.
40: 3625-3630
[Abstract][Full Text]
He, Y., Nakao, H., Tan, S.-L., Polyak, S. J., Neddermann, P., Vijaysri, S., Jacobs, B. L., Katze, M. G.
(2002). Subversion of Cell Signaling Pathways by Hepatitis C Virus Nonstructural 5A Protein via Interaction with Grb2 and P85 Phosphatidylinositol 3-Kinase. J. Virol.
76: 9207-9217
[Abstract][Full Text]
Brassard, D. L., Grace, M. J., Bordens, R. W.
(2002). Interferon-{alpha} as an immunotherapeutic protein. J. Leukoc. Biol.
71: 565-581
[Abstract][Full Text]
Shirota, Y., Luo, H., Qin, W., Kaneko, S., Yamashita, T., Kobayashi, K., Murakami, S.
(2002). Hepatitis C Virus (HCV) NS5A Binds RNA-dependent RNA Polymerase (RdRP) NS5B and Modulates RNA-dependent RNA Polymerase Activity. J. Biol. Chem.
277: 11149-11155
[Abstract][Full Text]
Pietschmann, T., Lohmann, V., Kaul, A., Krieger, N., Rinck, G., Rutter, G., Strand, D., Bartenschlager, R.
(2002). Persistent and Transient Replication of Full-Length Hepatitis C Virus Genomes in Cell Culture. J. Virol.
76: 4008-4021
[Abstract][Full Text]
Pflugheber, J., Fredericksen, B., Sumpter, R. Jr., Wang, C., Ware, F., Sodora, D. L., Gale, M. Jr.
(2002). Regulation of PKR and IRF-1 during hepatitis C virus RNA replication. Proc. Natl. Acad. Sci. USA
10.1073/pnas.062055699v1
[Abstract][Full Text]
Farci, P., Strazzera, R., Alter, H. J., Farci, S., Degioannis, D., Coiana, A., Peddis, G., Usai, F., Serra, G., Chessa, L., Diaz, G., Balestrieri, A., Purcell, R. H.
(2002). Early changes in hepatitis C viral quasispecies during interferon therapy predict the therapeutic outcome. Proc. Natl. Acad. Sci. USA
99: 3081-3086
[Abstract][Full Text]
Ikeda, M., Yi, M., Li, K., Lemon, S. M.
(2002). Selectable Subgenomic and Genome-Length Dicistronic RNAs Derived from an Infectious Molecular Clone of the HCV-N Strain of Hepatitis C Virus Replicate Efficiently in Cultured Huh7 Cells. J. Virol.
76: 2997-3006
[Abstract][Full Text]
Lusida, M. I., Nagano-Fujii, M., Nidom, C. A., Soetjipto, , Handajani, R., Fujita, T., Oka, K., Hotta, H.
(2001). Correlation between Mutations in the Interferon Sensitivity-Determining Region of NS5A Protein and Viral Load of Hepatitis C Virus Subtypes 1b, 1c, and 2a. J. Clin. Microbiol.
39: 3858-3864
[Abstract][Full Text]
Guo, J.-T., Bichko, V. V., Seeger, C.
(2001). Effect of Alpha Interferon on the Hepatitis C Virus Replicon. J. Virol.
75: 8516-8523
[Abstract][Full Text]
Nakano, I, Fukuda, Y, Katano, Y, Toyoda, H, Hayashi, K, Hayakawa, T, Kumada, T, Nakano, S
(2001). Interferon responsiveness in patients infected with hepatitis C virus 1b differs depending on viral subtype. Gut
49: 263-267
[Abstract][Full Text]
Chung, R. T., He, W., Saquib, A., Contreras, A. M., Xavier, R. J., Chawla, A., Wang, T. C., Schmidt, E. V.
(2001). Hepatitis C virus replication is directly inhibited by IFN-alpha in a full-length binary expression system. Proc. Natl. Acad. Sci. USA
10.1073/pnas.171319698v1
[Abstract][Full Text]
Lauer, G. M., Walker, B. D.
(2001). Hepatitis C Virus Infection. NEJM
345: 41-52
[Full Text]
Polyak, S. J., Khabar, K. S. A., Paschal, D. M., Ezelle, H. J., Duverlie, G., Barber, G. N., Levy, D. E., Mukaida, N., Gretch, D. R.
(2001). Hepatitis C Virus Nonstructural 5A Protein Induces Interleukin-8, Leading to Partial Inhibition of the Interferon-Induced Antiviral Response. J. Virol.
75: 6095-6106
[Abstract][Full Text]
He, Y., Tan, S.-L., Tareen, S. U., Vijaysri, S., Langland, J. O., Jacobs, B. L., Katze, M. G.
(2001). Regulation of mRNA Translation and Cellular Signaling by Hepatitis C Virus Nonstructural Protein NS5A. J. Virol.
75: 5090-5098
[Abstract][Full Text]
Nagayama, K, Enomoto, N, Izumi, N, Kurosaki, M, Miyasaka, Y, Watanabe, H, Itakura, J, Chen, C-H, Tazawa, J, Hoshino, Y, Ikeda, T, Marumo, F, Sato, C
(2001). Sequences in the NS5A protein of hepatitis C virus and the serum alanine aminotransferase response to interferon therapy in Japanese patients. Gut
48: 830-835
[Abstract][Full Text]
Krieger, N., Lohmann, V., Bartenschlager, R.
(2001). Enhancement of Hepatitis C Virus RNA Replication by Cell Culture-Adaptive Mutations. J. Virol.
75: 4614-4624
[Abstract][Full Text]
Frese, M., Pietschmann, T., Moradpour, D., Haller, O., Bartenschlager, R.
(2001). Interferon-{{alpha}} inhibits hepatitis C virus subgenomic RNA replication by an MxA-independent pathway. J. Gen. Virol.
82: 723-733
[Abstract][Full Text]
Lohmann, V., Körner, F., Dobierzewska, A., Bartenschlager, R.
(2001). Mutations in Hepatitis C Virus RNAs Conferring Cell Culture Adaptation. J. Virol.
75: 1437-1449
[Abstract][Full Text]
Blight, K. J., Kolykhalov, A. A., Rice, C. M.
(2000). Efficient Initiation of HCV RNA Replication in Cell Culture. Science
290: 1972-1974
[Abstract][Full Text]
Nousbaum, J.-B., Polyak, S. J., Ray, S. C., Sullivan, D. G., Larson, A. M., Carithers, R. L. Jr., Gretch, D. R.
(2000). Prospective Characterization of Full-Length Hepatitis C Virus NS5A Quasispecies during Induction and Combination Antiviral Therapy. J. Virol.
74: 9028-9038
[Abstract][Full Text]
François, C., Duverlie, G., Rebouillat, D., Khorsi, H., Castelain, S., Blum, H. E., Gatignol, A., Wychowski, C., Moradpour, D., Meurs, E. F.
(2000). Expression of Hepatitis C Virus Proteins Interferes with the Antiviral Action of Interferon Independently of PKR-Mediated Control of Protein Synthesis. J. Virol.
74: 5587-5596
[Abstract][Full Text]
Gale, M. Jr., Tan, S.-L., Katze, M. G.
(2000). Translational Control of Viral Gene Expression in Eukaryotes. Microbiol. Mol. Biol. Rev.
64: 239-280
[Abstract][Full Text]
Chung, K. M., Lee, J., Kim, J.-E., Song, O.-K., Cho, S., Lim, J., Seedorf, M., Hahm, B., Jang, S. K.
(2000). Nonstructural Protein 5A of Hepatitis C Virus Inhibits the Function of Karyopherin beta 3. J. Virol.
74: 5233-5241
[Abstract][Full Text]
Sandres, K., Dubois, M., Pasquier, C., Payen, J. L., Alric, L., Duffaut, M., Vinel, J. P., Pascal, J. P., Puel, J., Izopet, J.
(2000). Genetic Heterogeneity of Hypervariable Region 1 of the Hepatitis C Virus (HCV) Genome and Sensitivity of HCV to Alpha Interferon Therapy. J. Virol.
74: 661-668
[Abstract][Full Text]
Neddermann, P., Clementi, A., De Francesco, R.
(1999). Hyperphosphorylation of the Hepatitis C Virus NS5A Protein Requires an Active NS3 Protease, NS4A, NS4B, and NS5A Encoded on the Same Polyprotein. J. Virol.
73: 9984-9991
[Abstract][Full Text]
Gerotto, M., Sullivan, D. G., Polyak, S. J., Chemello, L., Cavalletto, L., Pontisso, P., Alberti, A., Gretch, D. R.
(1999). Effect of Retreatment with Interferon Alone or Interferon plus Ribavirin on Hepatitis C Virus Quasispecies Diversification in Nonresponder Patients with Chronic Hepatitis C. J. Virol.
73: 7241-7247
[Abstract][Full Text]
Gale, M. Jr., Kwieciszewski, B., Dossett, M., Nakao, H., Katze, M. G.
(1999). Antiapoptotic and Oncogenic Potentials of Hepatitis C Virus Are Linked to Interferon Resistance by Viral Repression of the PKR Protein Kinase. J. Virol.
73: 6506-6516
[Abstract][Full Text]
Taylor, D. R., Shi, S. T., Romano, P. R., Barber, G. N., Lai, M. M.
(1999). Inhibition of the Interferon- Inducible Protein Kinase PKR by HCV E2 Protein. Science
285: 107-110
[Abstract][Full Text]
Tan, S.-L., Nakao, H., He, Y., Vijaysri, S., Neddermann, P., Jacobs, B. L., Mayer, B. J., Katze, M. G.
(1999). NS5A, a nonstructural protein of hepatitis C virus, binds growth factor receptor-bound protein 2 adaptor protein in a Src homology 3 domain/ligand-dependent manner and perturbs mitogenic signaling. Proc. Natl. Acad. Sci. USA
96: 5533-5538
[Abstract][Full Text]
Gale, M. Jr., Blakely, C. M., Kwieciszewski, B., Tan, S.-L., Dossett, M., Tang, N. M., Korth, M. J., Polyak, S. J., Gretch, D. R., Katze, M. G.
(1998). Control of PKR Protein Kinase by Hepatitis C Virus Nonstructural 5A Protein: Molecular Mechanisms of Kinase Regulation. Mol. Cell. Biol.
18: 5208-5218
[Abstract][Full Text]
Reed, K. E., Gorbalenya, A. E., Rice, C. M.
(1998). The NS5A/NS5 Proteins of Viruses from Three Genera of the Family Flaviviridae Are Phosphorylated by Associated Serine/Threonine Kinases. J. Virol.
72: 6199-6206
[Abstract][Full Text]
Polyak, S. J., McArdle, S., Liu, S.-L., Sullivan, D. G., Chung, M., Hofgartner, W. T., Carithers, R. L. Jr., McMahon, B. J., Mullins, J. I., Corey, L., Gretch, D. R.
(1998). Evolution of Hepatitis C Virus Quasispecies in Hypervariable Region 1 and the Putative Interferon Sensitivity-Determining Region during Interferon Therapy and Natural Infection. J. Virol.
72: 4288-4296
[Abstract][Full Text]
Pawlotsky, J.-M., Germanidis, G., Neumann, A. U., Pellerin, M., Frainais, P.-O., Dhumeaux, D.
(1998). Interferon Resistance of Hepatitis C Virus Genotype 1b: Relationship to Nonstructural 5A Gene Quasispecies Mutations. J. Virol.
72: 2795-2805
[Abstract][Full Text]
Casato, M., Agnello, V., Pucillo, L. P., Knight, G. B., Leoni, M., Del Vecchio, S., Mazzilli, C., Antonelli, G., Bonomo, L.
(1997). Predictors of Long-Term Response to High-Dose Interferon Therapy in Type II Cryoglobulinemia Associated With Hepatitis C Virus Infection. Blood
90: 3865-3873
[Abstract][Full Text]
Worman, H. J.
(1997). Molecular biological methods in diagnosis and treatment of liver diseases. Clin. Chem.
43: 1476-1486
[Abstract][Full Text]
Dusheiko, G M, Khakoo, S, Soni, P, Grellier, L
(1996). Fortnightly Review: A rational approach to the management of hepatitis C infection. BMJ
312: 357-364
[Abstract][Full Text]
Pflugheber, J., Fredericksen, B., Sumpter, R. Jr., Wang, C., Ware, F., Sodora, D. L., Gale, M. Jr.
(2002). Regulation of PKR and IRF-1 during hepatitis C virus RNA replication. Proc. Natl. Acad. Sci. USA
99: 4650-4655
[Abstract][Full Text]
Chung, R. T., He, W., Saquib, A., Contreras, A. M., Xavier, R. J., Chawla, A., Wang, T. C., Schmidt, E. V.
(2001). Hepatitis C virus replication is directly inhibited by IFN-alpha in a full-length binary expression system. Proc. Natl. Acad. Sci. USA
98: 9847-9852
[Abstract][Full Text]
Previous
