FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 334:1367-1372 May 23, 1996 Number 21 Next

PDF Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

Complete deficiency of adenosine deaminase causes severe combined immunodeficiency that is inherited as an autosomal recessive trait. The patients present in infancy with recurrent infections, lymphopenia, defective proliferative responses to mitogens, hypogammaglobulinemia, and an inability to mount specific antibody responses. Patients with a low level of residual adenosine deaminase activity have a later onset of clinical disease owing to a slower and sometimes less complete loss of immune function.^1,2,3

Unlike other primary immunodeficiencies caused by defects in lymphocyte signaling pathways,⁴ adenosine deaminase deficiency is a systemic metabolic disorder. The enzymatic defect is expressed in all cells, and therefore the substrates for the enzyme, adenosine and 2'-deoxyadenosine, accumulate in cells of all types.³ Immunodeficiency is thought to occur because immature lymphoid cells are particularly sensitive to the toxic effects of adenosine and 2'-deoxyadenosine. In addition, some patients have neurologic abnormalities that are thought to be due to adenosine deaminase deficiency.⁵ Unlike humans, mice that express no adenosine deaminase die perinatally of severe hepatocellular degeneration.^6,7 Hepatotoxicity in humans has not previously been attributed to adenosine deaminase deficiency. We report a neonate with this deficiency and prolonged hyperbilirubinemia with hepatitis that resolved after the institution of adenosine deaminase–replacement therapy.

Case Report

The patient was born to a healthy mother who was seronegative for the human immunodeficiency virus (HIV) and hepatitis B virus. He was normal at birth, but by the age of three weeks he had thrush, hepatomegaly, and jaundice. The patient's serum total bilirubin concentration was 5 mg per deciliter (86 µmol per liter), and his direct bilirubin concentration was 2.9 mg per deciliter (50 µmol per liter). The serum enzyme activities were as follows: aspartate aminotransferase, 561 IU per liter; alanine aminotransferase, 109 IU per liter; alkaline phosphatase, 528 IU per liter; and lactate dehydrogenase, 1997 IU per liter. The white-cell count was 5100 per cubic millimeter, with an abnormal differential count (61 percent neutrophils, 18 percent monocytes, 16 percent eosinophils, and 5 percent lymphocytes). Diagnostic studies revealed no anatomical explanation for the jaundice; viral and bacterial cultures were negative; and no antibodies to cytomegalovirus, Epstein–Barr virus, or hepatitis viruses A, B, and C were detectable. The sweat chloride concentration was normal. Hepatic radionuclide imaging with megrofenin isotope (Squibb Pharmaceutical, Princeton, N.J.) revealed rapid uptake with delayed excretion.

At the age of seven weeks, the patient weighed 3100 g (less than at birth), and his length and head circumference were below the fifth percentile. He was icteric and had a diffuse, truncal erythematous macular rash, oral and perineal candidiasis, and erythema of the palms and soles. He had tachypnea with scattered rales. The liver was palpable 4 cm below the costal margin; the tip of the spleen was just palpable. No tonsillar tissue was visible, and no lymph nodes were palpable at any site.

The lymphocyte count was 126 cells per cubic millimeter, with low percentages of T cells, B cells, and natural killer cells. The serum immunoglobulin concentrations were low (IgG, 240 mg per deciliter; IgA, 19 mg per deciliter; and IgM, 15 mg per deciliter). There was no in vitro proliferation of peripheral-blood mononuclear cells in response to a panel of mitogens. A skin biopsy revealed no evidence of graft-versus-host disease or infection. In erythrocytes, adenosine deaminase activity was undetectable (normal mean [±SD] activity, 52.3±38.8 nmol per hour per milligram of protein), adenosylhomocysteinase activity was reduced (0.17 nmol per hour per milligram of protein; normal, 4.2±1.9), and the concentration of total deoxyadenosine nucleotides was elevated (709 nmol per milliliter of packed cells; normal, <2). These findings established the diagnosis of adenosine deaminase deficiency.

A percutaneous liver-biopsy specimen showed early giant-cell transformation, with enlarged foamy hepatocytes and portal and lobular eosinophilic infiltrates (Figure 1). There was no evidence of graft-versus-host disease, and no viral inclusions were seen. Immunostaining for herpes simplex virus and cytomegalovirus was negative. Viral cultures of liver, cerebrospinal fluid, nasopharyngeal secretions, stool, urine, and blood were negative, as were serum tests for cytomegalovirus and hepatitis B antigens and a polymerase-chain-reaction (PCR) test for hepatitis C.

View larger version (23K): [in this window] [in a new window]   Figure 1. Liver-Biopsy Specimen from the Patient with Adenosine Deaminase Deficiency, Showing Eosinophilic Infiltrates (Large Arrow), Enlarged Foamy Hepatocytes (Small Arrow), and Bile Stasis (Hematoxylin and Eosin, x160).

 
Methods

Adenosine deaminase complementary DNA (cDNA) and genomic sequences were identified,^8,9 and methods of amplifying the cDNA and genomic segments and of cloning and sequencing PCR products were performed as described previously.^10,11,12,13 The DNA fragments and PCR primer pairs used were as follows: adenosine deaminase cDNA coding region (base pairs [bp] 96 to 1188), 5'CGCGCGAATTCATGGCCCAGACGCCCGCCTTCGAC and 5'GCGCAAGCTTCAGAGGTTCTGCCCTGCAGAGGC; genomic exon 4 (bp 24,787 to 25,481), 5'GTATGCAGTTCCAAAGTAGAGCTG and 5'CAGTTATGAAGTTAGAGCAGGACC; and genomic exons 10 and 11 (bp 30,319 to 31,340), 5'AGGCTGCTGTGAGGATCAAAGGCGGGTGAA and 5'TGCTAGAAGTCCCACAGAAAGCCACACTGG.

The effect of mutations on adenosine deaminase activity was assessed as described elsewhere.^10,12,13 Messenger RNA (mRNA) transcribed in vitro from cDNA subclones was used to prime a rabbit reticulocyte lysate translation system in the presence of methionine labeled with sulfur-35. Aliquots of these reactions containing equal amounts of wild-type translation products and translation products from cDNA samples from the patient (as determined by 10 percent sodium dodecyl sulfate–mercaptoethanol polyacrylamide-gel electrophoresis and fluorography) were subjected to electrophoresis on cellulose acetate and stained for adenosine deaminase activity in situ.¹⁴

Results

The patient had no HLA-matched sibling and was considered a poor candidate for bone marrow transplantation because of hepatitis. Enzyme-replacement therapy was begun with pegademase bovine (polyethylene glycol–modified adenosine deaminase [PEG-ADA], Adagen, Enzon, Piscataway, N.J.; 30 U per kilogram of ideal body weight twice weekly).^{3,15,16,17,18,19} Plasma adenosine deaminase activity rose rapidly to therapeutic levels. Within days after the start of the replacement therapy, the patient's serum aminotransferase and bilirubin concentrations began to fall, paralleling a decrease in the concentration of deoxyadenosine nucleotides in erythrocytes as a percentage of all adenine nucleotides (Figure 2A). The serum bilirubin concentration became normal by day 55 of therapy and remained so subsequently. The improvement in the serum aminotransferase and bilirubin concentrations was followed by improvement in the lymphocyte count and the distribution of subgroups (Figure 2B). The patient is 23 months old at this writing, and his height, weight, and development are normal. He has had no infections other than a few episodes of otitis media. The in vitro proliferative responses of lymphcytes to mitogens and tetanus toxoid have been normal.

View larger version (8K): [in this window] [in a new window]   Figure 2. Responses to Treatment with Pegademase (PEG-ADA). Panel A shows the increase in plasma adenosine deaminase activity and the declines in the proportional concentration of total deoxyadenosine nucleotides (dAXP) in erythrocytes and in concentrations of bilirubin and aspartate aminotransferase (AST) in serum after the start of pegademase therapy. Values for deoxyadenosine nucleotides are expressed as a percentage of all adenine nucleotides (adenosine plus deoxyadenosine) in red cells, determined as described elsewhere.10,15 To convert values for bilirubin to micromoles per liter, multiply by 17.1. Panel B shows the recovery of lymphocyte counts during treatment. For comparison, the proportional decline in deoxyadenosine nucleotides in erythrocytes is plotted as in Panel A.

 
Sequencing of adenosine deaminase cDNA subclones prepared from a B-lymphoblastoid cell line identified two missense mutations (data not shown). One group of subclones had a novel guanine-to-thymidine (G-to-T) mutation at position 316 (221 bp from the starting site of translation) that changed a glycine (GGC) to a valine (GTC) at codon 74 and eliminated a BbvI restriction site in exon 4. All the cDNA subclones with the wild-type Gly74 had a previously reported^20,21 cytidine-to-thymidine (C-to-T) mutation at position 1081 (986 bp from the starting site of translation), which causes a substitution of valine for alanine at position 329 and introduces a new BalI–MscI restriction site in exon 11. Heterozygosity for each mutation (Figure 3A) was confirmed by digesting PCR-amplified fragments of genomic DNA containing exons 4 and 11 with BbvI and MscI, respectively (data not shown). The Ala329Val mutation is known to abolish the catalytic activity of adenosine deaminase.²² The in vitro translation product containing the novel Gly74Val mutation also lacked detectable enzymatic activity (Figure 3B and Figure 3C).

View larger version (61K): [in this window] [in a new window]   Figure 3. The Adenosine Deaminase Genotype of the Patient with Deficiency of That Enzyme and the Effect of the Gly74Val Mutation on Adenosine Deaminase Activity. Panel A shows a diagram of the adenosine deaminase gene on which the location of the two mutations in the study patient is marked. The numbered yellow boxes represent exons, and the orange areas introns. Panel B shows a gel electrophoretogram of 35S-labeled in vitro translation products, as described in the Methods section. The reticulocyte lysate translation reactions were primed as follows: lane 1, wild-type adenosine deaminase messenger RNA (mRNA); lane 2, no RNA control; and lane 3, mRNA containing the Gly74Val mutation (from the patient). Panel C shows an in situ assay of in vitro translation products for adenosine deaminase. The arrow indicates the position of human adenosine deaminase. The dark bands at the top and bottom are rabbit adenosine deaminase and rabbit hemoglobin, respectively, carried over from the reticulocyte translation reaction. Lane 1 shows a wild-type adenosine deaminase control, and lane 2, mRNA containing the Gly74Val mutation (from the patient); lane 3 is blank.

 
Discussion

Moderately elevated serum hepatic-enzyme concentrations whose cause and importance are uncertain are found in some patients with adenosine deaminase deficiency. In a review of autopsy findings in eight patients, severe bridging portal fibrosis was found in two.²³ In our patient, prolonged neonatal jaundice and elevated serum aminotransferase concentrations were the dominant features at presentation, obscuring signs of primary immunodeficiency. Once lymphopenia and the absence of lymphoid tissues were recognized and adenosine deaminase deficiency was diagnosed, an extensive evaluation failed to implicate known causes of hepatic dysfunction. No infectious agent was identified, nor was there evidence of graft-versus-host disease due to the transfer of maternal T cells across the placenta. However, the findings of enlarged hepatocytes and biliary stasis, though nonspecific, were similar to changes found in the livers of adenosine deaminase–deficient mice.^6,7 The patient's serum aminotransferase and bilirubin concentrations declined rapidly to normal after the start of adenosine deaminase–replacement therapy. These changes occurred in parallel with the correction of metabolic abnormalities induced by the accumulation of adenosine deaminase substrates, but before the numbers and function of T lymphocytes improved.

No biochemical studies of the patient's hepatocytes were conducted. However, in studies of adenosine deaminase–deficient mice⁷ (and unpublished data), the increase in deoxyadenosine triphosphate (the major cause of lymphopenia^3,24) in the liver was slight. The activity of adenosylhomocysteinase, which is inactivated by deoxyadenosine,²⁵ was reduced by 85 percent, resulting in an increase in hepatic adenosylhomocysteine by a factor of five to six.⁷ Partial inactivation of adenosylhomocysteine may contribute to the lymphopenia in adenosine deaminase deficiency.^{3,25,26,27,28,29} Among the mechanisms responsible for these effects are the inhibition by adenosylhomocysteine of s-adenosylmethionine–dependent transmethylation reactions^26,27,30 and possibly the depletion of methionine and folate pools. Limiting transmethylation by various means is hepatotoxic in rodents.^31,32,33

On the basis of these findings, we suggest that adenosine deaminase deficiency can cause hepatitis in some patients, who may have unknown predisposing factors or carry certain adenosine deaminase alleles, more than 40 of which have been identified.^{3,10,11,12,13,20,21,22,34} The specificity of the alleles is most likely related to their effect on adenosine deaminase activity, and hence to the degree of metabolic abnormality. Both our patient's missense mutations, Gly74Val and Ala329Val, reduce catalytic activity greatly. His very high erythrocyte deoxyadenosine nucleotide value at diagnosis indicates severe adenosine deaminase deficiency in all tissues.^3,10 Alternatively, specific adenosine deaminase alleles may act like the alpha₁-antitrypsin Z allele, which causes hepatotoxicity by being deposited as aberrantly processed inclusions in hepatocytes.³⁵ No inclusions were found in our patient's liver-biopsy specimen, and adenosine deaminase replacement would not be expected to correct dysfunction due to an intracellular accumulation of improperly processed enzyme.

The metabolic effects of adenosine deaminase deficiency may cause morbidity unrelated to immunodeficiency, even though the latter is the overriding clinical problem. This may explain why adenosine deaminase–deficient patients with severe combined immunodeficiency have generally fared worse than others undergoing transplantation of haploidentical bone marrow.³⁶ Two centers, for example, reported overall survival rates of 56 and 58 percent among a total of 74 patients who underwent this procedure, but none of the 8 with adenosine deaminase deficiency survived; the adenosine deaminase–deficient patients were also more likely than others to die before transplantation could be performed.^37,38 The hepatotoxicity of adenosine deaminase substrates may be additive with the effects of cytotoxic agents used to prepare these patients for marrow transplantation.

Supported by a grant (DK20902) from the National Institutes of Health (to Dr. Hershfield) and by Enzon, Inc. Dr. Hershfield is a consultant to Enzon, Inc.

We are indebted to Mr. Stephan Toutain for expert technical assistance.

Source Information

From the Eudowood Division of Pediatric Immunology (M.E.B., H.M.L.) and the Division of Pediatric Gastroenterology (K.S.), Johns Hopkins University School of Medicine, Baltimore; and the Departments of Medicine (F.X.A.-V., I.S., M.S.H.) and Biochemistry (M.S.H.), Duke University School of Medicine, Durham, N.C.

Address reprint requests to Dr. Bollinger at the Eudowood Division of Pediatric Immunology, Johns Hopkins Hospital, CMSC 1102, 600 N. Wolfe St., Baltimore, MD 21287-3923.

References

1. Giblett ER, Anderson JE, Cohen F, Pollara B, Meuwissen HJ. Adenosine-deaminase deficiency in two patients with severely impaired cellular immunity. Lancet 1972;2:1067-1069. [Medline]
2. Hirschhorn R. Adenosine deaminase deficiency. Immunodefic Rev 1990;2:175-198. [Medline]
3. Hershfield MS, Mitchell BS. Immunodeficiency diseases caused by adenosine deaminase deficiency and purine nucleoside phosphorylase deficiency. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic and molecular bases of inherited disease. 7th ed. Vol. 2. New York: McGraw-Hill, 1995:1725-68.
4. Rosen FS, Cooper MD, Wedgwood RJP. The primary immunodeficiencies. N Engl J Med 1995;333:431-440. [Free Full Text]
5. Hirschhorn R, Papageorgiou PS, Kesarwala HH, Taft LT. Amelioration of neurologic abnormalities after "enzyme replacement" in adenosine deaminase deficiency. N Engl J Med 1980;303:377-380. [Medline]
6. Wakamiya M, Blackburn MR, Jurecic R, et al. Disruption of the adenosine deaminase gene causes hepatocellular impairment and perinatal lethality in mice. Proc Natl Acad Sci U S A 1995;92:3673-3677. [Free Full Text]
7. Migchielsen AAJ, Breuer ML, van Roon MA, et al. Adenosine-deaminase-deficient mice die perinatally and exhibit liver-cell degeneration, atelectasis and small intestinal cell death. Nat Genet 1995;10:279-287. [CrossRef][Medline]
8. Wiginton DA, Adrian GS, Hutton JJ. Sequence of human adenosine deaminase cDNA including the coding region and a small intron. Nucleic Acids Res 1984;12:2439-2446. [Free Full Text]
9. Wiginton DA, Kaplan DJ, States JC, et al. Complete sequence and structure of the gene for human adenosine deaminase. Biochemistry 1986;25:8234-8244. [CrossRef][Medline]
10. Santisteban I, Arredondo-Vega FX, Kelly S, et al. Novel splicing, missense, and deletion mutations in seven adenosine deaminase-deficient patients with late/delayed onset of combined immunodeficiency disease: contribution of genotype to phenotype. J Clin Invest 1993;92:2291-2302.
11. Arredondo-Vega FX, Santisteban I, Kelly S, Schlossman CM, Umetsu DT, Hershfield MS. Correct splicing despite mutation of the invariant first nucleotide of a 5' splice site: a possible basis for disparate clinical phenotypes in siblings with adenosine deaminase deficiency. Am J Hum Genet 1994;54:820-830. [Medline]
12. Santisteban I, Arredondo-Vega FX, Kelly S, et al. Four new adenosine deaminase mutations, altering a zinc-binding histidine, two conserved alanines, and a 5' splice site. Hum Mutat 1995;5:243-250. [CrossRef][Medline]
13. Santisteban I, Arredondo-Vega FX, Kelly S, et al. Three new adenosine deaminase mutations that define a splicing enhancer and cause severe and partial phenotypes: implications for evolution of a CpG hotspot and expression of a transduced ADA cDNA. Hum Mol Genet 1995;4:2081-2087. [Free Full Text]
14. Arredondo-Vega FX, Kurtzberg J, Chaffee S, et al. Paradoxical expression of adenosine deaminase in T cells cultured from a patient with adenosine deaminase deficiency and combined immunodeficiency. J Clin Invest 1990;86:444-452.
15. Hershfield MS, Buckley RH, Greenberg ML, et al. Treatment of adenosine deaminase deficiency with polyethylene glycol-modified adenosine deaminase. N Engl J Med 1987;316:589-596. [Abstract]
16. Weinberg K, Hershfield MS, Bastian J, et al. T lymphocyte ontogeny in adenosine deaminase-deficient severe combined immune deficiency after treatment with polyethylene glycol-modified adenosine deaminase. J Clin Invest 1993;92:596-602.
17. Hershfield MS, Chaffee S, Sorensen RU. Enzyme replacement therapy with polyethylene glycol-adenosine deaminase in adenosine deaminase deficiency: overview and case reports of three patients, including two now receiving gene therapy. Pediatr Res 1993;33:Suppl:S42-S48.
18. Hershfield MS. PEG-ADA: an alternative to haploidentical bone marrow transplantation and an adjunct to gene therapy for adenosine deaminase deficiency. Hum Mutat 1995;5:107-112. [CrossRef][Medline]
19. Hershfield MS. PEG-ADA replacement therapy for adenosine deaminase deficiency: an update after 8.5 years. Clin Immunol Immunopathol 1995;76:S228-S232. [CrossRef][Medline]
20. Akeson AL, Wiginton DA, States JC, Perme CM, Dusing MR, Hutton JJ. Mutations in the human adenosine deaminase gene that affect protein structure and RNA splicing. Proc Natl Acad Sci U S A 1987;84:5947-5951. [Free Full Text]
21. Markert ML, Norby-Slycord C, Ward FE. A high proportion of ADA point mutations associated with a specific alanine-to-valine substitution. Am J Hum Genet 1989;45:354-361. [Medline]
22. Akeson AL, Wiginton DA, Dusing MR, States JC, Hutton JJ. Mutant human adenosine deaminase alleles and their expression of transfection into fibroblasts. J Biol Chem 1988;263:16291-16296. [Free Full Text]
23. Ratech H, Greco MA, Gallo G, Rimoin DL, Kamino H, Hirschhorn R. Pathologic findings in adenosine deaminase-deficient severe combined immunodeficiency. I. Kidney, adrenal, and chondro-osseous tissue alterations. Am J Pathol 1985;120:157-169. [Abstract]
24. Benveniste P, Cohen A. p53 Expression is required for thymocyte apoptosis induced by adenosine deaminase deficiency. Proc Natl Acad Sci U S A 1995;92:8373-8377. [Free Full Text]
25. Hershfield MS. Apparent suicide inactivation of human lymphoblast s-adenosylhomocysteine hydrolase by 2'-deoxyadenosine and adenine arabinoside: a basis for direct toxic effects of analogs of adenosine. J Biol Chem 1979;254:22-25. [Free Full Text]
26. Kredich NM, Martin DV Jr. Role of s-adenosylhomocysteine in adenosine mediated toxicity in cultured mouse T lymphoma cells. Cell 1977;12:931-938. [CrossRef][Medline]
27. Hershfield MS, Kredich NM. Resistance of an adenosine kinase-deficient human lymphoblastoid cell line to effects of deoxyadenosine on growth, s-adenosylhomocysteine hydrolase inactivation, and dATP accumulation. Proc Natl Acad Sci U S A 1980;77:4292-4296. [Free Full Text]
28. Wolos JA, Frondorf KA, Davis GF, Jarvi ET, McCarthy JR, Bowlin TL. Selective inhibition of T cell activation by an inhibitor of s-adenosyl-L-homocysteine hydrolase. J Immunol 1993;150:3264-3273. [Abstract]
29. Wolos JA, Frondorf KA, Esser RE. Immunosuppression mediated by an inhibitor of s-adenosyl-L-homocysteine hydrolase: prevention and treatment of collagen-induced arthritis. J Immunol 1993;151:526-534. [Abstract]
30. Kredich NM, Hershfield MS. S-adenosylhomocysteine toxicity in normal and adenosine kinase-deficient lymphoblasts of human origin. Proc Natl Acad Sci U S A 1979;76:2450-2454. [Free Full Text]
31. Wainfan E, Dizik M, Stender M, Christman JK. Rapid appearance of hypomethylated DNA in livers of rats fed cancer-promoting, methyl-deficient diets. Cancer Res 1989;49:4094-4097. [Free Full Text]
32. Chandar N, Lombardi B, Locker J. c-myc Gene amplification during hepatocarcinogenesis by a choline-devoid diet. Proc Natl Acad Sci U S A 1989;86:2703-2707. [Free Full Text]
33. Poirier LA. Methyl group deficiency in hepatocarcinogenesis. Drug Metab Rev 1994;26:185-199. [Medline]
34. Hirschhorn R. Adenosine deaminase deficiency: molecular basis and recent developments. Clin Immunol Immunopathol 1995;76:S219-S227. [CrossRef][Medline]
35. Cox DW. ₁-Antitrypsin deficiency. In: Scriver CR, Beaudet AL, Sly WS, Valle D, eds. The metabolic and molecular bases of inherited disease. 7th ed. Vol. 3. New York: McGraw-Hill, 1995:4125-58.
36. O'Reilly RJ, Keever CA, Small TN, Brochstein J. The use of HLA-non-identical T-cell-depleted marrow for transplants for correction of severe combined immunodeficiency disease. Immunodefic Rev 1989;1:273-309. [Medline]
37. Stephan JL, Vlekova V, Le Deist F, et al. Severe combined immunodeficiency: a retrospective single-center study of clinical presentation and outcome in 117 patients. J Pediatr 1993;123:564-572. [CrossRef][Medline]
38. Dror Y, Gallagher R, Wara DW, et al. Immune reconstitution in severe combined immunodeficiency disease after lectin-treated, T-cell-depleted haplocompatible bone marrow transplantation. Blood 1993;81:2021-2030. [Free Full Text]

PDF Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

This article has been cited by other articles:

• Gaspar, H. B., Aiuti, A., Porta, F., Candotti, F., Hershfield, M. S., Notarangelo, L. D. (2009). How I treat ADA deficiency. Blood 114: 3524-3532 [Abstract] [Full Text]  
• Titman, P., Pink, E., Skucek, E., O'Hanlon, K., Cole, T. J., Gaspar, J., Xu-Bayford, J., Jones, A., Thrasher, A. J., Davies, E. G., Veys, P. A., Gaspar, H. B. (2008). Cognitive and behavioral abnormalities in children after hematopoietic stem cell transplantation for severe congenital immunodeficiencies. Blood 112: 3907-3913 [Abstract] [Full Text]  
• Lainka, E., Hershfield, M. S., Santisteban, I., Bali, P., Seibt, A., Neubert, J., Friedrich, W., Niehues, T. (2005). Polyethylene Glycol-Conjugated Adenosine Deaminase (ADA) Therapy Provides Temporary Immune Reconstitution to a Child with Delayed-Onset ADA Deficiency. CVI 12: 861-866 [Abstract] [Full Text]  
• Aiuti, A., Slavin, S., Aker, M., Ficara, F., Deola, S., Mortellaro, A., Morecki, S., Andolfi, G., Tabucchi, A., Carlucci, F., Marinello, E., Cattaneo, F., Vai, S., Servida, P., Miniero, R., Roncarolo, M. G., Bordignon, C. (2002). Correction of ADA-SCID by Stem Cell Gene Therapy Combined with Nonmyeloablative Conditioning. Science 296: 2410-2413 [Abstract] [Full Text]  
• Arredondo-Vega, F. X., Santisteban, I., Richard, E., Bali, P., Koleilat, M., Loubser, M., Al-Ghonaium, A., Al-Helali, M., Hershfield, M. S. (2002). Adenosine deaminase deficiency with mosaicism for a "second-site suppressor" of a splicing mutation: decline in revertant T lymphocytes during enzyme replacement therapy. Blood 99: 1005-1013 [Abstract] [Full Text]  
• Ariga, T., Oda, N., Sanstisteban, I., Arredondo-Vega, F. X., Shioda, M., Ueno, H., Terada, K., Kobayashi, K., Hershfield, M. S., Sakiyama, Y. (2001). Molecular Basis for Paradoxical Carriers of Adenosine Deaminase (ADA) Deficiency That Show Extremely Low Levels of ADA Activity in Peripheral Blood Cells Without Immunodeficiency. J. Immunol. 166: 1698-1702 [Abstract] [Full Text]  
• Blackburn, M. R., Volmer, J. B., Thrasher, J. L., Zhong, H., Crosby, J. R., Lee, J. J., Kellems, R. E. (2000). Metabolic Consequences of Adenosine Deaminase Deficiency in Mice Are Associated with Defects in Alveogenesis, Pulmonary Inflammation, and Airway Obstruction. JEM 192: 159-170 [Abstract] [Full Text]  
• Blackburn, M. R., Datta, S. K., Kellems, R. E. (1998). Adenosine Deaminase-deficient Mice Generated Using a Two-stage Genetic Engineering Strategy Exhibit a Combined Immunodeficiency. J. Biol. Chem. 273: 5093-5100 [Abstract] [Full Text]  
• Ozsahin, H., Arredondo-Vega, F. X., Santisteban, I., Fuhrer, H., Tuchschmid, P., Jochum, W., Aguzzi, A., Lederman, H. M., Fleischman, A., Winkelstein, J. A., Seger, R. A., Hershfield, M. S. (1997). Adenosine Deaminase Deficiency in Adults. Blood 89: 2849-2855 [Abstract] [Full Text]  
• Blackburn, M. R., Aldrich, M., Volmer, J. B., Chen, W., Zhong, H., Kelly, S., Hershfield, M. S., Datta, S. K., Kellems, R. E. (2000). The Use of Enzyme Therapy to Regulate the Metabolic and Phenotypic Consequences of Adenosine Deaminase Deficiency in Mice. DIFFERENTIAL IMPACT ON PULMONARY AND IMMUNOLOGIC ABNORMALITIES. J. Biol. Chem. 275: 32114-32121 [Abstract] [Full Text]