Direct Cultivation of the Causative Agent of Human Granulocytic Ehrlichiosis
Jesse L. Goodman, M.D., Curtis Nelson, B.A., Blaise Vitale, M.D., John E. Madigan, D.V.M., J. Stephen Dumler, M.D., Timothy J. Kurtti, Ph.D., and Ulrike G. Munderloh, D.V.M., Ph.D.
Background human granulocytic ehrlichiosis is a potentiallyfatal tick-borne infection that has recently been described.This acute febrile illness is characterized by myalgias, headache,thrombocytopenia, and elevated serum aminotransferase levels.The disease is difficult to diagnose because the symptoms arenonspecific, intraleukocytic inclusions (morulae) may not beseen, and the serologic results are often initially negative.Little is known about the causative agent because it has neverbeen cultivated.
Methods We studied three patients with symptoms and laboratoryfindings suggestive of human granulocytic ehrlichiosis, includingunexplained fever after probable exposure to ticks, granulocytopenia,and thrombocytopenia. Peripheral blood was examined for ehrlichiamicroscopically and with use of the polymerase chain reaction(PCR). Blood was inoculated into cultures of HL60 cells (a lineof human promyelocytic leukemia cells), and the cultures weremonitored for infection by giemsa staining and PCR.
Results Blood from the three patients, only one of whom hadinclusions suggestive of ehrlichia in neutrophils, was positivefor human granulocytic ehrlichiosis on PCR. Blood from all threepatients was inoculated into HL60 cell cultures and caused infection,with intracellular organisms visualized as early as 5 days afterinoculation and cell lysis occurring within 12 to 14 days. Theidentity of the cultured organisms was confirmed by immunofluorescencemicroscopy, PCR analysis, and DNA sequencing. DNA from the infectedcells was sequenced in regions of the 16S ribosomal gene reportedto differ between the agent of human granulocytic ehrlichiosisand closely related species, including Ehrlichia equi and E.phagocytophila, which cause infection in animals. The sequencesfrom all three human isolates were identical and differed fromthe strain of E. equi studied in having guanine rather thanadenine at nucleotide 84.
Conclusions We describe the cultivation of the agent of humangranulocytic ehrlichiosis in cell culture. The ability to isolatethis organism should lead to a better understanding of the biology,treatment, and epidemiology of this emerging infection.
Ehrlichia are intracellular organisms that may infect a varietyof mammalian hosts.1 The rapid emergence of a new human ehrlichialinfection, human granulocytic ehrlichiosis, was recently reported.This infection was first recognized in north central Minnesotaand Wisconsin2,3 and has now been reported in New York4 andMassachusetts.5 Preliminary studies4 suggest that human granulocyticehrlichiosis is transmitted by Ixodes scapularis ticks, alsoa vector of Lyme disease. Human granulocytic ehrlichiosis isan acute, sometimes fatal, febrile syndrome. Unlike Lyme disease,it is usually accompanied by leukopenia, thrombocytopenia, andelevated serum aminotransferase levels. Little is known aboutthe agent that causes human granulocytic ehrlichiosis, largelybecause it has not been isolated in culture.
Case Reports
Patient 1
Patient 1 was a 61-year-old man from northwest Wisconsin witha 36-hour history of fever, myalgias, headache, and nausea.After a recent fishing trip he had removed ticks from himself.Examination showed him to be acutely ill and febrile (temperature,up to 38.5°C). The white-cell count was 5200 per cubic millimeter,the hemoglobin level was 152 g per liter, and the platelet countwas 82,000 per cubic millimeter. No inclusions suggestive ofehrlichia were seen on blood smears. Treatment with 100 mg ofdoxycycline twice daily orally was initiated, with dramaticimprovement within 24 hours. Treatment lasted two weeks, afterwhich the patient was well.
Patient 2
Patient 2 was a 66-year-old woman from north central Minnesotawith a two-day history of fever, confusion, ataxia, and vomiting.She did not recall having any tick bites, but two weeks earlierhad walked through woods in northwestern Wisconsin. She hada temperature of 38.9°C and ataxia. A computed tomographicscan of the head and lumbar puncture revealed no abnormalities.Laboratory analyses revealed the following: hemoglobin level,130 g per liter; white-cell count, 2600 per cubic millimeter,with 33 percent neutrophils, 58 percent bands, 8 percent lymphocytes,and 1 percent monocytes; platelet count, 33,000 per cubic millimeter;alanine aminotransferase level, 86 U per liter (normal, 0 to33); lactate dehydrogenase level, 386 U per liter (normal, 91to 232); and alkaline phosphatase level, 154 U per liter (normal,34 to 114). One percent of the neutrophils contained inclusionssuggestive of ehrlichia. Intravenous doxycycline was administered,and within 24 hours the patient was afebrile. She was givenoral doxycycline at a dose of 100 mg twice daily for two weeks.The ataxia resolved, and she was well at this writing.
Patient 3
Patient 3 was a 64-year-old man from north central Minnesotawith a history of lymphoid interstitial pneumonitis who hadlast received immunosuppressive treatment three years previously.Fever, rigors, and nausea developed, for which a regimen ofamoxicillin and clavulanate was prescribed. The patient hadno response and was admitted to another hospital. He had a white-cellcount of 5700 per cubic millimeter, a platelet count of 95,000per cubic millimeter, an aspartate aminotransferase level of59 U per liter, and an alanine aminotransferase level of 62U per liter. Chest x-ray films showed no change in the degreeof interstitial fibrosis, and cultures of blood and sputum werenegative. The patient was treated with erythromycin and ceftriaxonefor 10 days, with improvement. Nine days later the fever recurred.The patient was readmitted, the antibiotics were reinstitutedwithout improvement, and he was transferred to the Universityof Minnesota Hospital. He reported having removed multiple ticksfrom his dogs and having had laryngeal edema after tetracyclinetherapy. His temperature was 39.2°C, and he was somnolent.The white-cell count was 9200 per cubic millimeter, the hemoglobinlevel was 110 g per liter, and the platelet count was 179,000per cubic millimeter. no babesia or ehrlichia were noted onblood smears. The alanine aminotransferase level was 88 U perliter, the bilirubin level was 1.4 mg per deciliter (normal,0.1 to 1.2), the alkaline phosphatase level was 206 U per liter,and the lipase level was 942 U per liter (normal, 23 to 300).The cerebrospinal fluid was normal, and routine cultures werenegative. Chloramphenicol was administered orally at a doseof 500 mg four times daily. Within 24 hours the patient becameafebrile. By the fourth hospital day, the platelet count hadincreased to 306,000 per cubic millimeter, but the patient haddyspnea. An echocardiogram revealed a large pericardial effusionand tamponade. Pericardiocentesis yielded 650 ml of fluid, with35,000 red cells per cubic millimeter and 790 white cells percubic millimeter (53 percent neutrophils). Cultures and cytologicanalysis were negative. Tests for serum antinuclear antibodieswere positive at a titer of more than 1:320, and the level ofantinative DNA was 184 IU per milliliter (normal, 0 to 99).There was no other clinical evidence suggestive of systemiclupus erythematosus. The patient was treated with chloramphenicolfor 10 days and remained well four months later.
Methods
Cultivation of Patients' Blood Samples and Ehrlichia equi in HL60 and Tick Cells
The HL60 leukemia cell line6 (American Type Culture CollectionCCL240) was cultivated in RPMI 1640 medium supplemented with10 percent heat-inactivated fetal-calf serum and 2 mM glutamineand maintained at 37°C in 5 percent carbon dioxide. Bloodsamples (100 µl) were obtained from the patients, treatedwith EDTA as an anticoagulant, and immediately inoculated into3 ml of HL60 cells adjusted to a density of 500,000 per milliliter.Cells were kept in 25-cm2 culture flasks at a density of 200,000to 600,000 per milliliter by feeding the cells with medium twicea week.
The tick-embryo cell line IDE8 was isolated from I. scapularis7;IDE8 cells, which support the growth of E. equi (unpublisheddata), were maintained at 34°C and infected in the samemanner as HL60 cells. Control and inoculated HL60 and IDE8 cultureswere maintained in parallel.
The MRK strain of E. equi was obtained from the blood of aninfected horse8 and passaged in vivo in horses several times.Buffy-coat blood from infected horses was used both to infectHL60 cells directly and to infect IDE8 tick cells, which werethen used to infect HL60 cells secondarily. When 30 percentof the tick cells were infected, as determined by Giemsa staining,0.25 ml was added to 9 ml of HL60 cells, and the cultures weremaintained as described above.
Giemsa Staining and Immunofluorescence Microscopy
Slides of the cultured cells were dried, fixed in methanol for10 minutes, and stained with Giemsa stain for 30 minutes ata pH of 6.8. An indirect immunofluorescence assay was performedafter the slides had been fixed for 10 minutes in a 1:1 solutionof methanol and acetone. The primary antibody applied was eithercontrol human serum (negative for E. equi antibody) or serumfrom a patient who had recovered from human granulocytic ehrlichiosis(E. equi titer, 1:40). The slides were counterstained with Evansblue and mounted with phosphate-buffered saline supplementedwith 3 percent bovine-serum albumin, 10 percent glycerol, and10 percent triethylenediamine.
Serologic Studies
Serum samples were assayed by an indirect immunofluorescenceassay for the presence of antibodies against E. equi as describedpreviously.8 Titers of more than 1:20 were considered positivebecause higher titers were not noted in uninfected horses orcontrol patients and have been protective against experimentalinfection in horses.
PCR Analysis of Blood Samples and Cultured Cells
Blood samples and cultured cells were processed in a buildingwhere ehrlichia and their nucleic acids have never been present.To prevent contamination of samples for polymerase chain reaction(PCR), aerosol barrier pipette tips were used. A 100-µlsample of blood was subjected to nucleic acid extraction withguanidium isothiocyanate chaotropic lysis (IsoQuik, ORCA Research,Bothell, Wash.). The template DNA for each assay, one thirdof the nucleic acids derived, was resuspended in 10 µlof water. The other components of the PCR were as follows: 50mmol of potassium chloride per liter; 10 mmol of TRIS bufferper liter at a pH of 8.3; 2 mmol of magnesium chloride per liter;200 µmol each of 2'-deoxyadenosine triphosphate, deoxycytidinetriphosphate, deoxyguanosine triphosphate, and deoxythymidinetriphosphate per liter; 25 pmol of each primer; and 2.5 U ofAmplitaq DNA polymerase per 100 µl (Chiron, Cetus, Emeryville,Calif.). The primers PER 1 (5'TTTATCGCTATTAGATGAGCCTATG3') andPER 2 (5'CTCTACACTAGGAATTCCGCTAT3') correspond to bases 187to 211 and 616 to 638, respectively, of the reported sequencefor the agent of human granulocytic ehrlichiosis (GenBank accessionnumber U02521) and amplify a fragment of 451 base pairs (bp)from ehrlichia species other than E. sennetsu. The primers GER3 (5'TAGATCCTTAACGGAAGGGCG3') and GER 4 (5'AAGTGCCCGGCTTAACCCGCTGGC3')correspond to bases 950 to 973 and 1077 to 1101, respectively,and amplify a 151-bp fragment from species of the E. phagocytophilagroup (e.g., E. equi and the agent causing human granulocyticehrlichiosis) but not from monocytic ehrlichia, including theclosely related E. canis. For PER 1 and PER 2, amplificationwas performed in a thermal cycler (model 9600, Perkin-Elmer,Norwalk, Conn.) with 5 minutes of denaturation at 95°C,followed by 40 cycles consisting of 11 seconds of denaturationat 94°C, 10 seconds of annealing at 45°C, and 15 secondsof extension at 72°C for all cycles but the 40th, in whichextension lasted 7 minutes. For GER 3 and GER 4, amplificationwas performed in a Coy thermal cycler (Coy Laboratory products,Ann Arbor, Mich.) with 5 minutes of denaturation at 95°C,followed by 40 cycles consisting of 1 minute of denaturationat 94°C, 1 minute of annealing at 50°C, and 1 minuteof extension at 72°C for all cycles but the 40th, in whichextension lasted 7 minutes. Multiple (>4) negative controlswere processed in parallel and included in every experiment.For analysis, a 15-µl sample was electrophoresed in agarosegels. As a probe for the 450-bp product of the PER 1 and 2 primers,an internal HinfI fragment was obtained by digestion and gelpurification of PCR-amplified E. equi DNA. Digoxigenin labelingof probes, Southern hybridization, and the chemiluminescenceassay (Genius, Boeringer–Mannheim, Indianapolis) wereperformed as described previously.9
DNA Sequencing of Isolates of the Agent Causing Human Granulocytic Ehrlichiosis from Infected HL60 Cells
DNA was amplified with PCR as described for the PER 1 and 2primers. However, the primer pairs used were PER 3 (5'ATGCATTACTCACCCCTCTG3')and PER 4 (5'TCCTGGCTCAGAACGAACGC3'), which span bases 1 to20 and 92 to 111, respectively, of the 16S sequence of the agentcausing human granulocytic ehrlichiosis, and PER 5 (5'AAGCACTCCGCCTGGGGACT3')and PER 6 (5'CCATGTCAAGGAGTGGTAAGG3'), which span bases 818to 837 and 925 to 943, respectively. To minimize the amplificationof cellular sequences, Taq polymerase was not added to the reactionmixtures until the temperature reached 95°C (so-called hot-startPCR). DNA was purified with Centricon-30 columns (Amicon, Beverly,Mass.), sequenced with primers PER 3, 4, 5, and 6, and dye-labeledwith dideoxynucleotides (PRISM, Applied Biosystems, Foster City,Calif.). The sequence of both DNA strands was obtained witha DNA sequencer (model 373, Applied Biosystems).
Results
Cultivation of the Agent of Human Granulocytic Ehrlichiosis
Complete cytopathic effects, with lysis of the HL60 cells, werenoted 12 days after blood from Patient 1 was inoculated intoHL60 cells, and PCR analysis of the cultured cells was stronglypositive for human granulocytic ehrlichia. Organisms and degeneratingcells were visualized, but the organisms could not be recoveredby subcultivation. Control cultures and cultures of blood obtainedone day after the initiation of doxycycline therapy showed noevidence of infection on Giemsa staining or PCR. Twelve daysafter the inoculation of blood from Patient 2 into HL60 cells,organisms were noted on Giemsa staining in almost 100 percentof the HL60 cells. A variety of forms were noted, ranging fromwhat were presumed to be individual organisms to small, densebodies to rounded masses of organisms similar to those seenin granulocytes (morulae) in some patients (Figure 1A). Immunofluorescencemicroscopy (Figure 1B) demonstrated specific intense stainingof ehrlichial antigens in both morulae and smaller forms. Suchstaining was not observed in uninfected cells or cells incubatedwith control serum. In cultures inoculated with blood from Patient3, rare morulae were first noted in both HL60 and IDE8 cellsfive days after infection. By day 14, more than 90 percent ofHL60 cells contained morulae and other forms similar to thosenoted in Patient 2 (Figure 1C), but less than 1 percent of IDE8cells were infected. As of this writing, the isolates from Patients2 and 3 have been continuously subcultivated in HL60 cells for4 to 5 months by the addition of fresh cells every 7 to 10 days.All blood samples obtained from the three patients after theinitiation of doxycycline therapy and from three other patientswho were initially suspected of having ehrlichiosis but whowere found not to have it on the basis of PCR and blood-smearexamination were culture-negative.
Figure 1. Photomicrographs of HL60 Cells Infected with Granulocytic Ehrlichia (x750).
Panel A shows Giemsa-stained cells infected by the agent of human granulocytic ehrlichiosis isolated from the blood of Patient 2. Panel B shows immunofluorescent staining of infected cells from Patient 2. Panel C shows giemsa-stained cells infected by the agent of human granulocytic ehrlichiosis isolated from the blood of Patient 3. Panel D shows cells infected with E. equi. In each panel the arrows point to examples of various forms of the intracellular organisms.
Cultivation of E. equi in HL60 Cells
Rare morulae were first noted 21 days after HL60 cells wereinoculated with E. equi derived from IDE8. By day 49, 27 percentof cells contained morulae. As was true for the agent causinghuman granulocytic ehrlichiosis, these morulae had complex internalstructures, and infected cells often contained several morulae(Figure 1D); however, cell lysis was rarely observed. immunofluorescencemicroscopy revealed intense and specific staining of morulaenot seen with control cells or cells incubated with controlserum. The rate of replication was slow in tick-cell–derivedE. equi. In contrast, eight days after direct inoculation ofHL60 cells with blood from a horse infected with the same E.equi strain, morulae were noted in 90 percent of the cells.
PCR Analysis of Blood Samples and Cell Cultures
Blood samples from Patients 1, 2, and 3 were analyzed by PCRwith primer pair PER 1 and 2. The pretreatment blood samplesfrom Patients 1 and 2 were strongly positive for ehrlichialDNA (Figure 2, lanes 2 and 13), yielding bands of the appropriatemolecular weight (451 bp). Blood samples from Patient 3, whohad been treated previously with antibiotics, were negative(Figure 2, lane 17) (sensitivity, <10 genomes; Figure 2,lanes 9 to 11), but Southern blotting (sensitivity, 1 genome;data not shown) confirmed the identity of all positive signalsas ehrlichial in origin and was positive for Patient 3 at anintensity of less than 10 genomes. In blood specimens obtainedfrom Patients 1 and 2 one day after treatment was initiated,the intensity of bacteremia was already greatly diminished (Figure 2,lanes 3 and 14). All control samples, including blood froma patient suspected of having ehrlichiosis but who actuallyhad acute Epstein–Barr virus infection (Figure 2, lane6), uninfected HL60 cells (Figure 2, lane 19), and water (waterwas processed instead of DNA) (Figure 2, lanes 7, 8, and 20),were negative for ehrlichial DNA.
Figure 2. Identification of a 451-bp PCR Product of Ehrlichial DNA in Blood Samples from the Three Patients and in HL60 Cells Inoculated with the Blood Samples.
The primer pair PER 1 and 2 amplifies a 451-bp product of ehrlichial DNA (arrow). Lanes 1 and 22 show the molecular weight (MW) standard. Whole blood (WB) was analyzed before antibiotic treatment (lanes 2, 13, and 17) and after one day of treatment (day 2) (lanes 3 and 14). HL60 cells inoculated with the whole-blood samples obtained before treatment (lanes 4, 15, and 18) and after one day of treatment (lanes 5 and 16) were also examined. Negative controls included blood from a patient with Epstein–Barr virus (EBV) infection (lane 6), uninfected HL60 cells (lane 19), and samples in which water rather than blood was processed (lanes 7, 8, and 20). Positive controls included the 16S ribosomal DNA amplicon (in which 10 to 1000 molecules of the 451-bp amplicon were quantitated before it was used as a target for the PCR) (lanes 9, 10, and 11) and IDE8 tick cells infected with E. equi (lane 21).
Analysis of HL60 cell cultures inoculated with blood from thethree patients revealed that all were positive for ehrlichialDNA with the use of both the general ehrlichial primers (PER1 and 2) (Figure 2, lanes 4, 15, and 18) and the primers specificfor granulocytic ehrlichia (GER 3 and 4) (Figure 3, lanes 2,3, and 4). In each case the intensity of the bands generatedby PER 1 and 2 from the cultured samples was far greater thanthe intensity of the bands generated from the original bloodsamples (Figure 2), despite the fact that the original inoculumhad already been diluted by a factor of more than 1:500 duringculture. The band in the lane showing results for HL60 cellsinoculated with blood from Patient 3 (Figure 3, lane 4) is faintbecause amplification was performed only five days after inoculation.Pericardial fluid from Patient 3 was strongly positive for granulocyticehrlichial DNA (Figure 3, lane 5). As expected, IDE8 and HL60cells infected with E. equi yielded positive PCR results withboth primer pairs, whereas IDE8 cells infected with E. caniswere negative with the use of primers specific for granulocyticehrlichia (GER 3 and 4). All control samples were negative.
Figure 3. Identification of a 151-bp Segment of Granulocytic Ehrlichial DNA in Amplified DNA Obtained from HL60 Cells Inoculated with Patient Blood Samples and from Uncultured Pericardial Fluid from Patient 3.
The primers used for amplification (PER 3 and 4) are specific for a 151-bp segment (arrow) of granulocytic ehrlichial DNA. the 151-bp segment was identified in HL60 cells inoculated with blood from the three patients (lanes 2, 3, and 4) and in pericardial fluid from Patient 3 (lane 5). Lane 1 shows the molecular weight (MW) standard. Negative controls included samples in which water rather than cultured cells was processed (lanes 6, 7, and 11), IDE8 tick cells infected with E. canis (lane 9), and uninfected IDE8 cells (lane 10). The positive control consisted of IDE8 cells infected with E. equi (lane 8).
Serologic Analysis
Serum obtained during the acute illness and follow-up was availablefrom Patients 1 and 2, whereas a single sample from Patient3 was obtained four weeks into his illness. Patient 1 had aninitial E. equi antibody titer of 1:40 on immunofluorescenceassay and a titer of 1:20 four weeks later. Patient 2 had aninitial titer of 1:20 and a second titer of 1:5120. Patient3 had a titer of 1:5120.
DNA Sequence Analysis of the Ehrlichial Isolates
The DNA sequence of both strands of the 113-bp 5' end of the16S ribosomal DNA was determined from cultures of the isolatesfrom all three patients and of E. equi (Table 1). All threesequences from the patients with human granulocytic ehrlichiosiswere identical to each other and to the previously reportedsequence.2 However, all differed from E. equi at nucleotide84, where E. equi had an adenine present, rather than a guanine,which is consistent with the previously identified sequencesof E. equi and E. phagocytophila (GenBank accession numbersM73223 and M73220, respectively). However, the sequence of theMRK strain of E. equi that we used differed from that in theGenBank data base at base 33, which was previously describedas the site of a second polymorphism between the agent causinghuman granulocytic ehrlichiosis and E. equi.2 We found thatE. equi and all three of the isolates from the patients hada thymine at this position. We also analyzed the DNA sequenceof both strands from bases 818 to 929, surrounding base 886,the only other reported site of a 16S ribosomal sequence polymorphismbetween E. equi and E. phagocytophila and the agent of humangranulocytic ehrlichiosis: the human agent was reported to havea guanine, whereas E. equi and E. phagocytophila were reportedto have a gap of a single base.2 We found that the DNA sequenceswere identical in all three cultured isolates from the patientsand E. equi and that there was no gap in the E. equi sequence(Table 1).
Table 1. Nucleotides at Key Positions in the 16S Ribosomal DNA of the Agent Causing Human Granulocytic Ehrlichiosis, E. equi, and E. phagocytophila.
Discussion
We report the direct isolation from three patients of the causativeagent of human granulocytic ehrlichiosis, an emerging infectionin the eastern and midwestern United States. The HL60 leukemiacell line was highly susceptible to infection with this agent,as indicated by the rapid development of cytopathic effectsand the direct visualization of organisms within 5 to 12 daysafter inoculation. The identity of the organisms as the agentof human granulocytic ehrlichiosis was confirmed by immunofluorescencemicroscopy, PCR, and DNA-sequence analysis. The recovery ofviable ehrlichia from Patient 3 (before chloramphenicol therapy),despite prior treatment with other antibiotics and an extremelylow level of bacteremia, demonstrates the sensitivity of theculture system. Patient 3 appeared to respond rapidly to chloramphenicol,suggesting that it may be useful for patients with human granulocyticehrlichiosis who cannot take tetracyclines, as has been suggestedfor patients with E. chaffeensis.10 This patient's course wasalso noteworthy because of the development of cardiac tamponadewith an exudative pericardial effusion, which was strongly positivefor the agent of human granulocytic ehrlichiosis on PCR. Toour knowledge this manifestation has not previously been associatedwith this disease.
The first recognized case of ehrlichial infection in humansoccurred in Japan and was due to E. sennetsu.11 Subsequent caseswere documented in the United States11,12,13,14 as due to anew species, E. chaffeensis.15E. chaffeensis is distributedthroughout the southeastern and south central United States,infects mononuclear phagocytes, and causes disease manifestationssimilar to those of human granulocytic ehrlichiosis. The agentof human granulocytic ehrlichiosis is serologically and geneticallydistinct from both E. chaffeensis and E. sennetsu but closelyrelated to E. equi and E. phagocytophila,2,16 pathogens of horsesand ruminants, respectively. In infected horses, E. equi causesfever, thrombocytopenia, and edema of the legs. Like the agentof human granulocytic ehrlichiosis, E. equi infects neutrophilsand appears to be transmitted by ixodes ticks. The diagnosisof human granulocytic ehrlichiosis has depended on the resultsof blood smears or PCR or on findings of serologic reactivityagainst E. equi. As in our patients, both serologic analysisand blood smears may be nondiagnostic when the patient is firstseen. The diagnosis may be missed when there is simultaneousinfection with Borrelia burgdorferi, causing a localized rash(which is not normally found in ehrlichiosis). In such cases,patients may receive treatment (e.g., penicillins, cephalosporins,or macrolides) that is not effective against ehrlichiosis.
On the basis of similarities in their 16S ribosomal DNA sequencesand biologic properties,2 it is possible that a granulocyticehrlichia causing disease in animals (e.g., E. equi or E. phagocytophila)is identical to the species causing human granulocytic ehrlichiosis.Recent studies have shown that the agent of human granulocyticehrlichiosis can infect and cause disease in horses and thatinfected horses are immune to infection with E. equi.17,18 Someof our results suggest that the agent of human granulocyticehrlichiosis differs from the E. equi isolate studied. Tick-cell–derivedE. equi grew quite slowly in HL60 cells, causing incompletecytopathic effects even after eight weeks, whereas all threehuman isolates lysed HL60 cells within two weeks of inoculation.This difference may, however, reflect changes occurring as aresult of passage in tick cells, given the observation thatE. equi obtained directly from an infected horse rapidly infectedHL60 cells. E. equi grew rapidly in IDE8 tick cells (unpublisheddata), whereas only one of three human isolates grew at allin IDE8 cells and, in that case, extremely slowly. Finally,at the genetic level, the sequences of all three human isolatesdiffered by one nucleotide from those of E. equi and E. phagocytophilain the 16S ribosomal regions studied and were identical to thesequence of the agent causing human granulocytic ehrlichiosisregistered in the GenBank data base, suggesting that this differenceis conserved among temporally and geographically distinct isolates.2The potential biologic or taxonomic importance of this differenceis uncertain. Our E. equi isolate did not have two other previouslyreported DNA-sequence changes distinguishing it from the agentcausing human granulocytic ehrlichiosis. In addition, it wasrecently reported that granulocytic ehrlichia from dogs andhorses in Sweden19 and a horse in the northeastern United States20have 16S ribosomal sequences identical to those of the agentcausing human granulocytic ehrlichiosis. Further studies ofthe biology and genetics of this agent and related granulocyticehrlichia causing infection in animals will be needed beforeit can be determined whether the agent is a unique species ora zoonosis caused by one or more animal pathogens.
The HL60 cell line consists of myeloid precursors similar tothose in human bone marrow. Like human myeloid precursors, HL60cells can attain the functional properties of neutrophils, includingphagocytosis. Thus, studies of interactions between pathogensand this cell line are relevant to human infection. The HL60cell line may also be useful for the isolation of other granulocytotropicpathogens of humans and animals.
With our techniques, antigen specific to the agent causing humangranulocytic ehrlichiosis can be prepared that may lead to improveddiagnostic assays. The ability to propagate the infectious agentin culture should help further the understanding of the epidemiology,genetics, pathogenesis, and treatment of human granulocyticehrlichiosis, which is an emerging public health problem.
Supported by grants from the National Institutes of Health (9R01-AI37772-04)(to Dr. Goodman), the University of Minnesota Experiment Station(to Dr. Munderloh), and the California Center for Equine Healthand Performance, University of California, Davis (to Dr. Madigan).
The University of Minnesota, University of Maryland, and Universityof California have applied for a patent on some of the cultivationtechniques described for the agents causing granulocytic ehrlichiosis,with Drs. Dumler, Munderloh, Kurtti, Madigan, and Goodman listedas coinventors.
We are indebted to Sheila St. Cyr and Brent Huberty for technicalassistance, to Brian Beardsley and Jodi A. Aasmundrud for assistancein preparing the manuscript, and to Drs. Ronald Menke, PaulGoellner, Stephen Obaid, and Barbara Cahill for patient referral.
Source Information
From the Division of Infectious Diseases, Department of Medicine, University of Minnesota School of Medicine, Minneapolis (J.L.G., C.N.); the Grantsburg Clinic, Grantsburg, Wis. (B.V.); the Departments of Medicine and Epidemiology, School of Veterinary Medicine, University of California, Davis (J.E.M.); the Department of Pathology, University of Maryland School of Medicine, Baltimore (J.S.D.); and the Department of Entomology, College of Agriculture, University of Minnesota, St. Paul (T.J.K., U.G.M.).
Address reprint requests to Dr. Goodman at Box 250 UMHC, 420 Delaware St. SE, Minneapolis, MN 55455.
References
Rikihisa Y. The tribe Ehrlichieae and Ehrlichial diseases. Clin Microbiol Rev 1991;4:286-308. [Free Full Text]
Chen S-M, Dumler JS, Bakken JS, Walker DH. Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease. J Clin Microbiol 1994;32:589-595. [Free Full Text]
Bakken JS, Dumler JS, Chen SM, Eckman MR, Van Etta LL, Walker DH. Human granulocytic ehrlichiosis in the upper Midwest United States: a new species emerging? JAMA 1994;272:212-218. [Abstract]
Human granulocytic ehrlichiosis -- New York, 1995. MMWR Morb Mortal Wkly Rep 1995;44:593-595. [Medline]
Telford SR III, Lepore TJ, Snow P, Warner CK, Dawson JE. Human granulocytic ehrlichiosis in Massachusetts. Ann Intern Med 1995;123:277-279. [Free Full Text]
Collins SJ, Gallo RC, Gallagher RE. Continuous growth and differentiation of human myeloid leukaemic cells in suspension culture. Nature 1977;270:347-349. [CrossRef][Medline]
Munderloh UG, Liu Y, Wang M, Chen C, Kurtti TJ. Establishment, maintenance and description of cell lines from the tick Ixodes scapularis. J Parasitol 1994;80:533-543. [CrossRef][Medline]
Madigan JE, Hietala S, Chalmers S, DeRock E. Seroepidemiologic survey of antibodies to Ehrlichia equi in horses of northern California. J Am Vet Med Assoc 1990;196:1962-1964. [Medline]
Goodman JL, Bradley JF, Ross AE, et al. Bloodstream invasion in early Lyme disease: results from a prospective, controlled, blinded study using the polymerase chain reaction. Am J Med 1995;99:6-12. [CrossRef][Medline]
Fishbein DB, Dawson JE, Robinson LE. Human ehrlichiosis in the United States, 1985 to 1990. Ann Intern Med 1994;120:736-743. [Free Full Text]
Fukuda T, Kitao T, Keida Y. Studies on the causative agent of "hyuganetsu" disease. I. Isolation of the agent and its inoculation trial in human beings. Med Biol 1954;32:200-209.
Maeda K, Markowitz N, Hawley RC, Ristic M, Cox D, McDade JE. Human infection with Ehrlichia canis, a leukocytic rickettsia. N Engl J Med 1987;316:853-856. [Medline]
Dawson JE, Anderson BE, Fishbein DB, et al. Isolation and characterization of an Ehrlichia sp. from a patient diagnosed with human ehrlichiosis. J Clin Microbiol 1991;29:2741-2745. [Free Full Text]
Standaert SM, Dawson JE, Schaffner W, et al. Ehrlichiosis in a golf-oriented retirement community. N Engl J Med 1995;333:420-425. [Free Full Text]
Anderson BE, Dawson JE, Jones DC, Wilson KH. Ehrlichia chaffeensis, a new species associated with human ehrlichiosis. J Clin Microbiol 1991;29:2838-2842. [Free Full Text]
Dumler JS, Asanovich KM, Bakken JS, Richter P, Kimsey R, Madigan JE. Serologic cross-reactions among Ehrlichia equi, Ehrlichia phagocytophila, and human granulocytic Ehrlichia. J Clin Microbiol 1995;33:1098-1103. [Abstract]
Madigan JE, Richter PJ Jr, Kimsey RB, Barlough JE, Bakken JS, Dumler JS. Transmission and passage in horses of the agent of human granulocytic ehrlichiosis. J Infect Dis 1995;172:1141-1144. [Medline]
Barlough JE, Madigan JE, DeRock E, Dumler JS, Bakken JS. Protection against Ehrlichia equi is conferred by prior infection with the human granulocytotropic ehrlichia (HGE agent). J Clin Microbiol 1995;33:3333-3334. [Abstract]
Johansson KE, Pettersson B, Uhlen M, Gunnarsson A, Malmqvist M, Olsson E. Identification of the causative agent of granulocytic ehrlichiosis in Swedish dogs and horses by direct solid phase sequencing of PCR products from the 16S rRNA gene. Res Vet Sci 1995;58:109-112. [CrossRef][Medline]
Madigan JE, Barlough JE, Dumler JS, Schankman NS, DeRock E. Equine granulocytic ehrlichiosis in Connecticut caused by an agent resembling the human granulocytotropic ehrlichia. J Clin Microbiol (in press).
Wamsley, H. L., Barbet, A. F.
(2008). In Situ Detection of Anaplasma spp. by DNA Target-Primed Rolling-Circle Amplification of a Padlock Probe and Intracellular Colocalization with Immunofluorescently Labeled Host Cell von Willebrand Factor. J. Clin. Microbiol.
46: 2314-2319
[Abstract][Full Text]
Granick, J. L., Reneer, D. V., Carlyon, J. A., Borjesson, D. L.
(2008). Anaplasma phagocytophilum infects cells of the megakaryocytic lineage through sialylated ligands but fails to alter platelet production. J Med Microbiol
57: 416-423
[Abstract][Full Text]
Wang, X., Cheng, Z., Zhang, C., Kikuchi, T., Rikihisa, Y.
(2007). Anaplasma phagocytophilum p44 mRNA Expression Is Differentially Regulated in Mammalian and Tick Host Cells: Involvement of the DNA Binding Protein ApxR. J. Bacteriol.
189: 8651-8659
[Abstract][Full Text]
Ge, Y., Rikihisa, Y.
(2007). Identification of Novel Surface Proteins of Anaplasma phagocytophilum by Affinity Purification and Proteomics. J. Bacteriol.
189: 7819-7828
[Abstract][Full Text]
Massung, R. F., Levin, M. L., Munderloh, U. G., Silverman, D. J., Lynch, M. J., Gaywee, J. K., Kurtti, T. J.
(2007). Isolation and Propagation of the Ap-Variant 1 Strain of Anaplasma phagocytophilum in a Tick Cell Line. J. Clin. Microbiol.
45: 2138-2143
[Abstract][Full Text]
Wang, X., Kikuchi, T., Rikihisa, Y.
(2007). Proteomic Identification of a Novel Anaplasma phagocytophilum DNA Binding Protein That Regulates a Putative Transcription Factor. J. Bacteriol.
189: 4880-4886
[Abstract][Full Text]
Huang, H., Wang, X., Kikuchi, T., Kumagai, Y., Rikihisa, Y.
(2007). Porin Activity of Anaplasma phagocytophilum Outer Membrane Fraction and Purified P44. J. Bacteriol.
189: 1998-2006
[Abstract][Full Text]
Blas-Machado, U., de la Fuente, J., Blouin, E. F., Almazan, C., Kocan, K. M., Mysore, J. V.
(2007). Experimental Infection of C3H/HeJ Mice with the NY18 Isolate of Anaplasma phagocytophilum. Vet Pathol
44: 64-73
[Abstract][Full Text]
Barbet, A. F., Lundgren, A. M., Alleman, A. R., Stuen, S., Bjoersdorff, A., Brown, R. N., Drazenovich, N. L., Foley, J. E.
(2006). Structure of the Expression Site Reveals Global Diversity in MSP2 (P44) Variants in Anaplasma phagocytophilum. Infect. Immun.
74: 6429-6437
[Abstract][Full Text]
Lin, Q., Zhang, C., Rikihisa, Y.
(2006). Analysis of Involvement of the RecF Pathway in p44 Recombination in Anaplasma phagocytophilum and in Escherichia coli by Using a Plasmid Carrying the p44 Expression and p44 Donor Loci. Infect. Immun.
74: 2052-2062
[Abstract][Full Text]
Sukumaran, B., Carlyon, J. A., Cai, J.-L., Berliner, N., Fikrig, E.
(2005). Early Transcriptional Response of Human Neutrophils to Anaplasma phagocytophilum Infection. Infect. Immun.
73: 8089-8099
[Abstract][Full Text]
Tate, C. M., Mead, D. G., Luttrell, M. P., Howerth, E. W., Dugan, V. G., Munderloh, U. G., Davidson, W. R.
(2005). Experimental Infection of White-Tailed Deer with Anaplasma phagocytophilum, Etiologic Agent of Human Granulocytic Anaplasmosis. J. Clin. Microbiol.
43: 3595-3601
[Abstract][Full Text]
Holden, K., Hodzic, E., Feng, S., Freet, K. J., Lefebvre, R. B., Barthold, S. W.
(2005). Coinfection with Anaplasma phagocytophilum Alters Borrelia burgdorferi Population Distribution in C3H/HeN Mice. Infect. Immun.
73: 3440-3444
[Abstract][Full Text]
de la Fuente, J., Massung, R. F., Wong, S. J., Chu, F. K., Lutz, H., Meli, M., von Loewenich, F. D., Grzeszczuk, A., Torina, A., Caracappa, S., Mangold, A. J., Naranjo, V., Stuen, S., Kocan, K. M.
(2005). Sequence Analysis of the msp4 Gene of Anaplasma phagocytophilum Strains. J. Clin. Microbiol.
43: 1309-1317
[Abstract][Full Text]
Garyu, J. W. A., Choi, K.-s., Grab, D. J., Dumler, J. S.
(2005). Defective Phagocytosis in Anaplasma phagocytophilum- Infected Neutrophils. Infect. Immun.
73: 1187-1190
[Abstract][Full Text]
Branger, S., Rolain, J. M., Raoult, D.
(2004). Evaluation of Antibiotic Susceptibilities of Ehrlichia canis, Ehrlichia chaffeensis, and Anaplasma phagocytophilum by Real-Time PCR. Antimicrob. Agents Chemother.
48: 4822-4828
[Abstract][Full Text]
IJdo, J. W., Mueller, A. C.
(2004). Neutrophil NADPH Oxidase Is Reduced at the Anaplasma phagocytophilum Phagosome. Infect. Immun.
72: 5392-5401
[Abstract][Full Text]
Lin, Q., Rikihisa, Y., Felek, S., Wang, X., Massung, R. F., Woldehiwet, Z.
(2004). Anaplasma phagocytophilum Has a Functional msp2 Gene That Is Distinct from p44. Infect. Immun.
72: 3883-3889
[Abstract][Full Text]
Bayard-Mc Neeley, M, Bansal, A, Chowdhury, I, Girao, G, Small, C B, Seiter, K, Nelson, J, Liveris, D, Schwartz, I, Mc Neeley, D F, Wormser, G P, Aguero-Rosenfeld, M E
(2004). In vivo and in vitro studies on Anaplasma phagocytophilum infection of the myeloid cells of a patient with chronic myelogenous leukaemia and human granulocytic ehrlichiosis. J. Clin. Pathol.
57: 499-503
[Abstract][Full Text]
Park, J.-h., Heo, E.-j., Choi, K.-s., Dumler, J. S., Chae, J.-s.
(2003). Detection of Antibodies to Anaplasma phagocytophilum and Ehrlichia chaffeensis Antigens in Sera of Korean Patients by Western Immunoblotting and Indirect Immunofluorescence Assays. CVI
10: 1059-1064
[Abstract][Full Text]
Liddell, A. M., Stockham, S. L., Scott, M. A., Sumner, J. W., Paddock, C. D., Gaudreault-Keener, M., Arens, M. Q., Storch, G. A.
(2003). Predominance of Ehrlichia ewingii in Missouri Dogs. J. Clin. Microbiol.
41: 4617-4622
[Abstract][Full Text]
Munderloh, U. G., Tate, C. M., Lynch, M. J., Howerth, E. W., Kurtti, T. J., Davidson, W. R.
(2003). Isolation of an Anaplasma sp. Organism from White-Tailed Deer by Tick Cell Culture. J. Clin. Microbiol.
41: 4328-4335
[Abstract][Full Text]
Choi, K.-S., Garyu, J., Park, J., Dumler, J. S.
(2003). Diminished Adhesion of Anaplasma phagocytophilum-Infected Neutrophils to Endothelial Cells Is Associated with Reduced Expression of Leukocyte Surface Selectin. Infect. Immun.
71: 4586-4594
[Abstract][Full Text]
Park, J., Choi, K. S., Dumler, J. S.
(2003). Major Surface Protein 2 of Anaplasma phagocytophilum Facilitates Adherence to Granulocytes. Infect. Immun.
71: 4018-4025
[Abstract][Full Text]
Barbet, A. F., Meeus, P. F. M., Belanger, M., Bowie, M. V., Yi, J., Lundgren, A. M., Alleman, A. R., Wong, S. J., Chu, F. K., Munderloh, U. G., Jauron, S. D.
(2003). Expression of Multiple Outer Membrane Protein Sequence Variants from a Single Genomic Locus of Anaplasma phagocytophilum. Infect. Immun.
71: 1706-1718
[Abstract][Full Text]
Scaife, H., Woldehiwet, Z., Hart, C. A., Edwards, S. W.
(2003). Anaplasma phagocytophilum Reduces Neutrophil Apoptosis In Vivo. Infect. Immun.
71: 1995-2001
[Abstract][Full Text]
Teng, C.-H., Palaniappan, R. U. M., Chang, Y.-F.
(2003). Cloning and Characterization of an Ehrlichia canis Gene Encoding a Protein Localized to the Morula Membrane. Infect. Immun.
71: 2218-2225
[Abstract][Full Text]
Massung, R. F., Slater, K. G.
(2003). Comparison of PCR Assays for Detection of the Agent of Human Granulocytic Ehrlichiosis, Anaplasma phagocytophilum. J. Clin. Microbiol.
41: 717-722
[Abstract][Full Text]
Maurin, M., Bakken, J. S., Dumler, J. S.
(2003). Antibiotic Susceptibilities of Anaplasma (Ehrlichia) phagocytophilum Strains from Various Geographic Areas in the United States. Antimicrob. Agents Chemother.
47: 413-415
[Abstract][Full Text]
Wen, B., Jian, R., Zhang, Y., Chen, R.
(2002). Simultaneous Detection of Anaplasma marginale and a New Ehrlichia Species Closely Related to Ehrlichia chaffeensis by Sequence Analyses of 16S Ribosomal DNA in Boophilus microplus Ticks from Tibet. J. Clin. Microbiol.
40: 3286-3290
[Abstract][Full Text]
Heo, E.-j., Park, J.-h., Koo, J.-r., Park, M.-s., Park, M.-y., Dumler, J. S., Chae, J.-s.
(2002). Serologic and Molecular Detection of Ehrlichia chaffeensis and Anaplasma phagocytophila (Human Granulocytic Ehrlichiosis Agent) in Korean Patients. J. Clin. Microbiol.
40: 3082-3085
[Abstract][Full Text]
MAGNARELLI, L. A., IJDO, J. W., SHERMAN, B. A., BUSHMICH, S. L., LEVY, S. A., FIKRIG, E.
(2002). Antibodies to granulocytic ehrlichiae in cattle from Connecticut. J Med Microbiol
51: 326-331
[Abstract][Full Text]
Bjoersdorff, A., Bagert, B., Massung, R. F., Gusa, A., Eliasson, I.
(2002). Isolation and Characterization of Two European Strains of Ehrlichia phagocytophila of Equine Origin. CVI
9: 341-343
[Abstract][Full Text]
Akkoyunlu, M., Malawista, S. E., Anguita, J., Fikrig, E.
(2001). Exploitation of Interleukin-8-Induced Neutrophil Chemotaxis by the Agent of Human Granulocytic Ehrlichiosis. Infect. Immun.
69: 5577-5588
[Abstract][Full Text]
Inokuma, H., Brouqui, P., Drancourt, M., Raoult, D.
(2001). Citrate Synthase Gene Sequence: a New Tool for Phylogenetic Analysis and Identification of Ehrlichia. J. Clin. Microbiol.
39: 3031-3039
[Abstract][Full Text]
Carter, S. E., Ravyn, M. D., Xu, Y., Johnson, R. C.
(2001). Molecular Typing of the Etiologic Agent of Human Granulocytic Ehrlichiosis. J. Clin. Microbiol.
39: 3398-3401
[Abstract][Full Text]
Lodes, M. J., Mohamath, R., Reynolds, L. D., McNeill, P., Kolbert, C. P., Bruinsma, E. S., Benson, D. R., Hofmeister, E., Reed, S. G., Houghton, R. L., Persing, D. H.
(2001). Serodiagnosis of Human Granulocytic Ehrlichiosis by Using Novel Combinations of Immunoreactive Recombinant Proteins. J. Clin. Microbiol.
39: 2466-2476
[Abstract][Full Text]
Thomas, V., Anguita, J., Barthold, S. W., Fikrig, E.
(2001). Coinfection with Borrelia burgdorferi and the Agent of Human Granulocytic Ehrlichiosis Alters Murine Immune Responses, Pathogen Burden, and Severity of Lyme Arthritis. Infect. Immun.
69: 3359-3371
[Abstract][Full Text]
Martin, M. E., Caspersen, K., Dumler, J. S.
(2001). Immunopathology and Ehrlichial Propagation Are Regulated by Interferon-{{gamma}} and Interleukin-10 in a Murine Model of Human Granulocytic Ehrlichiosis. Am. J. Pathol.
158: 1881-1888
[Abstract][Full Text]
Horowitz, H. W., Hsieh, T.-C., Aguero-Rosenfeld, M. E., Kalantarpour, F., Chowdhury, I., Wormser, G. P., Wu, J. M.
(2001). Antimicrobial Susceptibility of Ehrlichia phagocytophila. Antimicrob. Agents Chemother.
45: 786-788
[Abstract][Full Text]
Suksawat, J., Pitulle, C., Arraga-Alvarado, C., Madrigal, K., Hancock, S. I., Breitschwerdt, E. B.
(2001). Coinfection with Three Ehrlichia Species in Dogs from Thailand and Venezuela with Emphasis on Consideration of 16S Ribosomal DNA Secondary Structure. J. Clin. Microbiol.
39: 90-93
[Abstract][Full Text]
Brouqui, P., Salvo, E., Dumler, J. S., Raoult, D.
(2001). Diagnosis of Granulocytic Ehrlichiosis in Humans by Immunofluorescence Assay. CVI
8: 199-202
[Abstract][Full Text]
Banerjee, R., Anguita, J., Fikrig, E.
(2000). Granulocytic Ehrlichiosis in Mice Deficient in Phagocyte Oxidase or Inducible Nitric Oxide Synthase. Infect. Immun.
68: 4361-4362
[Abstract][Full Text]
Cao, W.-C., Gao, Y.-M., Zhang, P.-H., Zhang, X.-T., Dai, Q.-H., Dumler, J. S., Fang, L.-Q., Yang, H.
(2000). Identification of Ehrlichia chaffeensis by Nested PCR in Ticks from Southern China. J. Clin. Microbiol.
38: 2778-2780
[Abstract][Full Text]
Herron, M. J., Nelson, C. M., Larson, J., Snapp, K. R., Kansas, G. S., Goodman, J. L.
(2000). Intracellular Parasitism by the Human Granulocytic Ehrlichiosis Bacterium Through the P-Selectin Ligand, PSGL-1. Science
288: 1653-1656
[Abstract][Full Text]
Kalantarpour, F., Chowdhury, I., Wormser, G. P., Aguero-Rosenfeld, M. E.
(2000). Survival of the Human Granulocytic Ehrlichiosis Agent under Refrigeration Conditions. J. Clin. Microbiol.
38: 2398-2399
[Abstract][Full Text]
Byrd, R. P. Jr., Roy, T. M., Faul, J. L., Ruoss, S. J.
(2000). Ehrlichiosis in the United States. Chest
117: 1524-1525
[Full Text]
Banerjee, R., Anguita, J., Roos, D., Fikrig, E.
(2000). Cutting Edge: Infection by the Agent of Human Granulocytic Ehrlichiosis Prevents the Respiratory Burst by Down-Regulating gp91phox. J. Immunol.
164: 3946-3949
[Abstract][Full Text]
Akkoyunlu, M., Fikrig, E.
(2000). Gamma Interferon Dominates the Murine Cytokine Response to the Agent of Human Granulocytic Ehrlichiosis and Helps To Control the Degree of Early Rickettsemia. Infect. Immun.
68: 1827-1833
[Abstract][Full Text]
Shibata, S.-i., Kawahara, M., Rikihisa, Y., Fujita, H., Watanabe, Y., Suto, C., Ito, T.
(2000). New Ehrlichia Species Closely Related to Ehrlichia chaffeensis Isolated from Ixodes ovatus Ticks in Japan. J. Clin. Microbiol.
38: 1331-1338
[Abstract][Full Text]
Pusterla, N., Madigan, J. E., Asanovich, K. M., Chae, J.-S., Derock, E., Leutenegger, C. M., Pusterla, J. B., Lutz, H., Dumler, J. S.
(2000). Experimental Inoculation with Human Granulocytic Ehrlichia Agent Derived from High- and Low-Passage Cell Culture in Horses. J. Clin. Microbiol.
38: 1276-1278
[Abstract][Full Text]
Aguero-Rosenfeld, M. E., Kalantarpour, F., Baluch, M., Horowitz, H. W., McKenna, D. F., Raffalli, J. T., Hsieh, T.-c., Wu, J., Dumler, J. S., Wormser, G. P.
(2000). Serology of Culture-Confirmed Cases of Human Granulocytic Ehrlichiosis. J. Clin. Microbiol.
38: 635-638
[Abstract][Full Text]
Chang, Y.-F., McDonough, S. P., Chang, C.-F., Shin, K.-S., Yen, W., Divers, T.
(2000). Human Granulocytic Ehrlichiosis Agent Infection in a Pony Vaccinated with a Borrelia burgdorferi Recombinant OspA Vaccine and Challenged by Exposure to Naturally Infected Ticks. CVI
7: 68-71
[Abstract][Full Text]
Walls, J. J., Caturegli, P., Bakken, J. S., Asanovich, K. M., Dumler, J. S.
(2000). Improved Sensitivity of PCR for Diagnosis of Human Granulocytic Ehrlichiosis Using epank1 Genes of Ehrlichia phagocytophila-Group Ehrlichiae. J. Clin. Microbiol.
38: 354-356
[Abstract][Full Text]
Ijdo, J. W., Wu, C., Magnarelli, L. A., Fikrig, E.
(1999). Serodiagnosis of Human Granulocytic Ehrlichiosis by a Recombinant HGE-44-Based Enzyme-Linked Immunosorbent Assay. J. Clin. Microbiol.
37: 3540-3544
[Abstract][Full Text]
Nicholson, W. L., Castro, M. B., Kramer, V. L., Sumner, J. W., Childs, J. E.
(1999). Dusky-Footed Wood Rats (Neotoma fuscipes) as Reservoirs of Granulocytic Ehrlichiae (Rickettsiales: Ehrlichieae) in Northern California. J. Clin. Microbiol.
37: 3323-3327
[Abstract][Full Text]
Walls, J. J., Aguero-Rosenfeld, M., Bakken, J. S., Goodman, J. L., Hossain, D., Johnson, R. C., Dumler, J. S.
(1999). Inter- and Intralaboratory Comparison of Ehrlichia equi and Human Granulocytic Ehrlichiosis (HGE) Agent Strains for Serodiagnosis of HGE by the Immunofluorescent-Antibody Test. J. Clin. Microbiol.
37: 2968-2973
[Abstract][Full Text]
Munderloh, U. G., Jauron, S. D., Fingerle, V., Leitritz, L., Hayes, S. F., Hautman, J. M., Nelson, C. M., Huberty, B. W., Kurtti, T. J., Ahlstrand, G. G., Greig, B., Mellencamp, M. A., Goodman, J. L.
(1999). Invasion and Intracellular Development of the Human Granulocytic Ehrlichiosis Agent in Tick Cell Culture. J. Clin. Microbiol.
37: 2518-2524
[Abstract][Full Text]
Goodman, J. L.
(1999). Ehrlichiosis -- Ticks, Dogs, and Doxycycline. NEJM
341: 195-197
[Full Text]
Zhi, N., Ohashi, N., Rikihisa, Y.
(1999). Multiple p44 Genes Encoding Major Outer Membrane Proteins Are Expressed in the Human Granulocytic Ehrlichiosis Agent. J. Biol. Chem.
274: 17828-17836
[Abstract][Full Text]
van Dobbenburgh, A., van Dam, A. P., Fikrig, E.
(1999). Human Granulocytic Ehrlichiosis in Western Europe. NEJM
340: 1214-1216
[Full Text]
Comer, J. A., Nicholson, W. L., Olson, J. G., Childs, J. E.
(1999). Serologic Testing for Human Granulocytic Ehrlichiosis at a National Referral Center. J. Clin. Microbiol.
37: 558-564
[Abstract][Full Text]
Hodzic, E., Fish, D., Maretzki, C. M., De Silva, A. M., Feng, S., Barthold, S. W.
(1998). Acquisition and Transmission of the Agent of Human Granulocytic Ehrlichiosis by Ixodes scapularis Ticks. J. Clin. Microbiol.
36: 3574-3578
[Abstract][Full Text]
Walls, J. J., Asanovich, K. M., Bakken, J. S., Dumler, J. S.
(1998). Serologic Evidence of a Natural Infection of White-Tailed Deer with the Agent of Human Granulocytic Ehrlichiosis in Wisconsin and Maryland. CVI
5: 762-765
[Abstract][Full Text]
Horowitz, H. W., Kilchevsky, E., Haber, S., Aguero-Rosenfeld, M., Kranwinkel, R., James, E. K., Wong, S. J., Chu, F., Liveris, D., Schwartz, I.
(1998). Perinatal Transmission of the Agent of Human Granulocytic Ehrlichiosis. NEJM
339: 375-378
[Full Text]
Murphy, C. I., Storey, J. R., Recchia, J., Doros-Richert, L. A., Gingrich-Baker, C., Munroe, K., Bakken, J. S., Coughlin, R. T., Beltz, G. A.
(1998). Major Antigenic Proteins of the Agent of Human Granulocytic Ehrlichiosis Are Encoded by Members of a Multigene Family. Infect. Immun.
66: 3711-3718
[Abstract][Full Text]
Ijdo, J. W., Sun, W., Zhang, Y., Magnarelli, L. A., Fikrig, E.
(1998). Cloning of the Gene Encoding the 44-Kilodalton Antigen of the Agent of Human Granulocytic Ehrlichiosis and Characterization of the Humoral Response. Infect. Immun.
66: 3264-3269
[Abstract][Full Text]
Klein, M. B., Hayes, S. F., Goodman, J. L.
(1998). Monocytic Differentiation Inhibits Infection and Granulocytic Differentiation Potentiates Infection by the Agent of Human Granulocytic Ehrlichiosis. Infect. Immun.
66: 3410-3415
[Abstract][Full Text]
Reubel, G. H., Kimsey, R. B., Barlough, J. E., Madigan, J. E.
(1998). Experimental Transmission of Ehrlichia equi to Horses through Naturally Infected Ticks (Ixodes pacificus) from Northern California. J. Clin. Microbiol.
36: 2131-2134
[Abstract][Full Text]
Ravyn, M. D., Goodman, J. L., Kodner, C. B., Westad, D. K., Coleman, L. A., Engstrom, S. M., Nelson, C. M., Johnson, R. C.
(1998). Immunodiagnosis of Human Granulocytic Ehrlichiosis by Using Culture-Derived Human Isolates. J. Clin. Microbiol.
36: 1480-1488
[Abstract][Full Text]
Zhi, N., Ohashi, N., Rikihisa, Y., Horowitz, H. W., Wormser, G. P., Hechemy, K.
(1998). Cloning and Expression of the 44-Kilodalton Major Outer Membrane Protein Gene of the Human Granulocytic Ehrlichiosis Agent and Application of the Recombinant Protein to Serodiagnosis. J. Clin. Microbiol.
36: 1666-1673
[Abstract][Full Text]
Storey, J. R., Doros-Richert, L. A., Gingrich-Baker, C., Munroe, K., Mather, T. N., Coughlin, R. T., Beltz, G. A., Murphy, C. I.
(1998). Molecular Cloning and Sequencing of Three Granulocytic Ehrlichia Genes Encoding High-Molecular-Weight Immunoreactive Proteins. Infect. Immun.
66: 1356-1363
[Abstract][Full Text]
Massung, R. F., Slater, K., Owens, J. H., Nicholson, W. L., Mather, T. N., Solberg, V. B., Olson, J. G.
(1998). Nested PCR Assay for Detection of Granulocytic Ehrlichiae. J. Clin. Microbiol.
36: 1090-1095
[Abstract][Full Text]
Nicholson, W. L., Muir, S., Sumner, J. W., Childs, J. E.
(1998). Serologic Evidence of Infection with Ehrlichia spp. in Wild Rodents (Muridae: Sigmodontinae) in the United States. J. Clin. Microbiol.
36: 695-700
[Abstract][Full Text]
Nadelman, R. B., Horowitz, H. W., Hsieh, T.-c., Wu, J. M., Aguero-Rosenfeld, M. E., Schwartz, I., Nowakowski, J., Varde, S., Wormser, G. P.
(1997). Simultaneous Human Granulocytic Ehrlichiosis and Lyme Borreliosis. NEJM
337: 27-30
[Full Text]
Aguero-Rosenfeld, M. E., Horowitz, H. W., Wormser, G. P., McKenna, D. F., Nowakowski, J., Munoz, J., Dumler, J. S.
(1996). Human Granulocytic Ehrlichiosis: A Case Series from a Medical Center in New York State. ANN INTERN MED
125: 904-908
[Abstract][Full Text]
(1996). THE AGENT OF HUMAN GRANULOCYTIC EHRLICHIOSIS IS ISOLATED. JWatch General
1996: 7-7
[Full Text]
Schaffner, W., Standaert, S. M.
(1996). Ehrlichiosis -- In Pursuit of an Emerging Infection. NEJM
334: 262-263
[Full Text]
A correction has been published: N Engl J Med 1996;335(5):361.
