Background An activating mutation of the receptor for parathyroidhormone (PTH) and parathyroid hormonerelated peptide(PTHrP) was recently found in a patient with Jansen's metaphysealchondrodysplasia, a rare form of short-limbed dwarfism associatedwith hypercalcemia and normal or low serum concentrations ofthe two hormones. To investigate this and other activating mutationsand to refine the classification of this unusual disorder, weanalyzed genomic DNA from six additional patients with Jansen'sdisease.
Methods Exons encoding the PTHPTHrP receptor were amplifiedby the polymerase chain reaction (PCR), and the products wereanalyzed by gel electrophoresis or direct nucleotide-sequenceanalysis. Nucleotide changes were confirmed by restriction-enzymedigestion of genomic DNA or the PCR products.
Results The previously reported mutation, which changes a histidineat position 223 to arginine (H223R), was found in genomic DNAfrom three of the six patients but not in DNA from their healthyrelatives or 45 unrelated normal subjects. A novel missensemutation that changes a threonine in the receptor's sixth membrane-spanningregion to proline (T410P) was identified in another patientbut not in 62 normal subjects. In two patients with radiologicevidence of Jansen's metaphyseal chondrodysplasia but less severehypercalcemia, no receptor mutations were detected. In COS-7cells expressing PTHPTHrP receptors with the T410P orH223R mutation, basal cyclic AMP accumulation was four to sixtimes higher than in cells expressing wild-type receptors.
Conclusions The expression of constitutively active PTHPTHrPreceptors in kidney, bone, and growth-plate chondrocytes providesa plausible genetic explanation for mineral-ion abnormalitiesand metaphyseal changes in patients with Jansen's disease.
Jansen's metaphyseal chondrodysplasia1 is a rare form of short-limbeddwarfism caused by severe abnormalities of the growth plates.The condition is typically associated with asymptomatic hypercalcemiaand hypercalciuria due to increased bone resorption, which developsduring the first months of life, despite normal or low serumconcentrations of parathyroid hormone (PTH) and parathyroidhormonerelated peptide (PTHrP).2,3,4,5,6,7,8,9,10 Bothpeptides mediate their biologic actions through the PTHPTHrPreceptor, which belongs to a distinct family of G proteincoupledreceptors,11 has dual signaling properties, and is expressedin many fetal and adult tissues, although most abundantly inkidney, bone, and growth-plate cartilage.12,13,14,15 We recentlyidentified a heterozygous mutation of the gene encoding thePTHPTHrP receptor in a patient with Jansen's metaphysealchondrodysplasia.16 The mutation changes a histidine residueto an arginine residue (H223R) (Figure 1), causing constitutive,ligand-independent activation of the receptor. We have now analyzedthe genomic DNA from six additional patients with this diseaseto determine the frequency of the H223R mutation and to searchfor other activating mutations.
Figure 1. Diagram of the Human PTHPTHrP Receptor.
The gold circles show the locations of the amino-acid substitutions identified in genomic DNA from patients with Jansen's metaphyseal chondrodysplasia. H denotes histidine, R arginine, T threonine, and P proline.
Methods
Laboratory Studies
Serum PTH and PTHrP were measured by immunoradiometric assayand radioimmunoassay, respectively (Incstar, Stillwater, Minn.).Serum osteocalcin, bone-specific alkaline phosphatase activity,25-hydroxyvitamin D, and 1,25-dihydroxyvitamin D were measuredas described elsewhere,17 and serum calcium and phosphorus weremeasured by standard techniques with an automated analyzer.
Patients
All seven patients with Jansen's metaphyseal chondrodysplasiahave been described previously.3,6,7,8,10,16,18,19,20 Selectedclinical and laboratory findings are shown in Table 1. Becauseof the rarity of the disease, the two patients in Family 3 aredescribed here in some detail.
Table 1. Clinical and Laboratory Findings in Seven Patients with Jansen's Metaphyseal Chondrodysplasia.
The index patient in Family 3 (Patient 3A) received a diagnosisof achondroplasia in childhood.20 Her parents were of averageheight and phenotypically normal; both died from causes unrelatedto changes in calcium homeostasis. In 1995, at the age of 49years, the patient's height was 130 cm; the ratio of the uppersegment to the lower segment was 1.58 (mean value for normalwomen, 1.01). She was dysmorphic, with a small degree of micrognathia,and her skin was very dry and scaly. The laboratory findingswere as follows: serum calcium concentration, 11.7 mg per deciliter(2.93 mmol per liter); phosphorus concentration, 2.9 mg perdeciliter (0.9 mmol per liter); PTH concentration, <0.4 pgper milliliter (normal range, 15 to 50); PTHrP concentration,<5 pmol per liter (normal value, <5); osteocalcin concentration,18 ng per milliliter (normal range, 8 to 12); bone-specificalkaline phosphatase activity, 235 U per liter (normal range,10 to 22); 25-hydroxyvitamin D concentration, 9 ng per milliliter(22 nmol per liter) (normal range, 10 to 40 ng per milliliter[25 to 100 nmol per liter]); and 1,25-dihydroxyvitamin D concentration,39 pg per milliliter (94 pmol per liter) (normal range, 15 to40 pg per milliliter [36 to 96 pmol per liter]).
Her daughter (Patient 3B) was delivered at term by cesareansection because of cephalopelvic disproportion. The weight atbirth was 3480 g, the length was 49 cm, the ratio of the uppersegment to the lower segment was 1.54 (normal value at birth,1.70), and the head circumference was 34.5 cm. The infant hadtachypnea and cyanosis due to micrognathia, which were relievedby oral intubation. Except for marked bowing of both femurs,no other abnormalities were noted on physical examination. Atbirth and on day 3, the infant's serum calcium and phosphorusconcentrations were normal for her age, but the serum alkalinephosphatase activity was 385 U per liter (normal range for thisage, 73 to 264). Radiographic studies showed cupping and irregularityof all long bones, marked cortical lucencies with poor definitionof the bony cortex, and marked subperiosteal resorption. Bilateraltibial fractures were present, the skull was undermineralized,and the mandible was hypoplastic.
At the age of six months, the patient's serum calcium concentrationranged from 11.8 to 12.4 mg per deciliter (2.95 to 3.10 mmolper liter), the phosphorus concentration ranged from 2.8 to3.6 mg per deciliter (0.9 to 1.2 mmol per liter), and the PTHconcentration was 0.2 µl-eq per milliliter (normal range,2.4 to 5.9). No other laboratory studies were performed until1995. At 1 1/2 years of age, the patient underwent frontal orbitaladvancement for bicoronal synostosis.
In 1995, at the age of 12 years, the patient's height was 104cm (36 cm below the fifth percentile), and her weight was 27kg (4 kg below the fifth percentile). Her pubic hair and breastdevelopment were Tanner stage 2 and 3, respectively. She hadabnormalities characteristic of Jansen's metaphyseal chondrodysplasia,including fronto-orbital asymmetry, hypertelorism, and mandibularhypoplasia. Her skin was dry and scaly, and her hair was thin.She was a B student in an age-appropriate grade.
The laboratory values were as follows: serum calcium concentration,11.2 to 11.5 mg per deciliter (2.80 to 2.87 mmol per liter);phosphorus concentration, 2.0 to 3.1 mg per deciliter (0.6 to1.0 mmol per liter); PTH concentration, <0.4 pg per milliliter;PTHrP concentration, <5 pmol per liter; osteocalcin concentration,97 ng per milliliter (age-adjusted normal range, 8 to 18); bone-specificalkaline phosphatase activity, 319 U per liter (age-adjustednormal range, 10 to 50); 25-hydroxyvitamin D concentration,14 ng per milliliter (35 nmol per liter); and 1,25-dihydroxyvitaminD concentration, 42 pg per milliliter (101 pmol per liter).
Identification of Mutations
All coding exons of the gene encoding the PTHPTHrP receptorwere amplified from blood leukocyte genomic DNA with the useof the polymerase chain reaction (PCR). The products were analyzedby temperature-gradient gel electrophoresis or direct nucleotide-sequenceanalysis.21
The nucleotide changes that cause the H223R mutation in exonM2 and a threonine-to-proline mutation in exon M6/7 (residue410 of the PTHPTHrP receptor) were confirmed by restriction-enzymedigestion. For this purpose, smaller portions of either exonwere amplified by PCR with the use of different reverse primersfrom those described previously.21 The reverse primer for exonM2, 5'CTCCTCCTCGGTGAGGCGCTCA3', which was synthesized with aGC clamp,21 generated a 206-bp PCR product; if adenine at position696 was mutated to guanosine, restriction-enzyme digestion withSph I resulted in two DNA fragments of 58 and 148 bp. The reverseprimer for exon M6/7, 5'GTCCCTGAGACCTCGGTGTAT3', generated a135-bp PCR product. Restriction-enzyme digestion with Aci Iresulted in two DNA fragments of 30 and 105 bp; if adenine atposition 1256 was mutated to cytosine, Aci I further digestedthe 105-bp fragment into 28- and 77-bp fragments. The H223Rmutation was also confirmed by Southern blot analysis of genomicDNA.16
In Vitro Evaluation of Wild-Type and Mutant PTHPTHrP Receptors
Mutations were introduced into the complementary DNA encodingthe wild-type human PTHPTHrP receptor (HKrk) and theversion of the receptor containing a human influenza virus hemagglutinin-epitopetag.16 Plasmid DNA from at least two independent bacterial colonies,each encoding the respective mutant PTHPTHrP receptor,was expressed in COS-7 cells.
Syntheses of [Nle8, Nle18, Tyr34] bovine PTH (134) amideand [Tyr36] human PTHrP (136) amide, radioreceptor assays,studies of the accumulation of PTH- and PTHrP-induced cyclicAMP and inositol phosphate, and studies of antihemagglutininbinding were performed as described elsewhere.16,21
Results
We recently reported the identification of a heterozygous H223Rmutation of the gene for the PTHPTHrP receptor in a patientwith Jansen's metaphyseal chondrodysplasia (Patient 1, Table 1and Figure 2) that results in constitutive, ligand-independentaccumulation of cyclic AMP in vitro.16 This mutation is causedby an adenine-to-guanine transition that introduces a novelSph I restriction site in exon M2 of the gene for the PTHPTHrPreceptor. PCR-amplified genomic DNA from six additional patientswith biochemical or radiologic evidence of Jansen's diseasewas therefore first screened by Sph I digestion. The PCR productsfrom the affected patients in Families 1, 2, and 3 yielded,in addition to the undigested PCR product, 58- and 148-bp DNAfragments (Figure 2). The heterozygous adenine-to-guanine transitionwas confirmed by direct nucleotide-sequence analysis and Southernblot analysis of Sph I-digested genomic DNA (data not shown).This mutation was not detected in unaffected first-degree relativesof the patients in Families 1 and 2 (Figure 2), in three otherpreviously described patients with Jansen's metaphyseal chondrodysplasia(Patients 4, 5, and 6), or in 45 normal subjects (data not shown).In Family 3, the H223R mutation was identified in the affectedmother (Patient 3A) and her affected daughter (Patient 3B) butnot in the healthy father.
Figure 2. Analysis of Genomic DNA from Patients with Jansen's Metaphyseal Chondrodysplasia and the H223R Mutation in the PTHPTHrP Receptor.
PCR products were amplified as described in the Methods section and digested with SphI before electrophoresis through a 3 percent MetaPhor gel (FMC Bioproducts, Rockland, Me.) and ethidium bromide staining. The squares denote male family members, and the circles female family members. Unaffected members are indicated by open symbols, and affected members by half-solid symbols.
To search for mutations of the PTHPTHrP receptor in Patients4, 5, and 6, all 14 coding exons were amplified by PCR of genomicDNA, and the products were analyzed by direct nucleotide-sequenceanalysis and temperature-gradient gel electrophoresis (in Patients5 and 6) or by nucleotide-sequence analysis alone (in Patient4).21 In Patient 4, a heterozygous adenine-to-cytosine transversionwas identified in exon M6/7 (Figure 3A), which corresponds toposition 1256 of the complementary DNA encoding the human PTHPTHrPreceptor. This mutation, which was confirmed by temperature-gradientgel electrophoresis, introduces a novel restriction site forAci I (Figure 3B) and changes a conserved threonine at position410 to proline (Figure 1).
Figure 3. Identification of the T410P Mutation in the PTHPTHrP Receptor.
Panel A shows the results of direct nucleotide-sequence analysis of PCR-amplified exon M6/7 of the PTHPTHrP receptor gene from a normal subject (Normal) and Patient 4 (Mutant). Panel B shows the results of Aci I digestion of PCR-amplified genomic DNA and electrophoresis of the resulting DNA fragments through a 3 percent MetaPhor gel, with ethidium bromide staining. Lane 1 shows DNA size markers, lane 2 shows undigested PCR product, lane 3 shows Aci I-digested PCR product from Patient 4, and lane 4 shows Aci I-digested PCR product from a normal subject. The relevant DNA size markers are indicated at the left, and the sizes of the undigested and digested PCR products at the right. The PCR-amplified portion of exon M6/7, the locations of the Aci I restriction sites, and the sizes of the resulting DNA fragments are shown at the bottom. (Aci I) is generated by the heterozygous nucleotide exchange that causes the T410P mutation.
For Patients 5 and 6, missense mutations were ruled out by temperature-gradientgel electrophoresis and direct nucleotide-sequence analysisin all coding exons of the gene for the PTHPTHrP receptor.18,19Patient 6 was heterozygous for a frequent exon M7 polymorphism.22
COS-7 cells expressing the mutant PTHPTHrP receptor,HKrk-T410P, accumulated about four times more cyclic AMP thancells expressing the wild-type receptor (mean ±SE, 45.3±1.5vs. 12.1±0.3 pmol per well per 15 minutes) (Figure 4A,Figure 4B, Figure 4C, and Figure 4D). This degree of ligand-independent,constitutive activation was lower (P<0.001) than that causedby the H223R mutation (67.2±3.5 pmol per well per 15minutes).16 The maximal accumulation of cyclic AMP in responseto either PTH or PTHrP was higher in cells expressing receptorswith the T410P mutation than in those with receptors containingthe H223R mutation. Basal inositol phosphate accumulation wassimilar in cells expressing wild-type and mutant PTHPTHrPreceptors. Unlike the cells expressing the H223R mutant receptor,however, those expressing the T410P mutant receptor had increasedinositol phosphate accumulation when stimulated by either PTHor PTHrP.
Figure 4. Expression of Wild-Type PTHPTHrP Receptor (HKrk) and Mutant PTHPTHrP Receptors (HKrk-H223R and HKrk-T410P) in COS-7 Cells.
Panel A shows the basal accumulation of cyclic AMP (cAMP) in cells transiently transfected with increasing doses (0.3 to 650 ng per well) of plasmid DNA encoding wild-type or mutant PTHPTHrP receptors; in all subsequent experiments, the cells were transfected with 110 ng per well. Panel B shows the basal cAMP accumulation in cells transfected with complementary DNA encoding wild-type or mutant PTHPTHrP receptors. Panel C shows the accumulation of cAMP in COS-7 cells expressing each of the receptors after stimulation with 10-12 M to 10-7 M PTH. Data are shown as percentages of the maximal accumulation of cAMP after stimulation with maximal concentrations of the PTH of cells expressing HKrk. The same results were obtained when PTHrP was used (data not shown). Panel D shows the accumulation of inositol phosphate in COS-7 cells expressing each of the receptors after stimulation with 10-6 M PTH. The results were similar when PTHrP was used (data not shown). There was no difference in basal inositol phosphate accumulation between cells expressing the wild-type receptor and cells expressing the two mutant receptors. Data are the mean (±SE) results of at least three independent experiments, each performed in duplicate.
The epitope-tagged version of the T410P mutant receptor showedonly 31±4 percent of maximal cell-surface expression,which is slightly lower than that previously reported for cellsexpressing the H223R mutant receptor.16 Scatchard analysis ofthe results from cells expressing either wild-type or mutantPTHPTHrP receptors without the hemagglutinin-epitopetag confirmed that the number of mutant receptors per cell wasone third to one fifth the number of wild-type receptors (datanot shown). Despite these reduced levels of mutant receptorson the cell surface, the maximal specific binding of radiolabeledPTH to wild-type and mutant PTHPTHrP receptors was similar(HKrk, 14.3±4.5 percent; HKrk-H223R, 17.4±0.7percent; and HKrk-T410P, 13.0±3.6 percent). The mutantreceptors had an apparent binding affinity for PTH and PTHrPthat was about two times higher than that of the wild-type receptors(HKrk, 10.3±4.8 nM; HKrk-H223R, 4.1±1.0 nM; andHKrk-T410P, 4.0±0.5 nM).
Discussion
A heterozygous mutation of the PTHPTHrP receptor, previouslyreported in one patient with Jansen's metaphyseal chondrodysplasia,was identified in genomic DNA from three additional, unrelatedpatients but not in their healthy first-degree relatives or45 normal subjects. In Family 3, the mutation was found in theaffected mother and her affected daughter but not in the healthyfather. Taken together, these findings suggest that Jansen'sdisease is usually caused by germ-line mutations in the genefor the PTHPTHrP receptor and that the disease is inheritedin an autosomal dominant fashion, as proposed previously.5,20,23
A second activating mutation in the PTHPTHrP receptor,previously ruled out in 62 normal subjects,22 was identifiedin one patient with Jansen's metaphyseal chondrodysplasia (Patient4). The mutated residue, T410, is conserved in all members ofthe family of calcitonin and PTH receptors in mammals.11 Thisresidue has also been found at a similar position in the 2-adrenergicreceptor, and its replacement by other residues resulted inconstitutive activation of the receptor.24
The T410P mutation also led to receptor activation that wasindependent of PTH and PTHrP. Furthermore, in comparison withPTHPTHrP receptors containing the H223R mutation, thosecontaining the T410P mutation had significantly higher ligand-stimulatedaccumulation of cyclic AMP and inositol phosphate. Despite thesedifferences in receptor function, the manifestations of thedisease were similar in the affected patients.
In two other patients with Jansen's metaphyseal chondrodysplasia(Patients 5 and 6), mutations of the PTHPTHrP receptorwere ruled out by temperature-gradient gel electrophoresis anddirect nucleotide-sequence analysis in all coding exons.18,19The course of the disease in these patients differed from thatin the patients with activating receptor mutations. The patientswithout these mutations had less severe hypercalcemia (Table 1),normal serum phosphorus and alkaline phosphatase activity,18,19and normal serum PTH concentrations and urinary cyclic AMP excretion(in Patient 5; data not shown). Furthermore, whereas the adultheight of Patient 6 was similar to that of other adults withJansen's disease, Patient 5 reached an adult height that wasalmost normal, and unlike the findings in other patients,4,7his radiologic growth-plate abnormalities did not improve afterpuberty.19 It thus appears possible that Jansen's metaphysealchondrodysplasia comprises two distinct genetic disorders orthat milder forms of the disease represent somatic mosaicismaffecting primarily the growth-plate cartilage, with normalgenes for PTHPTHrP receptors in blood cells.
In patients with Jansen's metaphyseal chondrodysplasia, asymptomatic,ligand-independent hypercalcemia is most likely caused by constitutiveactivation of PTHPTHrP receptors. These G proteincoupledreceptors with dual signaling properties are activated by PTHand PTHrP11 and are normally expressed at high levels in thekidneys and bone.12,13,14,15 Even if the receptors are expressedat reduced levels, the presence of activated mutant receptorsin these two tissues provides the most plausible explanationfor the ligand-independent abnormalities of mineral-ion homeostasisand bone turnover in patients with this disorder.2,3,4,6,7,8,9,10The abnormalities appear to subside later in life without treatment.
PTHPTHrP receptors are also abundantly expressed in growth-platechondrocytes at the transition between proliferation and hypertrophyand are thought to mediate, possibly through cyclic AMP, theparacrine or autocrine actions of PTHrP produced by adjacentperichondrial cells.14,25,26,27 Mice that lack PTHrP or PTHPTHrPreceptors have severe growth-plate abnormalities,28,29 and transgenicmice with an overproduction of PTHrP targeted to proliferatingchondrocytes have dwarfism as a result of impaired terminalchondrocyte differentiation and delayed mineralization.30 Onthe basis of these in vitro and in vivo findings, it appearslikely that constitutive activation of PTHPTHrP receptorsin chondrocytes causes growth-plate abnormalities that leadto the typical radiologic2,7,8,9,10,20 and histologic2,3,31findings in Jansen's metaphyseal chondrodysplasia and resultin short-limbed dwarfism.
Because of the widespread expression of PTHrP and its receptor,our findings may have implications for other biologic functionsmediated by the PTHPTHrP receptor. Patient 3A was unableto breast-feed, and her skin, as well as that of her affecteddaughter, was dry and scaly. PTHrP is found in the epidermis,26and its expression under the control of the keratin-14 promoterresults in abnormal development of the mammary-duct system.32These clinical findings may be related to constitutively activatedPTHPTHrP receptors in dermis and mammary epithelial cells,respectively. Patients with Jansen's disease have no obviousabnormalities in other systems, indicating that PTHPTHrPreceptors in these systems serve less crucial biologic functionsor that these functions are not all mediated by cyclic AMP.
In summary, the expression of activated PTHPTHrP receptorsin the kidneys, bone, and growth-plate chondrocytes most likelycauses ligand-independent hypercalcemia and short-limbed dwarfism,which are the two most prominent features of Jansen's metaphysealchondrodysplasia. These findings may have implications for understandingthe broader biologic role of PTHrP and the PTHPTHrP receptor,as well as their roles in other disorders.
Supported by a grant (R01 46718) from the National Instituteof Diabetes and Digestive and Kidney Diseases.
We are indebted to Drs. D.S. Rao and W. Kupin, Detroit, andto Dr. J.C. Leyhane, Delmar, New York, for providing blood samplesand clinical information; and to Dr. A.K. Poznanski, Chicago,for helpful discussions about the radiologic findings in Jansen'smetaphyseal chondrodysplasia.
Source Information
From the Endocrine Unit, Department of Medicine (E.S., G.S.J., H.J.), and the Children's Service (H.J.), Massachusetts General Hospital and Harvard Medical School, Boston; the Pediatric Nephrology and Mineral Metabolism Unit, Northwestern University Medical School and Children's Memorial Hospital, Chicago (C.B.L.); the Bone and Mineral Research Laboratory, Henry Ford Hospital, Detroit (A.M.P.); Fukushima Medical College, Fukushima, Japan (S.K.); and the Department of Orthopaedic Surgery and Endocrinology, Hospital for Sick Children and University of Toronto, Toronto (S.W.K., W.G.C.).
Address reprint requests to Dr. Jüppner at the Endocrine Unit, Wellman 5, Massachusetts General Hospital, Boston, MA 02114.
References
Jansen M. Über atypische Chondrodystrophie (Achondroplasie) und über eine noch nicht beschriebene angeborene Wachstumsstörung des Knochensystems: Metaphysäre Dysostosis. Orthop Chir 1934;61:253-86.
Cameron JAP, Young WB, Sissons HA. Metaphysial dysostosis: report of a case. J Bone Joint Surg Br 1954;36:622-629. [Medline]
Gram PB, Fleming JL, Frame B, Fine G. Metaphyseal chondrodysplasia of Jansen. J Bone Joint Surg Am 1959;41:951-959. [Free Full Text]
de Haas WHD, de Boer W, Griffioen F. Metaphysial dysostosis: a late follow-up of the first reported case. J Bone Joint Surg Br 1969;51:290-299.
Holthusen W, Holt JF, Stoeckenius M. The skull in metaphyseal chondrodysplasia type Jansen. Pediatr Radiol 1975;3:137-144. [CrossRef][Medline]
Rao DS, Frame B, Reynolds WA, Parfitt AM. Hypercalcemia in metaphyseal chondrodysplasia of Jansen (MCD): an enigma. In: Norman AW, Schaefer K, von Herrath D, et al., eds. Vitamin D, basic research and its clinical application. Berlin, Germany: Walter de Gruyter, 1979:1173-6.
Frame B, Poznanski AK. Conditions that may be confused with rickets. In: DeLuca HF, Anast CS, eds. Pediatric diseases related to calcium. New York: Elsevier, 1980:269-89.
Kessel D, Hall CM, Shaw DG. Two unusual cases of nephrocalcinosis in infancy. Pediatr Radiol 1992;22:470-471. [CrossRef][Medline]
Kruse K, Schütz C. Calcium metabolism in the Jansen type of metaphyseal dysplasia. Eur J Pediatr 1993;152:912-915. [CrossRef][Medline]
Jüppner H. Molecular cloning and characterization of a parathyroid hormone/parathyroid hormone-related peptide receptor: a member of an ancient family of G protein-coupled receptors. Curr Opin Nephrol Hypertens 1994;3:371-378. [CrossRef][Medline]
Urena P, Kong XF, Abou-Samra AB, et al. Parathyroid hormone (PTH)/PTH-related peptide receptor messenger ribonucleic acids are widely distributed in rat tissues. Endocrinology 1993;133:617-623. [Abstract]
Tian J, Smogorzewski M, Kedes L, Massry SG. Parathyroid hormone/parathyroid hormone related protein receptor messenger RNA is present in many tissues besides the kidney. Am J Nephrol 1993;13:210-213. [Medline]
Lee K, Deeds JD, Chiba S, Un-No M, Bond AT, Segre GV. Parathyroid hormone induces sequential c-fos expression in bone cells in vivo: in situ localization of its receptor and c-fos messenger ribonucleic acids. Endocrinology 1994;134:441-450. [Abstract]
Lee K, Brown D, Ureña P, et al. Localization of parathyroid hormone-parathyroid hormone-related peptide receptor mRNA in kidney. Am J Physiol 1996;270:F186-F191. [Free Full Text]
Schipani E, Kruse K, Jüppner H. A constitutively active mutant PTH-PTHrP receptor in Jansen-type metaphyseal chondrodysplasia. Science 1995;268:98-100. [Free Full Text]
Reed A, Haugen M, Pachman LM, Langman CB. Abnormalities in serum osteocalcin values in children with chronic rheumatic diseases. J Pediatr 1990;116:574-580. [CrossRef][Medline]
Gordon SL, Varano LA, Alandete A, Maisels MJ. Jansen's metaphyseal dysostosis. Pediatrics 1976;58:556-560. [Abstract]
Kikuchi S, Hasue M, Watanabe M, Hasebe K. Metaphysial dysostosis (Jansen type): report of a case with long follow-up. J Bone Joint Surg Br 1976;58:102-106. [Medline]
Charrow J, Poznanski AK. The Jansen type of metaphyseal chondrodysplasia: confirmation of dominant inheritance and review of radiographic manifestations in the newborn and adult. Am J Med Genet 1984;18:321-327. [Medline]
Schipani E, Weinstein LS, Bergwitz C, et al. Pseudohypoparathyroidism type lb is not caused by mutations in the coding exons of the human parathyroid hormone (PTH)/PTH-related peptide receptor gene. J Clin Endocrinol Metab 1995;80:1611-1621. [Free Full Text]
Schipani E, Hustmyer FG, Bergwitz C, Jüppner H. Polymorphism in exon M7 of the PTHR gene. Hum Mol Genet 1994;3:1210-1210. [Free Full Text]
Lenz WD. Discussion. In: Bergsma D, ed. The First Conference on the Clinical Delineation of Birth Defects. Part 4. Skeletal dysplasias. Vol. 5. No. 4 of Birth defects: original article series. New York: National Foundation, 1969:71-2.
Ren Q, Kurose H, Lefkowitz RJ, Cotecchia S. Constitutively active mutants of the 2-adrenergic receptor. J Biol Chem 1993;268:16483-16487. [Erratum, J Biol Chem 1994;269:1566.] [Free Full Text]
Iwamoto M, Jikko A, Murakami H, et al. Changes in parathyroid hormone receptors during chondrocyte cytodifferentiation. J Biol Chem 1994;269:17245-17251. [Free Full Text]
Lee K, Deeds JD, Segre GV. Expression of parathyroid hormone-related peptide and its receptor messenger ribonucleic acid during fetal development of rats. Endocrinology 1995;136:453-463. [Abstract]
Jikko A, Murahami H, Yan W, et al. Effects of cyclic adenosine 3',5'-monophosphate on chondrocyte terminal differentiation and cartilage-matrix calcification. Endocrinology 1996;137:122-128. [Abstract]
Karaplis AC, Luz A, Glowacki J, et al. Lethal skeletal dysplasia from targeted disruption of the parathyroid hormone-related peptide gene. Genes Dev 1994;8:277-289. [Free Full Text]
Lanske B, Karaplis AC, Lee K, et al. PTH/PTHrP receptor in early development and Indian hedgehog-regulated bone growth. Science 1996;273:663-666. [Abstract]
Weir E, Philbrick W, Neff L, Amling M, Baron R, Broadus A. Targeted overexpression of parathyroid hormone-related peptide in chondrocytes causes skeletal dysplasia and delayed osteogenesis. J Bone Miner Res 1995;10:Suppl 1:S157-S157.abstract
Jaffe HL. Metabolic, degenerative, and inflammatory diseases of bones and joints. Philadelphia: Lea & Febiger, 1972:222-6.
Wysolmerski JJ, McCaughern-Carucci JF, Daifotis AG, Broadus AE, Philbrick WM. Overexpression of parathyroid hormone-related protein or parathyroid hormone in transgenic mice impairs branching morphogenesis during mammary gland development. Development 1995;121:3539-3547. [Abstract]
Ono, N., Nakashima, K., Rittling, S. R., Schipani, E., Hayata, T., Soma, K., Denhardt, D. T., Kronenberg, H. M., Ezura, Y., Noda, M.
(2008). Osteopontin Negatively Regulates Parathyroid Hormone Receptor Signaling in Osteoblasts. J. Biol. Chem.
283: 19400-19409
[Abstract][Full Text]
Hoogendam, J., Farih-Sips, H., Wynaendts, L. C., Lowik, C. W. G. M., Wit, J. M., Karperien, M.
(2007). Novel Mutations in the Parathyroid Hormone (PTH)/PTH-Related Peptide Receptor Type 1 Causing Blomstrand Osteochondrodysplasia Types I and II. J. Clin. Endocrinol. Metab.
92: 1088-1095
[Abstract][Full Text]
Rey, A., Manen, D., Rizzoli, R., Caverzasio, J., Ferrari, S. L.
(2006). Proline-rich Motifs in the Parathyroid Hormone (PTH)/PTH-related Protein Receptor C Terminus Mediate Scaffolding of c-Src with beta-Arrestin2 for ERK1/2 Activation. J. Biol. Chem.
281: 38181-38188
[Abstract][Full Text]
Calvi, L. M.
(2006). Hematopoietic-Osteoblastic Interactions in the Hematopoietic Stem Cell Niche. IBMS BoneKEy
3: 10-18
[Abstract][Full Text]
Rodriguez, L., Cheng, Z., Chen, T.-H., Tu, C., Chang, W.
(2005). Extracellular Calcium and Parathyroid Hormone-Related Peptide Signaling Modulate the Pace of Growth Plate Chondrocyte Differentiation. Endocrinology
146: 4597-4608
[Abstract][Full Text]
Murray, T. M., Rao, L. G., Divieti, P., Bringhurst, F. R.
(2005). Parathyroid Hormone Secretion and Action: Evidence for Discrete Receptors for the Carboxyl-Terminal Region and Related Biological Actions of Carboxyl- Terminal Ligands. Endocr. Rev.
26: 78-113
[Abstract][Full Text]
Kuznetsov, S. A., Riminucci, M., Ziran, N., Tsutsui, T. W., Corsi, A., Calvi, L., Kronenberg, H. M., Schipani, E., Robey, P. G., Bianco, P.
(2004). The interplay of osteogenesis and hematopoiesis: expression of a constitutively active PTH/PTHrP receptor in osteogenic cells perturbs the establishment of hematopoiesis in bone and of skeletal stem cells in the bone marrow. JCB
167: 1113-1122
[Abstract][Full Text]
Bastepe, M., Raas-Rothschild, A., Silver, J., Weissman, I., Wientroub, S., Juppner, H., Gillis, D.
(2004). A Form of Jansen's Metaphyseal Chondrodysplasia with Limited Metabolic and Skeletal Abnormalities Is Caused by a Novel Activating Parathyroid Hormone (PTH)/PTH-Related Peptide Receptor Mutation. J. Clin. Endocrinol. Metab.
89: 3595-3600
[Abstract][Full Text]
Ballock, R. T., O'Keefe, R. J.
(2003). The Biology of the Growth Plate. JBJS
85: 715-726
[Full Text]
Raposo, J. F., Sobrinho, L. G., Ferreira, H. G.
(2002). A Minimal Mathematical Model of Calcium Homeostasis. J. Clin. Endocrinol. Metab.
87: 4330-4340
[Abstract][Full Text]
Beier, F., LuValle, P.
(2002). The Cyclin D1 and Cyclin A Genes Are Targets of Activated PTH/PTHrP Receptors in Jansen's Metaphyseal Chondrodysplasia. Mol. Endocrinol.
16: 2163-2173
[Abstract][Full Text]
Chen, H.-L., Demiralp, B., Schneider, A., Koh, A. J., Silve, C., Wang, C.-Y., McCauley, L. K.
(2002). Parathyroid Hormone and Parathyroid Hormone-related Protein Exert Both Pro- and Anti-apoptotic Effects in Mesenchymal Cells. J. Biol. Chem.
277: 19374-19381
[Abstract][Full Text]
Minagawa, M., Yasuda, T., Watanabe, T., Minamitani, K., Takahashi, Y., Goltzman, D., White, J. H., Hendy, G. N., Kohno, Y.
(2002). Association between AAAG Repeat Polymorphism in the P3 Promoter of the Human Parathyroid Hormone (PTH)/PTH-Related Peptide Receptor Gene and Adult Height, Urinary Pyridinoline Excretion, and Promoter Activity. J. Clin. Endocrinol. Metab.
87: 1791-1796
[Abstract][Full Text]
Soegiarto, D. W., Kiachopoulos, S., Schipani, E., Juppner, H., Erben, R. G., Lanske, B.
(2001). Partial Rescue of PTH/PTHrP Receptor Knockout Mice by Targeted Expression of the Jansen Transgene. Endocrinology
142: 5303-5310
[Abstract][Full Text]
Gensure, R. C., Carter, P. H., Petroni, B. D., Juppner, H., Gardella, T. J.
(2001). Identification of Determinants of Inverse Agonism in a Constitutively Active Parathyroid Hormone/Parathyroid Hormone-related Peptide Receptor by Photoaffinity Cross-linking and Mutational Analysis. J. Biol. Chem.
276: 42692-42699
[Abstract][Full Text]
Garner, S. C., Pi, M., Tu, Q., Quarles, L. D.
(2001). Rickets in Cation-Sensing Receptor-Deficient Mice: An Unexpected Skeletal Phenotype. Endocrinology
142: 3996-4005
[Abstract][Full Text]
Lee, E. J., Kotlar, T. J., Ciric, I., Lee, M. K., Lim, S. K., Lee, H. C., Huh, K. B., Mayo, K. E., Jameson, J. L.
(2001). Absence of Constitutively Activating Mutations in the GHRH Receptor in GH-Producing Pituitary Tumors. J. Clin. Endocrinol. Metab.
86: 3989-3995
[Abstract][Full Text]
Wysolmerski, J. J., Cormier, S., Philbrick, W. M., Dann, P., Zhang, J.-P., Roume, J., Delezoide, A.-L., Silve, C.
(2001). Absence of Functional Type 1 Parathyroid Hormone (PTH)/PTH-Related Protein Receptors in Humans Is Associated with Abnormal Breast Development and Tooth Impaction. J. Clin. Endocrinol. Metab.
86: 1788-1794
[Abstract][Full Text]
Carter, P. H., Petroni, B. D., Gensure, R. C., Schipani, E., Potts, J. T. Jr., Gardella, T. J.
(2001). Selective and Nonselective Inverse Agonists for Constitutively Active Type-1 Parathyroid Hormone Receptors: Evidence for Altered Receptor Conformations. Endocrinology
142: 1534-1545
[Abstract][Full Text]
Guo, J., Lanske, B., Liu, B.-Y., Divieti, P., Kronenberg, H. M., Bringhurst, F. R.
(2001). Signal-Selectivity of Parathyroid Hormone (PTH)/PTH-Related Peptide Receptor-Mediated Regulation of Differentiation in Conditionally Immortalized Growth-Plate Chondrocytes. Endocrinology
142: 1260-1268
[Abstract][Full Text]
Ferrari, S. L., Bisello, A.
(2001). Cellular Distribution of Constitutively Active Mutant Parathyroid Hormone (PTH)/PTH-Related Protein Receptors and Regulation of Cyclic Adenosine 3',5'-Monophosphate Signaling by {beta}-Arrestin2. Mol. Endocrinol.
15: 149-163
[Abstract][Full Text]
Marx, S. J.
(2000). Hyperparathyroid and Hypoparathyroid Disorders. NEJM
343: 1863-1875
[Full Text]
Nielsen, S. M., Nielsen, L. Z., Hjorth, S. A., Perrin, M. H., Vale, W. W.
(2000). Constitutive activation of tethered-peptide/ corticotropin-releasing factor receptor chimeras. Proc. Natl. Acad. Sci. USA
97: 10277-10281
[Abstract][Full Text]
Turner, P. R., Mefford, S., Christakos, S., Nissenson, R. A.
(2000). Apoptosis Mediated by Activation of the G Protein-Coupled Receptor for Parathyroid Hormone (PTH)/ PTH-Related Protein (PTHrP). Mol. Endocrinol.
14: 241-254
[Abstract][Full Text]
Strewler, G. J.
(2000). The Physiology of Parathyroid Hormone-Related Protein. NEJM
342: 177-185
[Full Text]
Boguslawski, G., Hale, L. V., Yu, X.-P., Miles, R. R., Onyia, J. E., Santerre, R. F., Chandrasekhar, S.
(2000). Activation of Osteocalcin Transcription Involves Interaction of Protein Kinase A- and Protein Kinase C-dependent Pathways. J. Biol. Chem.
275: 999-1006
[Abstract][Full Text]
Mannstadt, M., Juppner, H., Gardella, T. J.
(1999). Receptors for PTH and PTHrP: their biological importance and functional properties. Am. J. Physiol. Renal Physiol.
277: F665-F675
[Abstract][Full Text]
Karperien, M., van der Harten, H. J., van Schooten, R., Farih-Sips, H., den Hollander, N. S., Kneppers, S. L. J., Nijweide, P., Papapoulos, S. E., Lowik, C. W. G. M.
(1999). A Frame-Shift Mutation in the Type I Parathyroid Hormone (PTH)/PTH-Related Peptide Receptor Causing Blomstrand Lethal Osteochondrodysplasia. J. Clin. Endocrinol. Metab.
84: 3713-3720
[Abstract][Full Text]
Schipani, E., Langman, C., Hunzelman, J., Le Merrer, M., Loke, K. Y., Dillon, M. J., Silve, C., Jüppner, H.
(1999). A Novel Parathyroid Hormone (PTH)/PTH-Related Peptide Receptor Mutation in Jansen's Metaphyseal Chondrodysplasia. J. Clin. Endocrinol. Metab.
84: 3052-3057
[Abstract][Full Text]
St-Jacques, B., Hammerschmidt, M., McMahon, A. P.
(1999). Indian hedgehog signaling regulates proliferation and differentiation of chondrocytes and is essential for bone formation. Genes Dev.
13: 2072-2086
[Abstract][Full Text]
Rubin, D. A., Hellman, P., Zon, L. I., Lobb, C. J., Bergwitz, C., Juppner, H.
(1999). A G Protein-coupled Receptor from Zebrafish Is Activated by Human Parathyroid Hormone and Not by Human or Teleost Parathyroid Hormone-related Peptide. IMPLICATIONS FOR THE EVOLUTIONARY CONSERVATION OF CALCIUM-REGULATING PEPTIDE HORMONES. J. Biol. Chem.
274: 23035-23042
[Abstract][Full Text]
Nissenson, R. A.
(1998). Editorial: Parathyroid Hormone (PTH)/PTHrP Receptor Mutations in Human Chondrodysplasia. Endocrinology
139: 4753-4755
[Full Text]
Ganguli, S. C., Park, C.-G., Holtmann, M. H., Hadac, E. M., Kenakin, T. P., Miller, L. J.
(1998). Protean Effects of a Natural Peptide Agonist of the G Protein-Coupled Secretin Receptor Demonstrated by Receptor Mutagenesis. J. Pharmacol. Exp. Ther.
286: 593-598
[Abstract][Full Text]
Guise, T. A., Mundy, G. R.
(1998). Cancer and Bone. Endocr. Rev.
19: 18-54
[Abstract][Full Text]
Hjorth, S. A., Ørskov, C., Schwartz, T. W.
(1998). Constitutive Activity of Glucagon Receptor Mutants. Mol. Endocrinol.
12: 78-86
[Abstract][Full Text]
Fuller, P. J., Verity, K., Shen, Y., Mamers, P., Jobling, T., Burger, H. G.
(1998). No Evidence of a Role for Mutations or Polymorphisms of the Follicle-Stimulating Hormone Receptor in Ovarian Granulosa Cell Tumors. J. Clin. Endocrinol. Metab.
83: 274-279
[Abstract][Full Text]
Schipani, E., Lanske, B., Hunzelman, J., Luz, A., Kovacs, C. S., Lee, K., Pirro, A., Kronenberg, H. M., Juppner, H.
(1997). Targeted expression of constitutively active receptors for parathyroid hormone and parathyroid hormone-related peptide delays endochondral bone formation and rescues mice that lack parathyroid hormone-related peptide. Proc. Natl. Acad. Sci. USA
94: 13689-13694
[Abstract][Full Text]
Paschke, R., Ludgate, M.
(1997). The Thyrotropin Receptor in Thyroid Diseases. NEJM
337: 1675-1681
[Full Text]
Fuhrer, D., Holzapfel, H.-P., Wonerow, P., Scherbaum, W. A., Paschke, R.
(1997). Somatic Mutations in the Thyrotropin Receptor Gene and Not in the Gs{alpha} Protein Gene in 31 Toxic Thyroid Nodules. J. Clin. Endocrinol. Metab.
82: 3885-3891
[Abstract][Full Text]
Schipani, E., Jensen, G. S., Pincus, J., Nissenson, R. A., Gardella, T. J., Jüppner, H.
(1997). Constitutive Activation of the Cyclic Adenosine 3',5'-Monophosphate Signaling Pathway by Parathyroid Hormone (PTH)/PTH-Related Peptide Receptors Mutated at the Two Loci for Jansen's Metaphyseal Chondrodysplasia. Mol. Endocrinol.
11: 851-858
[Abstract][Full Text]
Martin, T. J.
(1996). Actions of Parathyroid Hormone-Related Peptide and Its Receptors. NEJM
335: 736-738
[Full Text]
Huang, W., Chung, U.-i., Kronenberg, H. M., de Crombrugghe, B.
(2001). The chondrogenic transcription factor Sox9 is a target of signaling by the parathyroid hormone-related peptide in the growth plate of endochondral bones. Proc. Natl. Acad. Sci. USA
98: 160-165
[Abstract][Full Text]