FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 335:1870-1879 December 19, 1996 Number 25 Next

Abstract PDF Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

ABSTRACT

Background Congenital lipoid adrenal hyperplasia results in severe impairment of steroid biosynthesis in the adrenal glands and gonads that is manifested both in utero and postnatally. We recently found mutations in the gene for the steroidogenic acute regulatory protein in four patients with this syndrome, but it was not clear whether all patients have such mutations or why there is substantial clinical variation in these patients.

Methods We directly sequenced the gene for steroidogenic acute regulatory protein in 15 patients with congenital lipoid adrenal hyperplasia from 10 countries. Identified mutations were confirmed and recreated in expression vectors, transfected into cultured cells, and assayed for the presence and activity of steroidogenic acute regulatory protein.

Results Fifteen different mutations in the gene for steroidogenic acute regulatory protein were found in 14 patients; the mutation Gln258Stop was found in 80 percent of affected alleles from Japanese and Korean patients, and the mutation Arg182Leu was found in 78 percent of affected alleles from Palestinian patients. We developed diagnostic tests for these and eight other mutations. Thirteen of the 15 mutations were in exons 5, 6, or 7, and all rendered the steroidogenic acute regulatory protein inactive in functional assays. Some mutants with amino acid replacements were capable of normal mitochondrial processing, indicating that the activity of steroidogenic acute regulatory protein is not associated with its translocation into mitochondria. Steroidogenic cells lacking the protein retained low levels of steroidogenesis. This explains the secretion of some steroid hormones by the ovaries after puberty before affected cells accumulate large amounts of cholesterol esters.

Conclusions The congenital lipoid adrenal hyperplasia phenotype is the result of two separate events, an initial genetic loss of steroidogenesis that is dependent on steroidogenic acute regulatory protein and a subsequent loss of steroidogenesis that is independent of the protein due to cellular damage from accumulated cholesterol esters.

Affected adrenal or testicular tissues cannot convert cholesterol to pregnenolone in vitro, suggesting a defect in the cholesterol-side-chain cleavage system,^4,6,7,8 which consists of cytochrome P450scc and its electron-transfer proteins adrenodoxin reductase and adrenodoxin.⁹ Adrenodoxin reductase, adrenodoxin, and several factors thought to participate in the transport of cholesterol to mitochondria are normal in patients with congenital lipoid adrenal hyperplasia,^10,11 so attention focused on P450scc. However, the P450scc gene is normal in these patients^10,12,13,14 and the synthesis of pregnenolone in the placenta (a fetal tissue) is unaffected,¹⁵ indicating that the entire cholesterol-side-chain cleavage system can function normally in affected patients.

Recently, a 30-kd mouse mitochondrial protein that appears to be a rapidly inducible, cycloheximide-sensitive mediator of the acute steroidogenic response^16,17 was cloned and named the steroidogenic acute regulatory protein.¹⁸ We cloned the human complementary DNA (cDNA)¹⁹ and gene²⁰ and found that messenger RNA (mRNA) for this protein was expressed in the adrenal glands and gonads but not in the placenta or brain, as expected for a factor that might cause congenital lipoid adrenal hyperplasia but spare placental steroidogenesis. We found mutations in the gene for steroidogenic acute regulatory protein in four affected families^21,22; however, it was not clear whether all patients with this phenotype have such mutations. Furthermore, correlations between the severity of the mutation and the phenotype have not been possible, and it was not clear how the mutations cause the clinical findings. To elucidate these issues, we examined the gene for steroidogenic acute regulatory protein in 15 previously unstudied patients with congenital lipoid adrenal hyperplasia, from various ethnic groups.

Methods

Leukocyte genomic DNA was amplified by the polymerase chain reaction (PCR) and sequenced directly (without cloning) on both strands with an automated sequencer (exons 1 through 4) or manually (exons 5 through 7). The following oligonucleotide primers were used: Ex1S 5'TAACACAGGTTTCTGAGCCTCAAT3' and Ex1AS 5'ATCAGAATTGGGTGGCCTGAGCCTC3' for exon 1, Ex2S 5'GTCCCTGCTAGAATACTGTGTT3' and Ex2AS 5'AAAGCCACATGCACCACATCA3' for exon 2, Ex3S 5'CAATGAGCAGACCCAGAGCT3' and Ex3AS 5'GACTGCTGCATGAGACAGGA3' for exon 3, Ex4S 5'TGCTGGGATTATAGGCGTGAAC3' and Ex4AS 5'GCTAGGGGTCCTCTCTTTGATACAG3' for exon 4, Ex5S 5'TGCTGTATCAAAGAG-AGGAC3' and Ex5AS 5'AGCCTGCTGCCCGTATTTAC3' for exon 5, and oligonucleotide B2 is 5'GACCACAAGATGAGCACATTC3'. Primers S3 and AS1 for exons 5 through 7 and primers S2, S3, S4, AS1, and AS5 have been described previously.^21,22 Identified mutations were reconfirmed by manual sequencing from an independent PCR amplification and re-created in a vector expressing steroidogenic acute regulatory protein cDNA. Primer sequences for mutagenesis and conditions for PCR have been deposited with the National Auxiliary Publications Service (). The activity of the protein was determined by measuring the pregnenolone produced from endogenous cholesterol in COS-1 cells transfected with plasmids expressing the cholesterol-side-chain cleavage system and steroidogenic acute regulatory protein, as described previously.^19,20,21,22 Western immunoblotting with rabbit antimouse antiserum against the protein was done as described previously.^19,20

Results

Patients

Fifteen patients from 10 countries were studied (Table 1). All patients had normal birth weights and gestational ages, and all had phenotypically normal female genitalia. Their plasma corticotropin and renin values were high; serum cortisol and testosterone values varied substantially but responded poorly to corticotropin and chorionic gonadotropin. There were substantial variations in the degree of hyponatremia and hyperkalemia and in the age at onset of symptoms, with one child surviving for six months without hormonal replacement. At least five neonates had hypoglycemia, and at least five had respiratory disorders. To our knowledge, neither of these features has been described previously in congenital lipoid adrenal hyperplasia, but both could be caused by glucocorticoid deficiency. At least 12 patients had hyperpigmentation at birth, indicating intrauterine glucocorticoid deficiency, which caused excessive corticotropin secretion. We found 15 different mutations in the gene for steroidogenic acute regulatory protein, 13 of which were in exons 5 through 7, in 14 of these 15 patients. Identified mutations were confirmed by direct sequencing of DNA in all patients and in their parents and siblings whenever possible.

View this table: [in this window] [in a new window]   Table 1. Characteristics of Patients with Congenital Lipoid Adrenal Hyperplasia and Mutations in the Gene for Steroidogenic Acute Regulatory Protein.

 
Gln258Stop Mutations

In three Japanese patients, four of the six unrelated alleles for steroidogenic acute regulatory protein had the mutation Gln258Stop (Table 2). When the previously described²¹ homozygous Patients 16 and 19 were included, 8 of 10 affected alleles in the patients from Japan and Korea, where congenital lipoid adrenal hyperplasia is not so rare as it is in the United States,^4,5,14 had this same mutation, suggesting a founder effect. The two other mutations in the Japanese patients have not been found in other patients and may represent new mutations. The Gln258Stop mutation is easily identified by amplifying genomic DNA with primers S4 and AS1²¹ followed by digestion with EcoRII, BstN1, or SexA1, since the responsible CT mutation (indicated by the underlined letter) destroys the recognition site ACCAGGT (Table 2); we estimate that the carrier rate for this mutation in Japan is about 1 in 200.

View this table: [in this window] [in a new window]   Table 2. Molecular Diagnosis of Congenital Lipoid Adrenal Hyperplasia.

 
Arg182Leu Mutations

Six of our patients were of Palestinian ancestry (Table 1). Patients 5 and 6 were siblings, and Patient 4 was from a consanguineous marriage, so these six patients represented nine unique alleles, seven of which had the Arg182Leu mutation. These apparently unrelated patients were from Jordan, Israel, Kuwait, and Denmark. Identification of intronic polymorphisms and other mutations within the gene for steroidogenic acute regulatory protein showed that the Arg182Leu mutation was found in various sequence contexts, confirming that the patients were unrelated. The Arg182Leu mutation is easily identified by amplifying genomic DNA with primers S3 and Ex5AS followed by digestion with Tsp45I (Table 2). Patient 15, an Egyptian of Coptic Christian heritage and hence probably a member of a different gene pool, had an unrelated frame-shift mutation.

Clustering of Mutations in the Gene for Steroidogenic Acute Regulatory Protein

Five additional patients from assorted ethnic groups had various mutations (Table 1). Patient 10, a Mexican of Native American ancestry, was homozygous for a deletion of the Arg272 codon, and Patient 11, from Greece, was homozygous for a frame-shift mutation, but no history of consanguinity was found in the families of these patients. Patient 12, a white patient from Britain, was heterozygous for the insertion of a foreign DNA segment beginning in exon 5; the mutation on the maternal allele has not been found. Patient 13, a white patient from Canada, was a compound heterozygote for the Leu275Pro and Ala218Val mutations. In Patient 14, the product of a consanguineous union, no mutation was found; this patient's mutation could be the result of a promoter mutation, an uninvestigated upstream splicing mutation, or a mutation in some other gene. Among 33 affected alleles we found 15 mutations, all but 2 of which affected exon 5, 6, or 7 (Table 1).

Genetic Diagnosis of Congenital Lipoid Adrenal Hyperplasia

The Gln258Stop and Arg182Leu mutations accounted for 70 to 80 percent of the mutations in the Japanese and Palestinian patients, providing the opportunity for genetic screening. We developed diagnostic tests for these and eight other mutations (Table 2). Genomic DNA was amplified by PCR with primers that encompass the suspected mutation, the DNA was then cut with a restriction endonuclease whose recognition sequence was created or destroyed by the mutation, and the products were examined by gel electrophoresis. Examples of genetic diagnosis with Gln258Stop and Arg182Leu are shown in Figure 1A and Figure 1B.

View larger version (17K): [in this window] [in a new window]   Figure 1. Genetic Diagnosis of Congenital Lipoid Adrenal Hyperplasia. Panel A shows the results of amplification of DNA carrying the mutation commonly found in Japanese patients with congenital lipoid adrenal hyperplasia — Gln258Stop. Genomic DNA from a homozygous patient, her heterozygous parents, and a normal subject was amplified with the primers S4 and AS1 and cut with BstNI. The uncut DNA is 254 bp; the patient has bands of 133 and 62 bp, the normal subject has bands of 115 and 62 bp, and the parents have both the 133- and 115-bp fragments. Panel B shows the result of amplification of DNA carrying the mutation commonly found in Palestinian patients with congenital lipoid adrenal hyperplasia — Arg182Leu. DNA from Patients 5 and 6 (who were siblings), their parents, and a normal subject was amplified with the primers S3 and Ex5AS and cut with Tsp45I. The patients have uncut 345-bp fragments, the normal subject has 223- and 122-bp fragments, and the parents are heterozygous, having 345-, 223-, and 122-bp fragments.

 
Activity of the Mutants

To determine whether the identified mutations caused the patients' disease and to study the structural and functional requirements of the steroidogenic acute regulatory protein, we tested each mutant in vitro. The mutations were recreated in vectors expressing the protein and transfected into nonsteroidogenic COS-1 cells, cotransfected with a vector expressing the three components of the cholesterol-side-chain cleavage system as a single monomolecular fusion protein (H₂N–P450scc–adrenodoxin reductase–adrenodoxin–COOH) termed F2.²⁸ This construct optimizes the activity of cytochrome P450scc and eliminates variations in P450scc activity due to variation in the molar ratio of P450scc to adrenodoxin reductase or adrenodoxin.^28,29 Incubation with 22R-hydroxycholesterol bypasses the mitochondrial cholesterol-transport system and provides a direct index of maximal mitochondrial steroidogenic capacity.³⁰ The ratio of steroidogenic capacity with endogenous cholesterol as substrate to that with 22R-hydroxycholesterol as substrate indicates the efficiency of mitochondrial cholesterol transport. In cells containing F2 and the control vector, the level of steroidogenesis from endogenous cholesterol that is independent of steroidogenic acute regulatory protein was 14 percent of the level with F2 and the protein. The Ala218Val and Leu275Pro mutants had minimal activity, and the others had essentially no detectable activity (Table 3).

View this table: [in this window] [in a new window]   Table 3. Ability of Mutant Steroidogenic Acute Regulatory Proteins to Promote Steroidogenesis.

 
To examine the structural effects of the mutations, transfected cells were assayed by immunoblotting with rabbit antimurine steroidogenic acute regulatory protein IgG.¹⁸ The 37-kd precursor protein was readily detectable, but not the mature 30-kd form of the mutants resulting from Glu169Gly and the deletion of Arg272 (data not shown). The Arg182Leu mutant protein was unstable and not detected. Both the 37-kd precursor and the 30-kd mature form of the Glu169Gly, Leu275Pro, and Ala218Val mutants could be detected in about the same ratio as for the wild-type protein (Figure 2). Thus, some changes in amino acids that ablated the activity of the protein did not alter its mitochondrial processing.

View larger version (5K): [in this window] [in a new window]   Figure 2. Western Blot Analysis of Steroidogenic Acute Regulatory Protein Expressed in COS-1 Cells. COS-1 cells were transfected with a control plasmid vector (pSV-SPORT-1), the vector harboring wild-type cDNA for steroidogenic acute regulatory protein, or the indicated mutant cDNAs (Glu169Lys, Leu275Pro, Ala218Val, and Gln258Stop). Whole-cell extracts were subjected to sodium dodecyl sulfate–polyacrylamide-gel electrophoresis and Western blotting as previously described21 with a rabbit polyclonal antibody raised against a structurally conserved peptide from mouse steroidogenic acute regulatory protein. The wild-type steroidogenic acute regulatory precursor protein migrates at 37 kd, and the mature protein at 32.5 kd.

 
Discussion

Finding mutations in the gene for the steroidogenic acute regulatory protein in patients with congenital lipoid adrenal hyperplasia from various ethnic and genetic backgrounds establishes that these mutations are responsible for most if not all cases of the syndrome. The basis of the disease in Patient 14, who had no detectable mutations in the gene for this protein, is unknown; a mutation in SF-1, a transcription factor involved in the embryonic differentiation of adrenal and gonadal (but not placental) steroidogenic cells,^31,32 is a possibility. The gene for steroidogenic acute regulatory protein is autosomal,¹⁹ yet only 3 of our 21 patients were 46,XX, and in another study, only 16 of 63 Japanese patients with known karyotypes were 46,XX.⁵ These results suggest that many affected 46,XX fetuses are lost in early pregnancy, that affected 23,X sperm are less likely to fertilize an egg, or that 23,X sperm are produced at disproportionately lower frequencies than 23,Y sperm. However, an ascertainment bias cannot be ruled out.

Previous studies suggested that the active form of steroidogenic acute regulatory protein is the 37-kd precursor, stimulating steroidogenesis by forming contact sites between the outer and inner membranes as it enters the mitochondria.^18,33 However, the deletion of only 28 carboxy-terminal amino acids in the Gln258Stop mutation commonly found in Japanese patients eliminates all activity,²¹ and some inactive mutants undergo normal mitochondrial processing (Figure 2). Thus, the carboxy-terminal half of the protein is crucial for activity. We found missense mutations only in exons 5, 6, and 7. Thus, either exons 1, 2, 3, and 4 are less prone to mutation or missense mutations in this region are phenotypically silent. Because steroidogenic acute regulatory protein lacking a mitochondrial import peptide is fully active,³⁴ we favor the latter explanation.

The clinical descriptions of congenital lipoid adrenal hyperplasia are remarkably consistent: female external genitalia, neonatal hyponatremia, hyperkalemia, and dehydration.^{1,2,3,4,6,7,8} Minimal degrees of posterior labial fusion or of clitorimegaly, which would reflect androgen action in early or late gestation, respectively, were not seen in our patients; thus, all 46,XY patients had a profound impairment of testosterone synthesis. By contrast with this consistent genital phenotype, the severity, manifestations, and age at onset of clinically apparent mineralocorticoid and glucocorticoid deficiency varied considerably. Most infants had vomiting, dehydration, hypotension, failure to thrive, hyponatremia, and hyperkalemia within two weeks after birth, but Patients 3, 5, 12, and 13 survived for three months or more without hormone-replacement therapy. Hyperpigmentation, a sign of corticotropin hypersecretion, was seen in two thirds of the newborns we studied, and about one fourth had neonatal hypoglycemia and compromised pulmonary development, both associated with glucocorticoid deficiency. Patient 13, who had a 46,XY karyotype and was a compound heterozygote for two amino acid replacements that allowed minimal steroidogenic acute regulatory protein activity, survived for four months without hormone-replacement therapy but had no evidence of fetal testosterone production. Thus, the testicular lesion in congenital lipoid adrenal hyperplasia appears to be substantially more severe than the adrenal lesion. In sharp contrast with this profound reduction in testicular steroidogenesis, some affected 46,XX patients undergo feminization and have vaginal bleeding at puberty.⁵

We hypothesize that there are two lesions in congenital lipoid adrenal hyperplasia (Figure 3A, Figure 3B, and Figure 3C). First, a mutant steroidogenic acute regulatory protein prevents the acute steroidogenic response in the fetal testis and adrenal gland. This destroys the steroidal responses to tropic stimulation that are dependent on the protein but permits basal steroidogenesis that is independent of the protein, as occurs in the placenta¹⁵ and in COS-1 cells transfected only with the cholesterol-side-chain cleavage system (Table 3). Second, the accumulation of cholesterol esters and sterol auto-oxidation products in affected cells damages the cell and eventually disrupts the basal steroidogenesis that is independent of steroidogenic acute regulatory protein. Thus, the fetal testis, which is stimulated by chorionic gonadotropin in early gestation, is severely affected early in gestation, so that virilization does not occur; this was the case even in Patient 13, who had some steroidogenic acute regulatory protein activity. Similarly, the fetal zone of the adrenal gland, which secretes large amounts of dehydroepiandrosterone for placental conversion to estriol, is also profoundly affected, leading to low plasma estriol concentrations in women carrying affected fetuses.

View larger version (162K): [in this window] [in a new window]   Figure 3. Model of Congenital Lipoid Adrenal Hyperplasia in an Adrenal Cell. In the normal cell (Panel A), cholesterol is derived by endogenous synthesis from acetyl–coenzyme A in the endoplasmic reticulum, from cholesterol esters stored in lipid droplets, and from low-density lipoprotein cholesterol, which after receptor-mediated endocytosis, is processed in lysosomes before it is used or stored in lipid droplets. Cholesterol is transported to the outer mitochondrial membrane by ill-defined processes involving the cytoskeleton.35 The rate-limiting step in steroidogenesis is the movement of cholesterol from the outer to the inner mitochondrial membrane; this can be promoted by steroidogenic acute regulatory protein (StAR), but may also be mediated by mechanisms independent of this protein. Thus, the net synthesis of steroid is due to mechanisms dependent on, as well as independent of, the protein. In Panel B, in the absence of steroidogenic acute regulatory protein, as in early congenital lipoid adrenal hyperplasia or in a placental cell, mechanisms independent of the protein can still move some cholesterol into the mitochondria, resulting in a low level of steroidogenesis. In patients with affected adrenal cells this results in increased corticotropin secretion, stimulating further production of cholesterol and its accumulation as cholesterol esters in lipid droplets. In Panel C, as lipid droplets accumulate they engorge the cell, damaging its cytoarchitecture through both physical displacement and the chemical action of cholesterol auto-oxidation products. Steroidogenic capacity is destroyed, and consequently tropic stimulation continues. In the ovary, follicular cells remain unstimulated and, hence, undamaged until they are recruited at the beginning of each menstrual cycle. Small amounts of estradiol are produced, as shown in Panel B, effecting phenotypic feminization and vaginal bleeding, but the cycles are anovulatory, resulting in infertility and progressive hypergonadotropic hypogonadism. cAMP denotes cyclic AMP.

 
By contrast, the definitive zone of the fetal adrenal gland makes relatively small amounts of steroids but probably develops into the adrenal zonae glomerulosa and fasciculata after birth.³⁶ These zones are variably affected by the accumulation of cholesterol esters, leading to the synthesis of small but detectable amounts of steroid hormones in affected newborns and permitting survival for a brief time, until the accumulation of cholesterol esters finally leads to the destruction of residual adrenal steroidogenesis.

In contrast to the testis and adrenal gland, the fetal ovary lacks steroidogenic enzymes and steroidogenic capacity.³⁷ Since it remains unstimulated until puberty, it does not accumulate cholesterol esters. The onset of puberty then stimulates the maturation of individual ovarian follicles, leading to some estrogen synthesis by the ovaries that is independent of steroidogenic acute regulatory protein in affected 46,XX females. The accumulation of ovarian cholesterol esters eventually destroys the steroidogenic capacity of the stimulated follicles that is independent of steroidogenic acute regulatory protein, but previously unstimulated follicles are recruited in subsequent cycles, permitting a low level of steroidogenesis associated with anovulatory cycles, progressive ovarian failure, and hypergonadotropic hypogonadism.

Thus, elucidation of the genetics and cell biology of the mutant steroidogenic acute regulatory protein has suggested a model to explain the phenotypic variations in congenital lipoid adrenal hyperplasia.

Supported by grants from the National Institutes of Health (DK37922 and DK42154 to Dr. Miller and HD06274 to Dr. Strauss) and a grant from the March of Dimes (to Dr. Miller).

We are indebted to Dr. Takuma Kondo, Kondo Clinic, Osaka, Japan, for the clinical data on Patients 1, 2, and 3; to Dr. Songya Pang, Department of Pediatrics, University of Illinois, Chicago, for the samples from and data on Patient 10; to Drs. David C.L. Savage and John Barton, Bristol Royal Hospital for Sick Children, Bristol, United Kingdom, for the data on and samples from Patient 13; and to Dr. Douglas M. Stocco, Department of Biochemistry, Texas Tech University, Lubbock, for the antibody against mouse steroidogenic acute regulatory protein.

^* Other members of the International Congenital Lipoid Adrenal Hyperplasia Consortium are listed in the Appendix.

See NAPS document no. 05350 for 3 pages of supplementary material. Order from NAPS c/o Microfiche Publications, P.O. Box 3513, Grand Central Station, New York, NY 10163-3513.

Source Information

From the Department of Pediatrics, University of California at San Francisco, San Francisco (H.S.B., W.L.M.); and the Department of Obstetrics and Gynecology, University of Pennsylvania, Philadelphia (T.S., J.F.S.).

Address reprint requests to Dr. Miller at the Department of Pediatrics, University of California, San Francisco, Bldg. MR-IV, Rm. 209, San Francisco, CA 94143-0978.

References

1. Sandison AT. A form of lipoidosis of the adrenal cortex in an infant. Arch Dis Child 1955;30:538-541. 
2. Prader A, Gurtner HP. Das Syndrom des Pseudohermaphroditismus masculinus bei kongenitaler Nebennierenrinden-Hyperplasie ohne Androgenüberproduktion (adrenaler Pseudohermaphroditismus masculinus). Helv Paediatr Acta 1955;10:397-412. [Medline]
3. Kirkland RT, Kirkland JL, Johnson CM, Horning MG, Librik L, Clayton GW. Congenital lipoid adrenal hyperplasia in an eight-year-old phenotypic female. J Clin Endocrinol Metab 1973;36:488-496. [Medline]
4. Hauffa BP, Miller WL, Grumbach MM, Conte FA, Kaplan SL. Congenital adrenal hyperplasia due to deficient cholesterol side-chain cleavage activity (20, 22 desmolase) in a patient treated for 18 years. Clin Endocrinol (Oxf) 1985;23:481-493. [Medline]
5. Matsuo N, Tsuzaki S, Anzo M, Ogata T, Sato S. The phenotypic definition of congenital lipoid adrenal hyperplasia: analysis of the 67 Japanese patients. Horm Res 1994;41:Suppl:106-106.abstract 
6. Camacho AM, Kowarski A, Migeon CJ, Brough AJ. Congenital adrenal hyperplasia due to a deficiency of one of the enzymes involved in the biosynthesis of pregnenolone. J Clin Endocrinol Metab 1968;28:153-161. [Medline]
7. Degenhart HJ, Visser HKA, Boon H, O'Doherty NJ. Evidence for deficiency of 20-cholesterol-hydroxylase activity in adrenal tissue of a patient with lipoid adrenal hyperplasia. Acta Endocrinol Suppl (Copenh) 1972;71:512-518. 
8. Koizumi S, Kyoya S, Miyawaki T, Kidani H, Funabashi T. Cholesterol side-chain cleavage enzyme activity and cytochrome P-450 content in adrenal mitochondria of a patient with congenital lipoid adrenal hyperplasia (Prader disease). Clin Chim Acta 1977;77:301-306. [CrossRef][Medline]
9. Miller WL. Molecular biology of steroid hormone synthesis. Endocr Rev 1988;9:295-318. [CrossRef][Medline]
10. Lin D, Gitelman SE, Saenger P, Miller WL. Normal genes for the cholesterol side chain cleavage enzyme, P450scc, in congenital lipoid adrenal hyperplasia. J Clin Invest 1991;88:1955-1962.
11. Lin D, Chang YJ, Strauss JF III, Miller WL. The human peripheral benzodiazepine receptor gene: cloning and characterization of alternative splicing in normal tissues and in a patient with congenital lipoid adrenal hyperplasia. Genomics 1993;18:643-650. [CrossRef][Medline]
12. Matteson KJ, Chung BC, Urdea MS, Miller WL. Study of cholesterol side-chain cleavage (20,22 desmolase) deficiency causing congenital lipoid adrenal hyperplasia using bovine-sequence P450scc oligodeoxyribonucleotide probes. Endocrinology 1986;118:1296-1305. [Abstract]
13. Sakai Y, Yanase T, Okabe Y, et al. No mutation in cytochrome P450 side chain cleavage in a patient with congenital lipoid adrenal hyperplasia. J Clin Endocrinol Metab 1994;79:1198-1201. [Abstract]
14. Fukami M, Sato S, Ogata T, Matsuo N. Lack of mutations in P450scc gene (CYP11A) in six Japanese patients with congenital lipoid adrenal hyperplasia. Clin Pediatr Endocrinol 1995;4:39-46.
15. Saenger P, Klonari Z, Black SM, et al. Prenatal diagnosis of congenital lipoid adrenal hyperplasia. J Clin Endocrinol Metab 1995;80:200-205. [Abstract]
16. Epstein LF, Orme-Johnson NR. Regulation of steroid hormone biosynthesis: identification of precursors of a phosphoprotein targeted to the mitochondrion in stimulated rat adrenal cortex cells. J Biol Chem 1991;266:19739-19745. [Free Full Text]
17. Stocco DM, Sodeman TC. The 30-kDa mitochondrial proteins induced by hormone stimulation in MA-10 mouse Leydig tumor cells are processed from larger precursors. J Biol Chem 1991;266:19731-19738. [Free Full Text]
18. Clark BJ, Wells J, King SR, Stocco DM. The purification, cloning, and expression of a novel luteinizing hormone-induced mitochondrial protein in MA-10 mouse Leydig tumor cells: characterization of the steroidogenic acute regulatory protein (StAR). J Biol Chem 1994;269:28314-28322. [Free Full Text]
19. Sugawara T, Holt JA, Driscoll D, et al. Human steroidogenic acute regulatory protein: functional activity in COS-1 cells, tissue-specific expression, and mapping of the structural gene to 8p11.2 and a pseudogene to chromosome 13. Proc Natl Acad Sci U S A 1995;92:4778-4782. [Free Full Text]
20. Sugawara T, Lin D, Holt JA, et al. Structure of the human steroidogenic acute regulatory protein (StAR) gene: StAR stimulates mitochondrial cholesterol 27-hydroxylase activity. Biochemistry 1995;34:12506-12512. [CrossRef][Medline]
21. Lin D, Sugawara T, Strauss JF III, et al. Role of steroidogenic acute regulatory protein in adrenal and gonadal steroidogenesis. Science 1995;267:1828-1831. [Free Full Text]
22. Tee MK, Lin D, Sugawara T, et al. TA transversion 11 bp from a splice acceptor site in the gene for steroidogenic acute regulatory protein causes congenital lipoid adrenal hyperplasia. Hum Mol Genet 1995;4:2299-2305. [Free Full Text]
23. Kondo T, Saito H, Nagahara S, Kobayashi Y. Clinical findings and gonadal pathology in three cases of congenital lipoid adrenal hyperplasia (Prader syndrome). Clin Endocrinol (Oxf) 1986;34:322-325. 
24. Kondo T, Saito H. Hormonal status in a patient with congenital lipoid adrenal hyperplasia and hyperpigmentation. Jpn J Pediatr 1986;34:Suppl:1223-8. (In Japanese.)
25. Kondo T, Nagahara S, Kobayashi Y. A case of congenital lipoid adrenal hyperplasia complicated by Wilson's disease. Clin Endocrinol (Oxf) 1993;41:Suppl:163-167. 
26. Müller J, Torsson A, Damkjaer Nielsen M, Petersen KE, Christoffersen J, Skakkebaek NE. Gonadal development and growth in 46,XX and 46,XY individuals with P450scc deficiency (congenital lipoid adrenal hyperplasia). Horm Res 1991;36:203-208. [Medline]
27. Saenger P, Lin D, Gitelman SE, Miller WL. Congenital lipoid adrenal hyperplasia -- genes for P450scc, side chain cleavage enzyme, are normal. J Steroid Biochem Mol Biol 1993;45:87-97. [CrossRef][Medline]
28. Harikrishna JA, Black SM, Szklarz GD, Miller WL. Construction and function of fusion enzymes of the human cytochrome P450scc system. DNA Cell Biol 1993;12:371-379. [Medline]
29. Zuber MX, Mason JI, Simpson ER, Waterman MR. Simultaneous transfection of COS-1 cells with mitochondrial and microsomal steroid hydroxylases: incorporation of a steroidogenic pathway into nonsteroidogenic cells. Proc Natl Acad Sci U S A 1988;85:699-703. [Free Full Text]
30. Toaff ME, Schleyer H, Strauss JF III. Metabolism of 25-hydroxycholesterol by rat luteal mitochondria and dispersed cells. Endocrinology 1982;111:1785-1790. [Abstract]
31. Luo X, Ikeda Y, Parker KL. A cell-specific nuclear receptor is essential for adrenal and gonadal development and sexual differentiation. Cell 1994;77:481-490. [CrossRef][Medline]
32. Hatano O, Takayama K, Imai T, et al. Sex-dependent expression of a transcription factor, Ad4BP, regulating steroidogenic P-450 genes in the gonads during prenatal and postnatal rat development. Development 1994;120:2787-2797. [Abstract]
33. Stocco DM, Clark BJ. Regulation of the acute production of steroids in steroidogenic cells. Endocr Rev 1996;17:221-244. [CrossRef][Medline]
34. Arakane F, Sugawara T, Nishino H, et al. Steroidogenic acute regulatory protein (StAR) retains activity in the absence of its mitochondrial targeting sequence: implications for the mechanism of StAR action. Proc Natl Acad Sci U S A 1996;93:13731-13736. [Free Full Text]
35. Hall PF. The roles of microfilaments and intermediate filaments in the regulation of steroid synthesis. J Steroid Biochem Mol Biol 1995;55:601-605. [CrossRef][Medline]
36. Mesiano S, Coulter CL, Jaffe RB. Localization of cytochrome P450 cholesterol side-chain cleavage, cytochrome P450 17-hydroxylase/17, 20 lyase, and 3-hydroxysteroid dehydrogenase isomerase steroido-genic enzymes in human and rhesus monkey fetal adrenal glands: reappraisal of functional zonation. J Clin Endocrinol Metab 1993;77:1184-1189. [Abstract]
37. Voutilainen R, Miller WL. Developmental expression of genes for the steroidogenic enzymes P450scc (20,22-desmolase), P450c17 (17-hydroxylase/17,20-lyase), and P450c21 (21-hydroxylase) in the humanfetus. J Clin Endocrinol Metab 1986;63:1145-1150. [Abstract]

Other members of the International Congenital Lipoid Adrenal Hyperplasia Consortium are as follows: Kenji Fujieda, M.D., Hokkaido University, Sapporo, Japan; Ziva Ben-Neriah, M.D., and Ariel Rösler, M.D., Hebrew University Hadassah Medical Center, Jerusalem, Israel; Jorn Müller, M.D., Marianne Schwartz, Ph.D., and Niels E. Skakkebaeck, M.D., National University Hospital, Copenhagen, Denmark; Marlin Nino Nawas, M.D., Khalidi Hospital, Amman, Jordan; Anastasios Papadimitriou, M.D., Penteli Children's Hospital, Athens, Greece; Jeremy S.D. Winter, M.D., University of Alberta, Edmonton, Canada; Christopher T. Cowell, M.D., Royal Alexandria Hospital for Sick Children, Paramatta, Australia; and Gary Warne, M.D., Royal Children's Hospital, Melbourne, Australia.

Abstract PDF Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

This article has been cited by other articles:

• Shaikh, M G, Boyes, L, Kingston, H, Collins, R, Besley, G T N, Padmakumar, B, Ismayl, O, Hughes, I, Hall, C M, Hellerud, C, Achermann, J C, Clayton, P E (2008). Skewed X inactivation is associated with phenotype in a female with adrenal hypoplasia congenita. J. Med. Genet. 45: e1-e1 [Abstract] [Full Text]  
• Nishida, H., Miyagawa, S., Vieux-Rochas, M., Morini, M., Ogino, Y., Suzuki, K., Nakagata, N., Choi, H.-S., Levi, G., Yamada, G. (2008). Positive Regulation of Steroidogenic Acute Regulatory Protein Gene Expression through the Interaction between Dlx and GATA-4 for Testicular Steroidogenesis. Endocrinology 149: 2090-2097 [Abstract] [Full Text]  
• Bose, M., Whittal, R. M., Miller, W. L., Bose, H. S. (2008). Steroidogenic Activity of StAR Requires Contact with Mitochondrial VDAC1 and Phosphate Carrier Protein. J. Biol. Chem. 283: 8837-8845 [Abstract] [Full Text]  
• Sasaki, G., Ishii, T., Jeyasuria, P., Jo, Y., Bahat, A., Orly, J., Hasegawa, T., Parker, K. L. (2008). Complex Role of the Mitochondrial Targeting Signal in the Function of Steroidogenic Acute Regulatory Protein Revealed by Bacterial Artificial Chromosome Transgenesis in Vivo. Mol. Endocrinol. 22: 951-964 [Abstract] [Full Text]  
• Kim, C. J., Lin, L., Huang, N., Quigley, C. A., AvRuskin, T. W., Achermann, J. C., Miller, W. L. (2008). Severe Combined Adrenal and Gonadal Deficiency Caused by Novel Mutations in the Cholesterol Side Chain Cleavage Enzyme, P450scc. J. Clin. Endocrinol. Metab. 93: 696-702 [Abstract] [Full Text]  
• Abdulhadi-Atwan, M., Jean, A., Chung, W. K., Meir, K., Ben Neriah, Z., Stratigopoulos, G., Oberfield, S. E., Fennoy, I., Hirsch, H. J., Bhangoo, A., Ten, S., Lerer, I., Zangen, D. H. (2007). Role of a Founder c.201_202delCT Mutation and New Phenotypic Features of Congenital Lipoid Adrenal Hyperplasia in Palestinians. J. Clin. Endocrinol. Metab. 92: 4000-4008 [Abstract] [Full Text]  
• Bose, M., Debnath, D., Chen, Y., Bose, H. S (2007). Folding, activity and import of steroidogenic acute regulatory protein into mitochondria changed by nicotine exposure. J Mol Endocrinol 39: 67-79 [Abstract] [Full Text]  
• Baker, B. Y., Epand, R. F., Epand, R. M., Miller, W. L. (2007). Cholesterol Binding Does Not Predict Activity of the Steroidogenic Acute Regulatory Protein, StAR. J. Biol. Chem. 282: 10223-10232 [Abstract] [Full Text]  
• Chen, Y.-C., Nagpal, M. L, Stocco, D. M, Lin, T. (2007). Effects of genistein, resveratrol, and quercetin on steroidogenesis and proliferation of MA-10 mouse Leydig tumor cells. J Endocrinol 192: 527-537 [Abstract] [Full Text]  
• Miller, W. L. (2007). StAR Search--What We Know about How the Steroidogenic Acute Regulatory Protein Mediates Mitochondrial Cholesterol Import. Mol. Endocrinol. 21: 589-601 [Abstract] [Full Text]  
• Murcia, M., Faraldo-Gomez, J. D., Maxfield, F. R., Roux, B. (2006). Modeling the structure of the StART domains of MLN64 and StAR proteins in complex with cholesterol. J. Lipid Res. 47: 2614-2630 [Abstract] [Full Text]  
• Baker, B. Y., Lin, L., Kim, C. J., Raza, J., Smith, C. P., Miller, W. L., Achermann, J. C. (2006). Nonclassic Congenital Lipoid Adrenal Hyperplasia: A New Disorder of the Steroidogenic Acute Regulatory Protein with Very Late Presentation and Normal Male Genitalia. J. Clin. Endocrinol. Metab. 91: 4781-4785 [Abstract] [Full Text]  
• Sugawara, T., Sakuragi, N., Minakami, H. (2006). CREM confers cAMP responsiveness in human steroidogenic acute regulatory protein expression in NCI-H295R cells rather than SF-1/Ad4BP.. J Endocrinol 191: 327-337 [Abstract] [Full Text]  
• Ikonen, E. (2006). Mechanisms for cellular cholesterol transport: defects and human disease.. Physiol. Rev. 86: 1237-1261 [Abstract] [Full Text]  
• Manna, P. R, Chandrala, S. P, Jo, Y., Stocco, D. M (2006). cAMP-independent signaling regulates steroidogenesis in mouse Leydig cells in the absence of StAR phosphorylation.. J Mol Endocrinol 37: 81-95 [Abstract] [Full Text]  
• al Kandari, H., Katsumata, N., Alexander, S., Rasoul, M. A. (2006). Homozygous Mutation of P450 Side-Chain Cleavage Enzyme Gene (CYP11A1) in 46, XY Patient with Adrenal Insufficiency, Complete Sex Reversal, and Agenesis of Corpus Callosum. J. Clin. Endocrinol. Metab. 91: 2821-2826 [Abstract] [Full Text]  
• Daftary, G. S., Taylor, H. S. (2006). Endocrine Regulation of HOX Genes. Endocr. Rev. 27: 331-355 [Abstract] [Full Text]  
• Manna, P. R., Chandrala, S. P., King, S. R., Jo, Y., Counis, R., Huhtaniemi, I. T., Stocco, D. M. (2006). Molecular Mechanisms of Insulin-like Growth Factor-I Mediated Regulation of the Steroidogenic Acute Regulatory Protein in Mouse Leydig Cells. Mol. Endocrinol. 20: 362-378 [Abstract] [Full Text]  
• Baker, B. Y., Yaworsky, D. C., Miller, W. L. (2005). A pH-dependent Molten Globule Transition Is Required for Activity of the Steroidogenic Acute Regulatory Protein, StAR. J. Biol. Chem. 280: 41753-41760 [Abstract] [Full Text]  
• Bhangoo, A., Gu, W.-X., Pavlakis, S., Anhalt, H., Heier, L., Ten, S., Jameson, J. L. (2005). Phenotypic Features Associated with Mutations in Steroidogenic Acute Regulatory Protein. J. Clin. Endocrinol. Metab. 90: 6303-6309 [Abstract] [Full Text]  
• Fluck, C. E., Maret, A., Mallet, D., Portrat-Doyen, S., Achermann, J. C., Leheup, B., Theintz, G. E., Mullis, P. E., Morel, Y. (2005). A Novel Mutation L260P of the Steroidogenic Acute Regulatory Protein Gene in Three Unrelated Patients of Swiss Ancestry with Congenital Lipoid Adrenal Hyperplasia. J. Clin. Endocrinol. Metab. 90: 5304-5308 [Abstract] [Full Text]  
• Miller, W. L. (2005). Minireview: Regulation of Steroidogenesis by Electron Transfer. Endocrinology 146: 2544-2550 [Abstract] [Full Text]  
• Hauet, T., Yao, Z.-X., Bose, H. S., Wall, C. T., Han, Z., Li, W., Hales, D. B., Miller, W. L., Culty, M., Papadopoulos, V. (2005). Peripheral-Type Benzodiazepine Receptor-Mediated Action of Steroidogenic Acute Regulatory Protein on Cholesterol Entry into Leydig Cell Mitochondria. Mol. Endocrinol. 19: 540-554 [Abstract] [Full Text]  
• Chen, X., Baker, B. Y., Abduljabbar, M. A., Miller, W. L. (2005). A Genetic Isolate of Congenital Lipoid Adrenal Hyperplasia with Atypical Clinical Findings. J. Clin. Endocrinol. Metab. 90: 835-840 [Abstract] [Full Text]  
• Yaworsky, D. C., Baker, B. Y., Bose, H. S., Best, K. B., Jensen, L. B., Bell, J. D., Baldwin, M. A., Miller, W. L. (2005). pH-dependent Interactions of the Carboxyl-terminal Helix of Steroidogenic Acute Regulatory Protein with Synthetic Membranes. J. Biol. Chem. 280: 2045-2054 [Abstract] [Full Text]  
• Buholzer, C. F., Arrighi, J.-F., Abraham, S., Piguet, V., Capponi, A. M., Casal, A. J. (2005). Chicken Ovalbumin Upstream Promoter-Transcription Factor Is a Negative Regulator of Steroidogenesis in Bovine Adrenal Glomerulosa Cells. Mol. Endocrinol. 19: 65-75 [Abstract] [Full Text]  
• Hiort, O., Holterhus, P.-M., Werner, R., Marschke, C., Hoppe, U., Partsch, C.-J., Riepe, F. G., Achermann, J. C., Struve, D. (2005). Homozygous Disruption of P450 Side-Chain Cleavage (CYP11A1) Is Associated with Prematurity, Complete 46,XY Sex Reversal, and Severe Adrenal Failure. J. Clin. Endocrinol. Metab. 90: 538-541 [Abstract] [Full Text]  
• King, S. R., Ginsberg, S. D., Ishii, T., Smith, R. G., Parker, K. L., Lamb, D. J. (2004). The Steroidogenic Acute Regulatory Protein Is Expressed in Steroidogenic Cells of the Day-Old Brain. Endocrinology 145: 4775-4780 [Abstract] [Full Text]  
• Tuckey, R. C., Bose, H. S., Czerwionka, I., Miller, W. L. (2004). Molten Globule Structure and Steroidogenic Activity of N-218 MLN64 in Human Placental Mitochondria. Endocrinology 145: 1700-1707 [Abstract] [Full Text]  
• Zhang, F.-p., Pakarainen, T., Zhu, F., Poutanen, M., Huhtaniemi, I. (2004). Molecular Characterization of Postnatal Development of Testicular Steroidogenesis in Luteinizing Hormone Receptor Knockout Mice. Endocrinology 145: 1453-1463 [Abstract] [Full Text]  
• Gonzalez, A. A., Reyes, M. L., Carvajal, C. A., Tobar, J. A., Mosso, L. M., Baquedano, P., Solar, A., Venegas, A., Fardella, C. E. (2004). Congenital Lipoid Adrenal Hyperplasia Caused by a Novel Splicing Mutation in the Gene for the Steroidogenic Acute Regulatory Protein. J. Clin. Endocrinol. Metab. 89: 946-951 [Abstract] [Full Text]  
• Miller, W. L. (2004). Steroid 17{alpha}-Hydroxylase Deficiency--Not Rare Everywhere. J. Clin. Endocrinol. Metab. 89: 40-42 [Full Text]  
• Costa-Santos, M., Kater, C. E., Auchus, R. J. (2004). Two Prevalent CYP17 Mutations and Genotype-Phenotype Correlations in 24 Brazilian Patients with 17-Hydroxylase Deficiency. J. Clin. Endocrinol. Metab. 89: 49-60 [Abstract] [Full Text]  
• Granot, Z., Geiss-Friedlander, R., Melamed-Book, N., Eimerl, S., Timberg, R., Weiss, A. M., Hales, K. H., Hales, D. B., Stocco, D. M., Orly, J. (2003). Proteolysis of Normal and Mutated Steroidogenic Acute Regulatory Proteins in the Mitochondria: the Fate of Unwanted Proteins. Mol. Endocrinol. 17: 2461-2476 [Abstract] [Full Text]  
• Shen, W.-J., Patel, S., Natu, V., Hong, R., Wang, J., Azhar, S., Kraemer, F. B. (2003). Interaction of Hormone-sensitive Lipase with Steroidogeneic Acute Regulatory Protein: FACILITATION OF CHOLESTEROL TRANSFER IN ADRENAL. J. Biol. Chem. 278: 43870-43876 [Abstract] [Full Text]  
• Sugawara, T., Shimizu, H., Hoshi, N., Nakajima, A., Fujimoto, S. (2003). Steroidogenic Acute Regulatory Protein-binding Protein Cloned by a Yeast Two-hybrid System. J. Biol. Chem. 278: 42487-42494 [Abstract] [Full Text]  
• Soccio, R. E., Breslow, J. L. (2003). StAR-related Lipid Transfer (START) Proteins: Mediators of Intracellular Lipid Metabolism. J. Biol. Chem. 278: 22183-22186 [Full Text]  
• Casal, A. J., Silvestre, J.-S., Delcayre, C., Capponi, A. M. (2003). Expression and Modulation of Steroidogenic Acute Regulatory Protein Messenger Ribonucleic Acid in Rat Cardiocytes and after Myocardial Infarction. Endocrinology 144: 1861-1868 [Abstract] [Full Text]  
• Irusta, G., Parborell, F., Peluffo, M., Manna, P. R., Gonzalez-Calvar, S. I., Calandra, R., Stocco, D. M., Tesone, M. (2003). Steroidogenic Acute Regulatory Protein in Ovarian Follicles of Gonadotropin-Stimulated Rats Is Regulated by a Gonadotropin-Releasing Hormone Agonist. Biol. Reprod. 68: 1577-1583 [Abstract] [Full Text]  
• Schwarzenbach, H., Manna, P. R., Stocco, D. M., Chakrabarti, G., Mukhopadhyay, A. K. (2003). Stimulatory Effect of Progesterone on the Expression of Steroidogenic Acute Regulatory Protein in MA-10 Leydig Cells. Biol. Reprod. 68: 1054-1063 [Abstract] [Full Text]  
• King, S. R., Manna, P. R., Ishii, T., Syapin, P. J., Ginsberg, S. D., Wilson, K., Walsh, L. P., Parker, K. L., Stocco, D. M., Smith, R. G., Lamb, D. J. (2002). An Essential Component in Steroid Synthesis, the Steroidogenic Acute Regulatory Protein, Is Expressed in Discrete Regions of the Brain. J. Neurosci. 22: 10613-10620 [Abstract] [Full Text]  
• Koch, C. A., Pacak, K., Chrousos, G. P. (2002). The Molecular Pathogenesis of Hereditary and Sporadic Adrenocortical and Adrenomedullary Tumors. J. Clin. Endocrinol. Metab. 87: 5367-5384 [Abstract] [Full Text]  
• Tuckey, R. C., Headlam, M. J., Bose, H. S., Miller, W. L. (2002). Transfer of Cholesterol between Phospholipid Vesicles Mediated by the Steroidogenic Acute Regulatory Protein (StAR). J. Biol. Chem. 277: 47123-47128 [Abstract] [Full Text]  
• Manna, P. R., Huhtaniemi, I. T., Wang, X.-J., Eubank, D. W., Stocco, D. M. (2002). Mechanisms of Epidermal Growth Factor Signaling: Regulation of Steroid Biosynthesis and the Steroidogenic Acute Regulatory Protein in Mouse Leydig Tumor Cells. Biol. Reprod. 67: 1393-1404 [Abstract] [Full Text]  
• Ishii, T., Hasegawa, T., Pai, C.-I, Yvgi-Ohana, N., Timberg, R., Zhao, L., Majdic, G., Chung, B.-c., Orly, J., Parker, K. L. (2002). The Roles of Circulating High-Density Lipoproteins and Trophic Hormones in the Phenotype of Knockout Mice Lacking the Steroidogenic Acute Regulatory Protein. Mol. Endocrinol. 16: 2297-2309 [Abstract] [Full Text]  
• Li, H., Brochu, M., Wang, S. P., Rochdi, L., Cote, M., Mitchell, G., Gallo-Payet, N. (2002). Hormone-Sensitive Lipase Deficiency in Mice Causes Lipid Storage in the Adrenal Cortex and Impaired Corticosterone Response to Corticotropin Stimulation. Endocrinology 143: 3333-3340 [Abstract] [Full Text]  
• Eimerl, S., Orly, J. (2002). Regulation of Steroidogenic Genes by Insulin-Like Growth Factor-1 and Follicle-Stimulating Hormone: Differential Responses of Cytochrome P450 Side-Chain Cleavage, Steroidogenic Acute Regulatory Protein, and 3{beta}-Hydroxysteroid Dehydrogenase/Isomerase in Rat Granulosa Cells. Biol. Reprod. 67: 900-910 [Abstract] [Full Text]  
• Caulfield, M. P., Lynn, T., Gottschalk, M. E., Jones, K. L., Taylor, N. F., Malunowicz, E. M., Shackleton, C. H. L., Reitz, R. E., Fisher, D. A. (2002). The Diagnosis of Congenital Adrenal Hyperplasia in the Newborn by Gas Chromatography/Mass Spectrometry Analysis of Random Urine Specimens. J. Clin. Endocrinol. Metab. 87: 3682-3690 [Abstract] [Full Text]  
• Katsumata, N., Ohtake, M., Hojo, T., Ogawa, E., Hara, T., Sato, N., Tanaka, T. (2002). Compound Heterozygous Mutations in the Cholesterol Side-Chain Cleavage Enzyme Gene (CYP11A) Cause Congenital Adrenal Insufficiency in Humans. J. Clin. Endocrinol. Metab. 87: 3808-3813 [Abstract] [Full Text]  
• Kiiveri, S., Liu, J., Westerholm-Ormio, M., Narita, N., Wilson, D. B., Voutilainen, R., Heikinheimo, M. (2002). Differential Expression of GATA-4 and GATA-6 in Fetal and Adult Mouse and Human Adrenal Tissue. Endocrinology 143: 3136-3143 [Abstract] [Full Text]  
• Hu, M.-C., Hsu, N.-C., El Hadj, N. B., Pai, C.-I, Chu, H.-P., Wang, C.-K. L., Chung, B.-c. (2002). Steroid Deficiency Syndromes in Mice with Targeted Disruption of Cyp11a1. Mol. Endocrinol. 16: 1943-1950 [Abstract] [Full Text]  
• Achermann, J. C., Ozisik, G., Meeks, J. J., Jameson, J. L. (2002). Genetic Causes of Human Reproductive Disease. J. Clin. Endocrinol. Metab. 87: 2447-2454 [Full Text]  
• Kalantaridou, S. N., Chrousos, G. P. (2002). Monogenic Disorders of Puberty. J. Clin. Endocrinol. Metab. 87: 2481-2494 [Full Text]  
• Javitt, N. B. (2002). 25R,26-Hydroxycholesterol revisited: synthesis, metabolism, and biologic roles. J. Lipid Res. 43: 665-670 [Abstract] [Full Text]  
• Merke, D. P., Bornstein, S. R., Avila, N. A., Chrousos, G. P. (2002). Future Directions in the Study and Management of Congenital Adrenal Hyperplasia due to 21-Hydroxylase Deficiency. ANN INTERN MED 136: 320-334 [Abstract] [Full Text]  
• Gruber, C. J., Tschugguel, W., Schneeberger, C., Huber, J. C. (2002). Production and Actions of Estrogens. NEJM 346: 340-352 [Full Text]  
• Artemenko, I. P., Zhao, D., Hales, D. B., Hales, K. H., Jefcoate, C. R. (2001). Mitochondrial Processing of Newly Synthesized Steroidogenic Acute Regulatory Protein (StAR), but Not Total StAR, Mediates Cholesterol Transfer to Cytochrome P450 Side Chain Cleavage Enzyme in Adrenal Cells. J. Biol. Chem. 276: 46583-46596 [Abstract] [Full Text]  
• Tajima, T., Fujieda, K., Kouda, N., Nakae, J., Miller, W. L. (2001). Heterozygous Mutation in the Cholesterol Side Chain Cleavage Enzyme (P450scc) Gene in a Patient with 46,XY Sex Reversal and Adrenal Insufficiency. J. Clin. Endocrinol. Metab. 86: 3820-3825 [Abstract] [Full Text]  
• Stocco, D. M. (2001). Tracking the Role of a StAR in the Sky of the New Millennium. Mol. Endocrinol. 15: 1245-1254 [Abstract] [Full Text]  
• Cherradi, N., Capponi, A. M., Gaillard, R. C., Pralong, F. P. (2001). Decreased Expression of Steroidogenic Acute Regulatory Protein: A Novel Mechanism Participating in the Leptin-Induced Inhibition of Glucocorticoid Biosynthesis. Endocrinology 142: 3302-3308 [Abstract] [Full Text]  
• Richmond, E. J., Flickinger, C. J., McDonald, J. A., Lovell, M. A., Rogol, A. D. (2001). Lipoid Congenital Adrenal Hyperplasia (CAH): Patient Report and a Mini-Review. CLIN PEDIATR 40: 403-407  
• Calvo, R. M., Asunción, M., Tellería, D., Sancho, J., San Millán, J. L., Escobar-Morreale, H. F. (2001). Screening for Mutations in the Steroidogenic Acute Regulatory Protein and Steroidogenic Factor-1 Genes, and in CYP11A and Dosage-Sensitive Sex Reversal-Adrenal Hypoplasia Gene on the X Chromosome, Gene-1 (DAX-1), in Hyperandrogenic Hirsute Women. J. Clin. Endocrinol. Metab. 86: 1746-1749 [Abstract] [Full Text]  
• Lacroix, A., N'Diaye, N., Tremblay, J., Hamet, P. (2001). Ectopic and Abnormal Hormone Receptors in Adrenal Cushing's Syndrome. Endocr. Rev. 22: 75-110 [Abstract] [Full Text]  
• Collett-Solberg, P. F. (2001). Congenital Adrenal Hyperplasia: From Genetics and Biochemistry to Clinical Practice, Part 1. CLIN PEDIATR 40: 1-16 [Abstract]  
• Bose, H. S., Sato, S., Aisenberg, J., Shalev, S. A., Matsuo, N., Miller, W. L. (2000). Mutations in the Steroidogenic Acute Regulatory Protein (StAR) in Six Patients with Congenital Lipoid Adrenal Hyperplasia. J. Clin. Endocrinol. Metab. 85: 3636-3639 [Abstract] [Full Text]  
• Hasegawa, T., Zhao, L., Caron, K. M., Majdic, G., Suzuki, T., Shizawa, S., Sasano, H., Parker, K. L. (2000). Developmental Roles of the Steroidogenic Acute Regulatory Protein (StAR) as Revealed by StAR Knockout Mice. Mol. Endocrinol. 14: 1462-1471 [Abstract] [Full Text]  
• Sugawara, T., Saito, M., Fujimoto, S. (2000). Sp1 and SF-1 Interact and Cooperate in the Regulation of Human Steroidogenic Acute Regulatory Protein Gene Expression. Endocrinology 141: 2895-2903 [Abstract] [Full Text]  
• Katsumata, N., Kawada, Y., Yamamoto, Y., Noda, M., Nimura, A., Horikawa, R., Tanaka, T. (1999). A Novel Compound Heterozygous Mutation in the Steroidogenic Acute Regulatory Protein Gene in a Patient with Congenital Lipoid Adrenal Hyperplasia. J. Clin. Endocrinol. Metab. 84: 3983-3987 [Abstract] [Full Text]  
• Lehoux, J.-G., Hales, D. B., Fleury, A., Brière, N., Martel, D., Ducharme, L. (1999). The in Vivo Effects of Adrenocorticotropin and Sodium Restriction on the Formation of Different Species of Steroidogenic Acute Regulatory Protein in Rat Adrenal. Endocrinology 140: 5154-5164 [Abstract] [Full Text]  
• Bose, H. S., Whittal, R. M., Baldwin, M. A., Miller, W. L. (1999). The active form of the steroidogenic acute regulatory protein, StAR, appears to be a molten globule. Proc. Natl. Acad. Sci. USA 96: 7250-7255 [Abstract] [Full Text]  
• Silverman, E., Eimerl, S., Orly, J. (1999). CCAAT Enhancer-binding Protein beta  and GATA-4 Binding Regions within the Promoter of the Steroidogenic Acute Regulatory Protein (StAR) Gene Are Required for Transcription in Rat Ovarian Cells. J. Biol. Chem. 274: 17987-17996 [Abstract] [Full Text]  
• Korsch, E., Peter, M., Hiort, O., Sippell, W. G., Ure, B. M., Hauffa, B. P., Bergmann, M. (1999). Gonadal Histology with Testicular Carcinoma in Situ in a 15-Year-Old 46,XY Female Patient with a Premature Termination in the Steroidogenic Acute Regulatory Protein Causing Congenital Lipoid Adrenal Hyperplasia. J. Clin. Endocrinol. Metab. 84: 1628-1632 [Abstract] [Full Text]  
• Adashi, E. Y., Hennebold, J. D. (1999). Single-Gene Mutations Resulting in Reproductive Dysfunction in Women. NEJM 340: 709-718 [Full Text]  
• Wang, X., Liu, Z., Eimerl, S., Timberg, R., Weiss, A. M., Orly, J., Stocco, D. M. (1998). Effect of Truncated Forms of the Steroidogenic Acute Regulatory Protein on Intramitochondrial Cholesterol Transfer. Endocrinology 139: 3903-3912 [Abstract] [Full Text]  
• Lehoux, J.-G., Fleury, A., Ducharme, L. (1998). The Acute and Chronic Effects of Adrenocorticotropin on the Levels of Messenger Ribonucleic Acid and Protein of Steroidogenic Enzymes in Rat Adrenal in Vivo. Endocrinology 139: 3913-3922 [Abstract] [Full Text]  
• Luo, L., Chen, H., Stocco, D. M., Zirkin, B. R. (1998). Leydig Cell Protein Synthesis and Steroidogenesis in Response to Acute Stimulation by Luteinizing Hormone in Rats. Biol. Reprod. 59: 263-270 [Abstract] [Full Text]  
• Cherradi, N., Brandenburger, Y., Rossier, M. F., Vallotton, M. B., Stocco, D. M., Capponi, A. M. (1998). Atrial Natriuretic Peptide Inhibits Calcium-Induced Steroidogenic Acute Regulatory Protein Gene Transcription in Adrenal Glomerulosa Cells. Mol. Endocrinol. 12: 962-972 [Abstract] [Full Text]  
• Lin, T., Hu, J., Wang, D., Stocco, D. M. (1998). Interferon-{gamma} Inhibits the Steroidogenic Acute Regulatory Protein Messenger Ribonucleic Acid Expression and Protein Levels in Primary Cultures of Rat Leydig Cells. Endocrinology 139: 2217-2222 [Abstract] [Full Text]  
• Miller, W. L. (1998). Why Nobody Has P450scc (20,22 Desmoslase) Deficiencyg. J. Clin. Endocrinol. Metab. 83: 1399-1400 [Full Text]  
• Ariyoshi, N., Kim, Y.-C., Artemenko, I., Bhattacharyya, K. K., Jefcoate, C. R. (1998). Characterization of the Rat Star Gene That Encodes the Predominant 3.5-Kilobase Pair mRNA. ACTH STIMULATION OF ADRENAL STEROIDS IN VIVO PRECEDES ELEVATION OF Star mRNA AND PROTEIN. J. Biol. Chem. 273: 7610-7619 [Abstract] [Full Text]  
• Brand, C., Cherradi, N., Defaye, G., Chinn, A., Chambaz, E. M., Feige, J.-J., Bailly, S. (1998). Transforming Growth Factor beta 1 Decreases Cholesterol Supply to Mitochondria via Repression of Steroidogenic Acute Regulatory Protein Expression. J. Biol. Chem. 273: 6410-6416 [Abstract] [Full Text]  
• Arakane, F., King, S. R., Du, Y., Kallen, C. B., Walsh, L. P., Watari, H., Stocco, D. M., Strauss III, J. F. (1997). Phosphorylation of Steroidogenic Acute Regulatory Protein (StAR) Modulates Its Steroidogenic Activity. J. Biol. Chem. 272: 32656-32662 [Abstract] [Full Text]  
• Pollack, S. E., Furth, E. E., Kallen, C. B., Arakane, F., Kiriakidou, M., Kozarsky, K. F., Strauss, J. F. III (1997). Localization of the Steroidogenic Acute Regulatory Protein in Human Tissues. J. Clin. Endocrinol. Metab. 82: 4243-4251 [Abstract] [Full Text]  
• Fu, G. K., Lin, D., Zhang, M. Y. H., Bikle, D. D., Shackleton, C. H. L., Miller, W. L., Portale, A. A. (1997). Cloning of Human 25-Hydroxyvitamin D-1{alpha}-Hydroxylase and Mutations Causing Vitamin D-Dependent Rickets Type 1. Mol. Endocrinol. 11: 1961-1970 [Abstract] [Full Text]  
• Clark, B. J., Combs, R., Hales, K. H., Hales, D. B., Stocco, D. M. (1997). Inhibition of Transcription Affects Synthesis of Steroidogenic Acute Regulatory Protein and Steroidogenesis in MA-10 Mouse Leydig Tumor Cells. Endocrinology 138: 4893-4901 [Abstract] [Full Text]  
• Caron, K. M., Soo, S.-C., Wetsel, W. C., Stocco, D. M., Clark, B. J., Parker, K. L. (1997). Targeted disruption of the mouse gene encoding steroidogenic acute regulatory protein provides insights into congenital lipoid adrenal hyperplasia. Proc. Natl. Acad. Sci. USA 94: 11540-11545 [Abstract] [Full Text]  
• Watari, H., Arakane, F., Moog-Lutz, C., Kallen, C. B., Tomasetto, C., Gerton, G. L., Rio, M.-C., Baker, M. E., Strauss, J. F. III (1997). MLN64 contains a domain with homology to the steroidogenic acute regulatory protein (StAR) that stimulates steroidogenesis. Proc. Natl. Acad. Sci. USA 94: 8462-8467 [Abstract] [Full Text]  
• Okuyama, E., Nishi, N., Onishi, S., Itoh, S., Ishii, Y., Miyanaka, H., Fujita, K., Ichikawa, Y. (1997). A Novel Splicing Junction Mutation in the Gene for the Steroidogenic Acute Regulatory Protein Causes Congenital Lipoid Adrenal Hyperplasia. J. Clin. Endocrinol. Metab. 82: 2337-2342 [Abstract] [Full Text]  
• Bose, H. S., Pescovitz, O. H., Miller, W. L. (1997). Spontaneous Feminization in a 46,XX Female Patient with Congenital Lipoid Adrenal Hyperplasia Due to a Homozygous Frameshift Mutation in the Steroidogenic Acute Regulatory Protein. J. Clin. Endocrinol. Metab. 82: 1511-1515 [Abstract] [Full Text]  
• Cherradi, N., Rossier, M. F., Vallotton, M. B., Timberg, R., Friedberg, I., Orly, J., Wang, X. J., Stocco, D. M., Capponi, A. M. (1997). Submitochondrial Distribution of Three Key Steroidogenic Proteins (Steroidogenic Acute Regulatory Protein and Cytochrome P450scc and 3beta -Hydroxysteroid Dehydrogenase Isomerase Enzymes) upon Stimulation by Intracellular Calcium in Adrenal Glomerulosa Cells. J. Biol. Chem. 272: 7899-7907 [Abstract] [Full Text]  
• Alpy, F., Stoeckel, M.-E., Dierich, A., Escola, J.-M., Wendling, C., Chenard, M.-P., Vanier, M. T., Gruenberg, J., Tomasetto, C., Rio, M.-C. (2001). The Steroidogenic Acute Regulatory Protein Homolog MLN64, a Late Endosomal Cholesterol-binding Protein. J. Biol. Chem. 276: 4261-4269 [Abstract] [Full Text]  
• Christensen, K., Bose, H. S., Harris, F. M., Miller, W. L., Bell, J. D. (2001). Binding of Steroidogenic Acute Regulatory Protein to Synthetic Membranes Suggests an Active Molten Globule. J. Biol. Chem. 276: 17044-17051 [Abstract] [Full Text]