A Mutation in the Interferon- –Receptor Gene and Susceptibility to Mycobacterial Infection
Melanie J. Newport, M.D., Ph.D., Clare M. Huxley, Ph.D., Sara Huston, B.Sc., Catherine M. Hawrylowicz, Ph.D., Ben A. Oostra, Ph.D., Robert Williamson, Ph.D., and Michael Levin, F.R.C.P., Ph.D.
Background Genetic differences in immune responses may affectsusceptibility to mycobacterial infection, but no specific geneshave been implicated in humans. We studied four children whohad an unexplained genetic susceptibility to mycobacterial infectionand who appeared to have inherited the same recessive mutationfrom a common ancestor.
Methods We used microsatellite analysis, immunofluorescencestudies, and sequence analysis to study the affected patients,unaffected family members, and normal controls.
Results A genome search using microsatellite markers identifieda region on chromosome 6q in which the affected children wereall homozygous for eight markers. The gene for interferon- receptor1 maps to this region. Immunofluorescence studies showed thatthe receptor was absent on leukocytes from the affected children.Sequence analysis of complementary DNA for the gene for interferon- receptor 1 revealed a point mutation at nucleotide 395 thatintroduces a stop codon and results in a truncated protein thatlacks the transmembrane and cytoplasmic domains.
Conclusions Four children with severe mycobacterial infectionshad a mutation in the gene for interferon- receptor 1 that leadsto the absence of receptors on cell surfaces and a functionaldefect in the up-regulation of tumor necrosis factor by macrophagesin response to interferon-. The interferon- pathway is importantin the response to intracellular pathogens such as mycobacteria.
The World Health Organization has estimated that more than 1.7billion persons are infected with Mycobacterium tuberculosisworldwide.1,2 A puzzling feature of mycobacterial infectionis that clinically evident disease occurs in only a small proportionof those who are infected. However, the mechanisms that distinguisha successful immune response, which contains the infection,from an ineffective response, which enables progressive diseaseto occur, remain poorly understood. Familial clustering, racialdifferences in incidence, and twin studies suggest that geneticfactors have a role in susceptibility.3,4,5 However, in contrastto the situation in mice, in which a number of single gene defectshave been associated with susceptibility to intracellular pathogens,including mycobacteria,6,7,8,9,10 no such genes have been identifiedin humans.
We have previously described a group of related children froma village in Malta who appear to have a familial immunologicdefect predisposing them to infection with a range of mycobacteria.11Despite intensive treatment three of the four affected patientshave died, and the survivor has persistent infection. Immunologicstudies have shown that the affected children have defectiveproduction of tumor necrosis factor (TNF-) in response to endotoxinand a failure to up-regulate this cytokine in response to interferon-.11
It is likely that all four affected Maltese children have thesame autosomal recessive disorder owing to a single mutationintroduced by a common ancestor.12 The mutation originally occurredon a single chromosome and is therefore associated with a particularhaplotype inherited with the mutant allele. It is possible toidentify the chromosomal location of a recessive gene in suchfamilies by searching for regions of the genome for which allthe affected family members are homozygous by descent.13,14Candidate genes identified within the region of homology canthen be analyzed for causative mutations. We have used thisapproach to identify the genetic defect underlying the increasedsusceptibility to mycobacterial infection in our patients.
Methods
Patients
The characteristics of the patients have been described elsewhere.11Briefly, four children from the same small town in Malta presentedwith disseminated atypical mycobacterial infection in the absenceof a recognized immunodeficiency. They all had fever, weightloss, hepatosplenomegaly, bone lesions, and an intense acute-phaseresponse. Two of the affected children are brothers whose parentsare second cousins, and the third is related to them as a fourthcousin through both sets of parents. The family pedigree hasbeen described elsewhere,11,12 and the numbering of patientsand family members follows that of Newport et al.12 The geneticlink between these three children and the fourth child has notbeen determined, but they all come from the same town, whereintermarriage between families is common. Each child was infectedwith a different species or strain of mycobacterium (M. fortuitum,M. chelonei, and two strains of M. avium), suggesting a defectin host immunity, and one child also had a prolonged episodeof salmonellosis. It is therefore likely that the children allhad the same recessively inherited defect. Three of the childrenhave died as a result of their infections.
All family members agreed to participate in this study, whichwas approved by the hospitals' ethics committees.
Microsatellite Analysis
DNA was prepared from peripheral-blood lymphocytes accordingto standard methods.15 A set of polymorphic microsatellitesderived from both the Genethon catalogue and the CooperativeHuman Linkage Center were typed in the parents and three ofthe affected children. Amplification was performed with thepolymerase chain reaction (PCR) according to standard Genethonconditions.16 Amplified products were resolved on 6 percentpolyacrylamide sequencing gels. The subjects were subsequentlytyped for additional markers in the region of homozygosity.
Immunofluorescence Studies of Peripheral-Blood Leukocytes
Peripheral-blood mononuclear cells were prepared by Ficoll–Hypaque(Nycomed, Oslo, Norway) gradient centrifugation. Granulocyteswere isolated from the erythrocyte pellet by lysis of red cellswith 155 mM ammonium chloride. The cells were incubated for30 to 60 minutes on ice with 2 to 5 µg of an isotype controlper milliliter (Becton Dickinson, Oxford, United Kingdom) or2 to 5 µg of antibodies against interferon- receptor 1per milliliter (mouse IgG2b [1224-00] or mouse IgG1 [1223-01];Genzyme, Cambridge, Mass.). Both antibodies are directed againstthe extracellular domain. Bound antibody was detected with goatantimouse IgG antibody labeled with fluorescein isothiocyanate(Dako, Teddington, United Kingdom). A minimum of 3000 cellswas analyzed for each test with an Epics Profile II cell analyzer(Coulter Electronics, Luton, United Kingdom). For the analysisof up-regulation of the receptor, lymphocytes were culturedfor 24 hours in the presence or absence of 400 nM dexamethasone(Sigma Chemical, St. Louis).17
Sequence Analysis of Complementary DNA for the Gene for Interferon- Receptor 1
In three of the affected patients and an unrelated control,messenger RNA (mRNA) was extracted with the Microfast Trackkit (Invitrogen, San Diego, Calif.) from 1 million lymphocytesafter transformation with the Epstein–Barr virus (EBV).Reverse transcription was accomplished with a complementaryDNA (cDNA) cycle kit (Invitrogen), and the open reading frameof the gene for interferon- receptor 1 was amplified by PCRwith the primers 5'CCAGCGACCGTCGGTAGCAGC3' and 5'ATCCTCTTTACGCTTTCAT3',designed from published sequence data.18 The PCR products werecloned with the TA (Invitrogen) cloning kit. One to five clonesfrom separate PCR reactions from each subject were sequencedwith the Sequenase kit (Amersham, Amersham, United Kingdom)according to the manufacturer's instructions.
For the PCR assay of genomic DNA from members of the affectedfamilies, primers were designed (5'GTTAAAGCCAGGGTTGGACA3' and5'CATCTCGGCATACAGCAAATTCTTGT3') to amplify a 70-bp fragmentacross the mutation site from genomic DNA. A single-base mismatchwas introduced at the penultimate 3' nucleotide of the reverseprimer sequence (a substitution of G for C, shown underlinedin the primer) in order to create a Tsp45I restriction sitein normal DNA. This enzyme recognizes the sequence GTCAC (orGTGAC). The normal genomic sequence is GTCAG for nucleotides393 to 397; the mismatch in the reverse primer introduces aC at position 397, thus creating a Tsp45I site. However, inthe mutant sequence, there is an A at position 395 and the restrictionsite is lost. PCR amplification was performed in a total volumeof 30 µl containing 100 ng of DNA; 10 pM of each primer;3.5 mM magnesium chloride; 75 mM potassium chloride; 10 mM TRIS(pH 9.2); 200 µM each of deoxyadenosine triphosphate,deoxycytosine triphosphate, deoxyguanosine triphosphate, anddeoxythymidine triphosphate; and 1 U of Taq polymerase at anannealing temperature of 55°C. Amplified products were digestedwith Tsp45I, resolved on 15 percent polyacrylamide gels, stainedwith ethidium bromide, and visualized under ultraviolet light.
Interferon- Responses
The ability of interferon- to up-regulate the production ofTNF- by monocytes was studied with an in vitro whole-blood assay,as described elsewhere.11 The production of TNF- in responseto Escherichia coli lipopolysaccharide (1 µg per milliliter)was compared with TNF- production induced by the same concentrationof lipopolysaccharide after pretreatment with interferon- (2µg per milliliter) for two hours. Plasma TNF- levels weremeasured with an enzyme-linked immunosorbent assay.19
Results
In an initial screening, 360 polymorphic microsatellite markersspaced at intervals of approximately 11 cM across the genomewere typed in three of the affected children and their parents.Haplotype sharing on three or more of the six affected chromosomeswas observed on a total of 42 chromosomal regions. These regionswere further analyzed with additional microsatellite markersto determine whether they were identical by state or by descent.A single 5-cM region was identified on chromosome 6q in whichall three affected children were homozygous for the same allelesfor eight microsatellites, whereas their parents and unaffectedsiblings were not (Figure 1). The gene for interferon- receptor1 is located in this region21 and seemed a likely candidategene, since mice lacking this gene are susceptible to infectionswith mycobacteria.7
Figure 1. Haplotypes of Affected Children, Their Parents, and Unaffected Siblings in the Region of Chromosome 6q22–q23.
Squares denote male family members, circles female family members, solid symbols affected family members, and symbols with a slash deceased family members. Plus signs denote markers typed in the genome-wide screening. The order of markers and genetic distances indicated were derived from data from Genethon or the Cooperative Human Linkage Center.16,20 The numbering of subjects corresponds to the pedigree in Newport et al.12 Vertical lines represent the region of homology identified on affected chromosomes. Positions of meiotic recombination are indicated by dashes. The asterisk denotes a single allele in this region for which Subject III-6 was not homozygous. Subject II-3 was not typed for marker D6S1675 (ND).
To establish whether the expression of interferon- receptor1 was defective on the cells of the affected children, we investigatedthe binding of two monoclonal antibodies with specificitiesfor different epitopes of the extracellular domain of the receptor.The antibodies did not bind to freshly isolated monocytes, neutrophils,or lymphocytes from the only surviving child, Subject III-4(Figure 2A, Figure 2B, and Figure 2C). The extent of bindingto the cells from his mother (Subject II-4) was intermediate.Similarly, there was no binding to stored lymphocytes from SubjectIII-1 (Figure 2D), whereas the extent of binding to his parents'cells (Subjects II-1 and II-2) was intermediate between thatof the patients and that of the healthy controls (Figure 2A,Figure 2B, Figure 2C, and Figure 2D). The expression of othercell-surface proteins, including CD14, CD16, CD3, and the receptorfor granulocyte–macrophage colony-stimulating factor,was normal (data not shown). Preincubation of fresh peripheral-bloodmononuclear cells with dexamethasone resulted in the up-regulationof the receptor on lymphocytes from the control and an unaffectedparent (Subject II-4), but not from the affected child (SubjectIII-4) (Figure 2C).
Figure 2. Level of Expression of Interferon- Receptor 1 on the Surface of Peripheral-Blood Cells from the Patients, Their Parents, and Healthy Controls.
There was little or no expression of interferon- receptor 1 on the surface of the patients' cells and an intermediate level of expression on the parents' cells. Panel A shows the binding of monoclonal antibody against interferon- receptor 1 (mouse IgG2b) to fresh monocytes from Subject III-4, his mother (Subject II-4), and a healthy adult control. The solid line indicates binding of the specific antibody; the dotted line indicates binding of an appropriate isotype control antibody. No increase in fluorescence above background levels was detected on the patient's cells (mean fluorescence, 2.42; background, 2.34). There is clear binding to adult control cells (mean fluorescence, 8.53; background, 2.54) and an intermediate level of binding to the maternal cells (mean fluorescence, 5.61; background, 2.13).
Panel B shows the binding of two monoclonal antibodies against interferon- receptor 1 to fresh neutrophils from a patient (Subject III-4), his mother (Subject II-4), and a healthy adult control. Panel C shows the binding of monoclonal antibody against interferon- receptor 1 (mouse IgG1) to lymphocytes from a patient (Subject III-4), his mother (Subject II-4), and a healthy adult control. Solid bars represent binding to cells cultured in medium alone, and open bars represent binding to cells incubated overnight with dexamethasone. Panel D shows the binding of monoclonal antibody against interferon- receptor 1 (mouse IgG2b) to stored lymphocytes from a patient (Subject III-1), his parents (Subjects II-1 and II-2), and healthy adult and age-matched child controls. In each case values have been adjusted for the level of background fluorescence.
Northern analysis of mRNA from EBV-transformed B lymphocytesshowed no difference in the expression of the gene for interferon-receptor 1 between affected children and an unrelated control(data not shown). The cDNA was prepared from the EBV-transformedlymphocytes by reverse-transcription PCR and sequenced. A substitutionof A for C, which results in a stop codon, was identified atposition 395 of the coding sequence in all affected children(Figure 3A).
Figure 3. Characterization of the Mutation in the Gene for Interferon- Receptor 1 in Patients with Disseminated Mycobacterial Infection and Their Families.
Panel A shows the sequence of the cDNA for the gene for interferon- receptor 1 in three of the affected children (Subjects III-1, III-4, and III-6) and an unrelated, unaffected control. The asterisk indicates the substitution of A for C at position 395. The A tracks from each subject were loaded next to each other, as were the C, G, and T tracks. Panel B shows the results of the PCR assay that used genomic DNA. The symbols are defined in Figure 1. The affected children (Subjects III-1, III-4, and III-6) all have a single uncut band and are homozygous for the mutation. Their parents have both cut and uncut fragments and are all heterozygous for the mutation. Subject III-7 is homozygous for the normal sequence.
In order to validate this finding in genomic DNA, a PCR assaywas designed that incorporates the site of the mutation intoa Tsp45I restriction site (as described in the Methods section).The affected children are homozygous for the mutation, whereastheir parents are heterozygous carriers (Figure 3B). SiblingsIII-2 and III-5 are heterozygous, whereas sibling III-7 is homozygousfor the normal sequence (Figure 3B), as they are for the microsatellitesaround the mutation (Figure 1).
Consistent with the mutation in the gene for interferon- receptor1 and the absence of interferon- –receptor 1 protein oncell surfaces as detected by the monoclonal antibodies, TNF-production in response to interferon- was markedly lower inthe surviving affected child than in healthy controls; his parentshad intermediate responses (Figure 4).
Figure 4. TNF- Production in Response to Stimulation of Whole Blood with Phosphate-Buffered Saline (PBS), Lipopolysaccharide (LPS) Alone, or Lipopolysaccharide and Interferon- (IFN-) in the Surviving Affected Child, His Parents, and Control Subjects.
The affected child (Subject III-4) has markedly reduced TNF- production in contrast to a control child, who has localized atypical mycobacterial infection, and a healthy adult control, whereas his parents have intermediate responses.
Discussion
We have shown that a novel immunodeficiency predisposing affectedpersons to mycobacterial infection is caused by a mutation inthe gene for interferon- receptor 1. We have mapped the defectto the same chromosomal region as the receptor gene and identifieda point mutation in the coding region. The substitution of Afor C at position 395 results in a new stop codon and in theproduction of a truncated protein that would be predicted tolack the membrane-binding region and the intracellular domainand would be unlikely to be expressed on the cell surface (Figure 5A).
Figure 5. Structure of the Interferon- –Receptor 1 Protein and a Model of the Interferon- Receptor Complex.
Panel A shows the structure of the interferon-–receptor 1 protein and the position of the mutation. The structure was based on the model of Farrar and Schreiber.22 The mutation results in a premature stop codon. Interferon- –receptor 1 is a transmembrane protein with an extracellular domain of 228 amino acids, a transmembrane domain of 23 amino acids, and an intracellular domain of 221 amino acids that is rich in serine and threonine residues, which are phosphorylated on ligand binding. The shaded sections represent functionally important areas required for signal transduction. The mutant protein lacks the transmembrane and intracellular domains required for signal transduction. Panel B shows a model of the interferon- –receptor complex and signal transduction based on the data of Kotenko et al.23 On the left side both interferon- receptor 1 (green bars) and interferon- receptor 2 (red bars) extend through the cell membrane. The protein kinases Jak 1 and Jak 2 are in close association with the two chains of the receptor. In the middle of the panel, on binding of interferon- (IFN-; yellow boxes), the chains associate, triggering phosphorylation (•), which exposes a binding site for Stat 1. The right side of the panel shows a proposed model to explain residual cell activation in affected patients. Interferon- may associate either with the truncated interferon- receptor 1 or with interferon- receptor 2 directly.
The major defects in immunologic function observed in the affectedpatients are the failure of interferon- to up-regulate the productionof TNF- by macrophages and defective antigen processing andpresentation.11,24 Unlike the situation in cells from healthycontrols, in monocytes from the patients exogenous interferon-induces only a small increase in TNF- production in vitro (Figure 4).These findings are explained by our molecular studies showinga mutation in the gene for interferon- receptor 1 and by ourcellular studies confirming the absence of the expression ofinterferon- receptor 1 on cell surfaces as detected by the bindingof monoclonal antibodies to the extracellular domain of thereceptor. However, given the absence of interferon- receptor1 on cell surfaces, it is surprising that we observed any up-regulationof monocytes by interferon-. It is also surprising that thereappeared to have been clinical improvement associated with theadministration of interferon- to three of the patients.11 Thisparadox may be explained by considering the function of thevarious components of the interferon- receptor (Figure 5B).
Interferon- induces cellular activation by binding to a receptorcomplex consisting of at least two subunits: the interferon-–binding subunit (interferon- receptor 1) and a chromosome21–encoded transmembrane accessory factor (interferon-receptor 2) (Figure 5B).25 Both components of the receptor arethought to be required for normal signal transduction. Bindingof interferon- induces dimerization of the interferon- receptor1, which associates with interferon- receptor 2 (Figure 5B).There is evidence that interferon- interacts with both interferon-receptor 1 and interferon- receptor 2 during the process ofassociation of the two receptor proteins.23 The Janus proteinkinases Jak 1 and Jak 2 are associated with the intracellulardomains of interferon- receptor 1 and interferon- receptor 2,respectively, and are brought together and activated by phosphorylationby the binding of interferon- to the receptor complex. Thisresults in the phosphorylation of tyrosine at position 457 ofthe interferon- receptor 1 chain and produces a binding sitefor Stat 1 (signal transduction and activation of transcriptionprotein), leading to the phosphorylation, homodimerization,and subsequent dissociation of Stat 1 from the interferon- –receptorcomplex.26 The Stat 1 dimer translocates to the nucleus andinteracts with -activation sequences in the promoter regionsof interferon- –inducible genes, resulting in their transcription(Figure 5B).
The mutation present in our patients severely disrupts the functionof the interferon-receptor complex, since interferon- receptor1 is required both for binding of interferon- and for signaltransduction. The small residual response to interferon- observedin our patients and the apparent clinical response to exogenousinterferon- have a number of possible explanations. The truncatedextracellular domain of interferon- receptor 1 may be transportedto the cell surface and shed into the plasma, since the membraneanchor is absent. Interferon- may associate with the truncatedreceptor in the plasma, and the complex may interact with interferon-receptor 2, allowing some signal transduction through this receptor(Figure 5B). Alternatively, interferon- may bind directly tointerferon- receptor 2 and induce a minor degree of cellularactivation. In the absence of the transmembrane region of interferon-receptor 1, signaling through the Janus kinases is likely tobe markedly reduced. Finally, interferon- may induce a milderdegree of cellular activation through an as yet unidentifiedadditional receptor. Most of what is known about the functionsof the human interferon- –receptor complex has been learnedby studying human–rodent chimeras in which individualcomponents of the receptor complex can be knocked out.23 Ourpatients provide an opportunity to study the receptor in whatmight be considered a knockout in humans, and further studiesare required to explain their residual response to interferon-fully.
A large literature documents the importance of interferon- inthe up-regulation of murine macrophage function to control intracellularorganisms, including mycobacteria, salmonella, and leishmania.27Interferon- produced by T cells and natural killer cells inducesmacrophage activation, resulting in increased production ofinterleukin-1 and TNF-,28 enhanced antigen presentation,29 andincreased production of nitric oxide30 and reactive-oxygen intermediates.31Murine macrophages activated by interferon- are able to limitthe growth of mycobacteria in vitro, and there appears to besynergy between interferon- and TNF-.32 Mice in which the genefor interferon- has been disrupted have defective productionof macrophage antimicrobial products and reduced expressionof major-histocompatibility-complex class II antigens and dieof disseminated mycobacterial infection.10 Moreover, mice lackinginterferon- receptor 1 have a similar phenotype to those withdisruption of the interferon- gene and are susceptible to infectionwith intracellular pathogens.7 Despite these data in mice, thereis no clear evidence that interferon- enhances the killing ofmycobacteria in vitro by human macrophages.33,34,35 However,treatment with interferon- resulted in clinical improvementin a group of patients with refractory disseminated nontuberculousmycobacterial infection.11,36
A striking feature of the immune defect in these children isthat it is highly specific for mycobacteria and possibly otherintracellular pathogens such as salmonella. They have not hadinfections with conventional bacteria or fungi and have copedwith viral infections normally. The interferon- pathway hasbeen implicated in the immune response to virtually all infectiousagents, including fungi, parasites, and bacteria.37 The specificityof the defect in these children suggests that there must bea redundancy of immunologic mechanisms against most of thesepathogens but not against mycobacteria. Perhaps the successof mycobacteria as human pathogens is due to the absence ofoverlapping immunologic responses able to control their growthin humans.
Elucidation of the basis of this rare immunodeficiency not onlyprovides important information on the role of the interferon-pathway in human immunity, but also identifies a gene with apotentially crucial role in determining susceptibility to mycobacterialdisease. Clearly, the complete absence of interferon- receptor1 on cell surfaces induces so profound an immune defect thatsuch mutations are unlikely to explain mycobacterial susceptibilityin the general population. However, the existence of heterozygouscarriers of the defect or more subtle variations in this genemight explain differences in mycobacterial susceptibility withinthe population. The interferon- pathway may be an importantpotential target for immunotherapy of mycobacterial infections.
Supported in part by St. Mary's Hospital Special Trustees.
We are indebted to Lodewijk Sandkuijl for helpful discussionsregarding the feasibility of a genome search to map the genein these families; to Gideon Lack and Laura Guida for assistancewith immunofluorescence studies; to Sushila d'Souza for establishingthe EBV-transformed lymphocyte lines; to Jean Weissenbach fordisclosure of microsatellite primer sequences before the datawere published; to members of the Department of Clinical Genetics,Erasmus University, Rotterdam, in particular Leon Testers, GuidoBreedveld, and Peter Heutink, for their hospitality and assistancewhile genotype studies were conducted; and to Graham Davies,the Maltese pediatricians Herbert Lenicker and Paul VassalloAgius, and the families for their help with this study.
Source Information
From the Departments of Pediatrics (M.J.N., M.L.), Biochemistry and Molecular Genetics (M.J.N., C.M. Huxley, S.H., R.W.), and Immunology (C.M. Hawrylowicz), Imperial College School of Medicine at St. Mary's, London; and the Department of Clinical Genetics, Erasmus University, Rotterdam, the Netherlands (B.A.O.).
Address reprint requests to Dr. Levin at the Department of Pediatrics, Queen Elizabeth the Queen Mother Wing, St. Mary's Hospital, South Wharf Rd., London W2 1NY, United Kingdom.
References
Kochi A. The global tuberculosis situation and the new control strategy of the World Health Organization. Tubercle 1991;72:1-6. [CrossRef][Medline]
Horsburgh CR Jr, Selik RM. The epidemiology of disseminated nontuberculous mycobacterial infection in the acquired immunodeficiency syndrome (AIDS). Am Rev Respir Dis 1989;139:4-7. [Medline]
Fine PEM. Immunogenetics of susceptibility to leprosy, tuberculosis, and leishmaniasis: an epidemiological perspective. Int J Lepr Other Mycobact Dis 1981;49:437-454. [Medline]
Comstock GW. Tuberculosis in twins: a re-analysis of the Prophit survey. Am Rev Respir Dis 1978;117:621-624. [Medline]
Kallmann FJ, Reisner D. Twin studies on the significance of genetic factors in tuberculosis. Am Rev Tuberc 1943;47:549-74.
Blackwell JM. The macrophage resistance gene, Lsh/Ity/Bcg. Res Immunol 1989;140:767-769.
Kamijo R, Le J, Shapiro D, et al. Mice that lack the interferon-gamma receptor have profoundly altered responses to infection with Bacillus Calmette-Guerin and subsequent challenge with lipopolysaccharide. J Exp Med 1993;178:1435-1440. [Free Full Text]
Pfeffer K, Matsuyama T, Kundig TM, et al. Mice deficient for the 55 kd tumor necrosis factor receptor are resistant to endotoxic shock, yet succumb to L. monocytogenes infection. Cell 1994;73:457-467.
Flynn JL, Chan J, Triebold KJ, Dalton DK, Stewart TA, Bloom BR. An essential role for interferon in resistance to Mycobacterium tuberculosis infection. J Exp Med 1993;178:2249-2254. [Free Full Text]
Cooper AM, Dalton DK, Stewart TA, Griffin JP, Russell DG, Orme IM. Disseminated tuberculosis in interferon gene-disrupted mice. J Exp Med 1993;178:2243-2247. [Free Full Text]
Levin M, Newport MJ, D'Souza S, et al. Familial disseminated atypical mycobacterial infection in childhood: a human mycobacterial susceptibility gene? Lancet 1995;345:79-83. [CrossRef][Medline]
Newport M, Levin M, Blackwell JM, Shaw MA, Williamson R, Huxley C. Evidence for exclusion of a mutation in NRAMP as the cause of familial disseminated atypical mycobacterial infection in a Maltese kindred. J Med Genet 1995;32:904-906. [Free Full Text]
Lander ES, Botstein D. Homozygosity mapping: a way to map human recessive traits with the DNA of inbred children. Science 1987;236:1567-1570. [Free Full Text]
Houwen RHJ, Baharloo S, Blankenship K, et al. Genome screening by searching for shared segments: mapping a gene for benign recurrent intrahepatic cholestasis. Nat Genet 1994;8:380-386. [CrossRef][Medline]
Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Vol. 2. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1989.
Gyapay G, Morissette J, Vignal A, et al. The 1993-94 Genethon human genetic linkage map. Nat Genet 1994;7:246-339. [CrossRef][Medline]
Strickland RW, Wahl LM, Finbloom DS. Corticosteroids enhance the binding of recombinant interferon- to cultured human monocytes. J Immunol 1986;137:1577-1580. [Abstract]
Aguet M, Dembic Z, Merlin G. Molecular cloning and expression of the human interferon- receptor. Cell 1988;55:273-280. [CrossRef][Medline]
Klein NJ, Kalabalikis P, Curtis N, et al. Ex-vivo assessment of candidate anti-inflammatory agents in the treatment of gram negative sepsis. Immunol Infect Dis 1994;4:33-5.
Dib C, Faure S, Fizames C, et al. A comprehensive genetic map of the human genome based on 5,264 microsatellites. Nature 1996;380:152-154. [CrossRef][Medline]
Pfizenmaier K, Wiegmann K, Scheurich P, et al. High affinity human IFN--binding capacity is encoded by a single receptor gene located in proximity to c-ros on human chromosome region 6q16 to 6q22. J Immunol 1988;141:856-860. [Abstract]
Farrar MA, Schreiber RD. The molecular cell biology of interferon-gamma and its receptor. Annu Rev Immunol 1993;11:571-611. [CrossRef][Medline]
Kotenko SV, Izotova LS, Pollack BP, et al. Interaction between the components of the interferon receptor complex. J Biol Chem 1995;270:20915-20921. [Free Full Text]
D'Souza S, Levin M, Faith A, et al. Defective antigen processing associated with familial disseminated mycobacteriosis. Clin Exp Immunol 1996;103:35-39. [CrossRef][Medline]
Soh J, Donnelly RJ, Kotenko S, et al. Identification and sequence of an accessory factor required for activation of the human interferon receptor. Cell 1994;76:793-802. [CrossRef][Medline]
Greenlund AC, Farrar MA, Viviano BL, Schreiber RD. Ligand-induced IFN gamma receptor tyrosine phosphorylation couples the receptor to its signal transduction system (p91). EMBO J 1994;13:1591-1600. [Medline]
Chan J, Kaufmann SHE. Immune mechanisms of protection. In: Bloom BR, ed. Tuberculosis: pathogenesis, protection, and control. Washington, D.C.: American Society for Microbiology Press, 1994:389-415.
Orme IM, Roberts AD, Griffin JP, Abrams JS. Cytokine secretion by CD4 T lymphocytes acquired in response to Mycobacterium tuberculosis infection. J Immunol 1993;151:518-525. [Abstract]
Wong GH, Clark-Lewis I, McKimm-Breschkin L, Harris AW, Schrader JW. Interferon- induces enhanced expression of Ia and H-2 antigens on B lymphoid, macrophage, and myeloid cell lines. J Immunol 1983;131:788-793. [Abstract]
Nathan C. Nitric oxide as a secretory product of mammalian cells. FASEB J 1992;6:3051-3064. [Abstract]
Walker L, Lowrie DB. Killing of Mycobacterium microti by immunologically activated macrophages. Nature 1981;293:69-71. [CrossRef][Medline]
Flesch IEA, Kaufmann SHE. Activation of tuberculostatic macrophage functions by gamma interferon, interleukin-4, and tumor necrosis factor. Infect Immun 1990;58:2675-2677. [Free Full Text]
Denis M. Killing of Mycobacterium tuberculosis within human monocytes: activation by cytokines and calcitriol. Clin Exp Immunol 1991;84:200-206. [Medline]
Nathan CF, Murray HW, Wiebe ME, Rubin BY. Identification of interferon- as the lymphokine that activates human macrophage oxidative metabolism and antimicrobial activity. J Exp Med 1983;158:670-689. [Free Full Text]
Rook GAW, Steele J, Fraher L, et al. Vitamin D3, gamma interferon, and control of proliferation of Mycobacterium tuberculosis by human monocytes. Immunology 1986;57:159-163. [Medline]
Holland SM, Eisenstein EM, Kuhns DB, et al. Treatment of refractory disseminated nontuberculous mycobacterial infection with interferon gamma: a preliminary report. N Engl J Med 1994;330:1348-1355. [Free Full Text]
Lewis DB, Wilson CB. Gamma-interferon: an immunoregulatory lymphokine with immunotherapeutic potential. Pediatr Infect Dis 1990;9:642-651.
Watford, W. T., Hissong, B. D., Durant, L. R., Yamane, H., Muul, L. M., Kanno, Y., Tato, C. M., Ramos, H. L., Berger, A. E., Mielke, L., Pesu, M., Solomon, B., Frucht, D. M., Paul, W. E., Sher, A., Jankovic, D., Tsichlis, P. N., O'Shea, J. J.
(2008). Tpl2 kinase regulates T cell interferon-{gamma} production and host resistance to Toxoplasma gondii. JEM
205: 2803-2812
[Abstract][Full Text]
Zhu, J., Paul, W. E.
(2008). CD4 T cells: fates, functions, and faults. Blood
112: 1557-1569
[Abstract][Full Text]
Pulickal, A. S., Hambleton, S., Callaghan, M. J., Moore, C. E., Goulding, J., Goodsall, A., Baretto, R., Lammas, D. A., Anderson, S. T., Levin, M., Pollard, A. J.
(2008). Biliary Cirrhosis in a Child with Inherited Interleukin-12 Deficiency. J Trop Pediatr
54: 269-271
[Abstract][Full Text]
Miles, D. J. C., van der Sande, M., Crozier, S., Ojuola, O., Palmero, M. S., Sanneh, M., Touray, E. S., Rowland-Jones, S., Whittle, H., Ota, M., Marchant, A.
(2008). Effects of Antenatal and Postnatal Environments on CD4 T-Cell Responses to Mycobacterium bovis BCG in Healthy Infants in The Gambia. CVI
15: 995-1002
[Abstract][Full Text]
Glassroth, J.
(2008). Pulmonary Disease Due to Nontuberculous Mycobacteria. Chest
133: 243-251
[Abstract][Full Text]
Hussain, R., Talat, N., Shahid, F., Dawood, G.
(2007). Longitudinal Tracking of Cytokines after Acute Exposure to Tuberculosis: Association of Distinct Cytokine Patterns with Protection and Disease Development. CVI
14: 1578-1586
[Abstract][Full Text]
Giannoudis, P. V., van Griensven, M., Tsiridis, E., Pape, H. C.
(2007). The genetic predisposition to adverse outcome after trauma. J Bone Joint Surg Br
89-B: 1273-1279
[Abstract][Full Text]
Okada, S., Ishikawa, N., Shirao, K., Kawaguchi, H., Tsumura, M., Ohno, Y., Yasunaga, S., Ohtsubo, M., Takihara, Y., Kobayashi, M.
(2007). The novel IFNGR1 mutation 774del4 produces a truncated form of interferon-{gamma} receptor 1 and has a dominant-negative effect on interferon-{gamma} signal transduction. J. Med. Genet.
44: 485-491
[Abstract][Full Text]
Martineau, A. R., Wilkinson, K. A., Newton, S. M., Floto, R. A., Norman, A. W., Skolimowska, K., Davidson, R. N., Sorensen, O. E., Kampmann, B., Griffiths, C. J., Wilkinson, R. J.
(2007). IFN-{gamma}- and TNF-Independent Vitamin D-Inducible Human Suppression of Mycobacteria: The Role of Cathelicidin LL-37. J. Immunol.
178: 7190-7198
[Abstract][Full Text]
Plitas, G., Chaudhry, U. I., Kingham, T. P., Raab, J. R., DeMatteo, R. P.
(2007). NK Dendritic Cells Are Innate Immune Responders to Listeria monocytogenes Infection. J. Immunol.
178: 4411-4416
[Abstract][Full Text]
Milburn, H.
(2007). Key issues in the diagnosis and management of tuberculosis. JRSM
100: 134-141
[Full Text]
Loeuillet, C., Martinon, F., Perez, C., Munoz, M., Thome, M., Meylan, P. R.
(2006). Mycobacterium tuberculosis Subverts Innate Immunity to Evade Specific Effectors. J. Immunol.
177: 6245-6255
[Abstract][Full Text]
Ziedalski, T. M., Kao, P. N., Henig, N. R., Jacobs, S. S., Ruoss, S. J.
(2006). Prospective analysis of cystic fibrosis transmembrane regulator mutations in adults with bronchiectasis or pulmonary nontuberculous mycobacterial infection.. Chest
130: 995-1002
[Abstract][Full Text]
Waller, E. A., Roy, A., Brumble, L., Khoor, A., Johnson, M. M., Garland, J. L.
(2006). The Expanding Spectrum of Mycobacterium avium Complex-Associated Pulmonary Disease.. Chest
130: 1234-1241
[Abstract][Full Text]
Filipe-Santos, O., Bustamante, J., Haverkamp, M. H., Vinolo, E., Ku, C.-L., Puel, A., Frucht, D. M., Christel, K., von Bernuth, H., Jouanguy, E., Feinberg, J., Durandy, A., Senechal, B., Chapgier, A., Vogt, G., de Beaucoudrey, L., Fieschi, C., Picard, C., Garfa, M., Chemli, J., Bejaoui, M., Tsolia, M. N., Kutukculer, N., Plebani, A., Notarangelo, L., Bodemer, C., Geissmann, F., Israel, A., Veron, M., Knackstedt, M., Barbouche, R., Abel, L., Magdorf, K., Gendrel, D., Agou, F., Holland, S. M., Casanova, J.-L.
(2006). X-linked susceptibility to mycobacteria is caused by mutations in NEMO impairing CD40-dependent IL-12 production. JEM
203: 1745-1759
[Abstract][Full Text]
Connell, T G, Curtis, N, Ranganathan, S C, Buttery, J P
(2006). Performance of a whole blood interferon gamma assay for detecting latent infection with Mycobacterium tuberculosis in children. Thorax
61: 616-620
[Abstract][Full Text]
Field, S. K., Cowie, R. L.
(2006). Lung Disease Due to the More Common Nontuberculous Mycobacteria. Chest
129: 1653-1672
[Abstract][Full Text]
LIPNER, E. M., GOPI, P. G., SUBRAMANI, R., KOLAPPAN, C., SADACHARAM, K., KUMARAN, P., PREVOTS, D. R., NARAYANAN, P. R., NUTMAN, T. B., KUMARASWAMI, V.
(2006). Coincident filarial, intestinal helminth, and mycobacterial infection: helminths fail to influence tuberculin reactivity, but bcg influences hookworm prevalence.. Am J Trop Med Hyg
74: 841-847
[Abstract][Full Text]
Koch, O., Kwiatkowski, D. P., Udalova, I. A.
(2006). Context-specific functional effects of IFNGR1 promoter polymorphism. Hum Mol Genet
15: 1475-1481
[Abstract][Full Text]
Ota, M. O. C., Goetghebuer, T., Vekemans, J., Okoko, B. J., Newport, M. J., McAdam, K. P. W. J., Marchant, A.
(2006). Dissociation Between Tuberculin Skin Test and In Vitro IFN-{gamma} Responses Following Neonatal BCG Vaccination. J Trop Pediatr
52: 136-140
[Abstract][Full Text]
Pennini, M. E., Pai, R. K., Schultz, D. C., Boom, W. H., Harding, C. V.
(2006). Mycobacterium tuberculosis 19-kDa Lipoprotein Inhibits IFN-{gamma}-Induced Chromatin Remodeling of MHC2TA by TLR2 and MAPK Signaling. J. Immunol.
176: 4323-4330
[Abstract][Full Text]
Guyot-Revol, V., Innes, J. A., Hackforth, S., Hinks, T., Lalvani, A.
(2006). Regulatory T Cells Are Expanded in Blood and Disease Sites in Patients with Tuberculosis. Am. J. Respir. Crit. Care Med.
173: 803-810
[Abstract][Full Text]
Yu, S., Sharp, G. C., Braley-Mullen, H.
(2006). Thyrocytes Responding to IFN-{gamma} Are Essential for Development of Lymphocytic Spontaneous Autoimmune Thyroiditis and Inhibition of Thyrocyte Hyperplasia. J. Immunol.
176: 1259-1265
[Abstract][Full Text]
Flores-Villanueva, P. O., Ruiz-Morales, J. A., Song, C.-H., Flores, L. M., Jo, E.-K., Montano, M., Barnes, P. F., Selman, M., Granados, J.
(2005). A functional promoter polymorphism in monocyte chemoattractant protein-1 is associated with increased susceptibility to pulmonary tuberculosis. JEM
202: 1649-1658
[Abstract][Full Text]
Elkington, P. T. G., Nuttall, R. K., Boyle, J. J., O'Kane, C. M., Horncastle, D. E., Edwards, D. R., Friedland, J. S.
(2005). Mycobacterium tuberculosis, but Not Vaccine BCG, Specifically Upregulates Matrix Metalloproteinase-1. Am. J. Respir. Crit. Care Med.
172: 1596-1604
[Abstract][Full Text]
Sghiri, R., Feinberg, J., Thabet, F., Dellagi, K., Boukadida, J., Ben Abdelaziz, A., Casanova, J. L., Barbouche, M. R.
(2005). Gamma Interferon Is Dispensable for Neopterin Production In Vivo. CVI
12: 1437-1441
[Abstract][Full Text]
Mukherjee, S., Kashino, S. S., Zhang, Y., Daifalla, N., Rodrigues, V. Jr, Reed, S. G., Campos-Neto, A.
(2005). Cloning of the Gene Encoding a Protective Mycobacterium tuberculosis Secreted Protein Detected In Vivo during the Initial Phases of the Infectious Process. J. Immunol.
175: 5298-5305
[Abstract][Full Text]
Elkington, P. T. G., Emerson, J. E., Lopez-Pascua, L. D. C., O'Kane, C. M., Horncastle, D. E., Boyle, J. J., Friedland, J. S.
(2005). Mycobacterium tuberculosis Up-Regulates Matrix Metalloproteinase-1 Secretion from Human Airway Epithelial Cells via a p38 MAPK Switch. J. Immunol.
175: 5333-5340
[Abstract][Full Text]
Tzioupis, C. C, Katsoulis, S., Manidakis, N., Giannoudis, P. V
(2005). The immuno-inflammatory response to trauma. Trauma
7: 171-183
[Abstract]
Dheda, K., Chang, J.-S., Breen, R. A. M., Kim, L. U., Haddock, J. A., Huggett, J. F., Johnson, M. A., Rook, G. A. W., Zumla, A.
(2005). In Vivo and In Vitro Studies of a Novel Cytokine, Interleukin 4{delta}2, in Pulmonary Tuberculosis. Am. J. Respir. Crit. Care Med.
172: 501-508
[Abstract][Full Text]
Shin, S. J., Chang, C.-F., Chang, C.-D., McDonough, S. P., Thompson, B., Yoo, H. S., Chang, Y.-F.
(2005). In Vitro Cellular Immune Responses to Recombinant Antigens of Mycobacterium avium subsp. paratuberculosis. Infect. Immun.
73: 5074-5085
[Abstract][Full Text]
Casanova, J.-L., Abel, L.
(2005). Inborn errors of immunity to infection: the rule rather than the exception. JEM
202: 197-201
[Abstract][Full Text]
Koh, W.-J., Kwon, O. J., Kim, E. J., Lee, K. S., Ki, C.-S., Kim, J. W.
(2005). NRAMP1 Gene Polymorphism and Susceptibility to Nontuberculous Mycobacterial Lung Diseases. Chest
128: 94-101
[Abstract][Full Text]
Samten, B., Howard, S. T., Weis, S. E., Wu, S., Shams, H., Townsend, J. C., Safi, H., Barnes, P. F.
(2005). Cyclic AMP Response Element-Binding Protein Positively Regulates Production of IFN-{gamma} by T Cells in Response to a Microbial Pathogen. J. Immunol.
174: 6357-6363
[Abstract][Full Text]
Bonanni, D., Rindi, L., Lari, N., Garzelli, C.
(2005). Immunogenicity of mycobacterial PPE44 (Rv2770c) in Mycobacterium bovis BCG-infected mice. J Med Microbiol
54: 443-448
[Abstract][Full Text]
Roberts, C. S., Pape, H.-C., Jones, A. L., Malkani, A. L., Rodriguez, J. L., Giannoudis, P. V.
(2005). Damage Control Orthopaedics. Evolving Concepts in the Treatment of Patients Who Have Sustained Orthopaedic Trauma. JBJS
87: 434-449
[Full Text]
Frodsham, A. J., Hill, A. V.S.
(2004). Genetics of infectious diseases. Hum Mol Genet
13: R187-R194
[Abstract][Full Text]
Fieschi, C., Bosticardo, M., de Beaucoudrey, L., Boisson-Dupuis, S., Feinberg, J., Santos, O. F., Bustamante, J., Levy, J., Candotti, F., Casanova, J.-L.
(2004). A novel form of complete IL-12/IL-23 receptor {beta}1 deficiency with cell surface-expressed nonfunctional receptors. Blood
104: 2095-2101
[Abstract][Full Text]
Rosenzweig, S. D., Dorman, S. E., Uzel, G., Shaw, S., Scurlock, A., Brown, M. R., Buckley, R. H., Holland, S. M.
(2004). A Novel Mutation in IFN-{gamma} Receptor 2 with Dominant Negative Activity: Biological Consequences of Homozygous and Heterozygous States. J. Immunol.
173: 4000-4008
[Abstract][Full Text]
Field, S. K., Fisher, D., Cowie, R. L.
(2004). Mycobacterium avium complex Pulmonary Disease in Patients Without HIV Infection. Chest
126: 566-581
[Abstract][Full Text]
Marino, S., Pawar, S., Fuller, C. L., Reinhart, T. A., Flynn, J. L., Kirschner, D. E.
(2004). Dendritic Cell Trafficking and Antigen Presentation in the Human Immune Response to Mycobacterium tuberculosis. J. Immunol.
173: 494-506
[Abstract][Full Text]
Skeiky, Y. A. W., Alderson, M. R., Ovendale, P. J., Guderian, J. A., Brandt, L., Dillon, D. C., Campos-Neto, A., Lobet, Y., Dalemans, W., Orme, I. M., Reed, S. G.
(2004). Differential Immune Responses and Protective Efficacy Induced by Components of a Tuberculosis Polyprotein Vaccine, Mtb72F, Delivered as Naked DNA or Recombinant Protein. J. Immunol.
172: 7618-7628
[Abstract][Full Text]
Casanova, J.-L., Abel, L.
(2004). Human Mannose-binding Lectin in Immunity: Friend, Foe, or Both?. JEM
199: 1295-1299
[Abstract][Full Text]
Bonecini-Almeida, M. G., Ho, J. L., Boechat, N., Huard, R. C., Chitale, S., Doo, H., Geng, J., Rego, L., Lazzarini, L. C. O., Kritski, A. L., Johnson, W. D. Jr., McCaffrey, T. A., Silva, J. R. L. e
(2004). Down-Modulation of Lung Immune Responses by Interleukin-10 and Transforming Growth Factor {beta} (TGF-{beta}) and Analysis of TGF-{beta} Receptors I and II in Active Tuberculosis. Infect. Immun.
72: 2628-2634
[Abstract][Full Text]
Awomoyi, A A, Nejentsev, S, Richardson, A, Hull, J, Koch, O, Podinovskaia, M, Todd, J A, McAdam, K P W J, Blackwell, J M, Kwiatkowski, D, Newport, M J
(2004). No association between interferon-{gamma} receptor-1 gene polymorphism and pulmonary tuberculosis in a Gambian population sample. Thorax
59: 291-294
[Abstract][Full Text]
Toyoda, H., Ido, M., Hayashi, T., Gabazza, E. C., Suzuki, K., Bu, J., Tanaka, S., Nakano, T., Kamiya, H., Chipeta, J., Kisenge, R. R., Kang, J., Hori, H., Komada, Y.
(2004). Impairment of IL-12-Dependent STAT4 Nuclear Translocation in a Patient with Recurrent Mycobacterium avium Infection. J. Immunol.
172: 3905-3912
[Abstract][Full Text]
Gold, J. A., Hoshino, Y., Hoshino, S., Jones, M. B., Nolan, A., Weiden, M. D.
(2004). Exogenous Gamma and Alpha/Beta Interferon Rescues Human Macrophages from Cell Death Induced by Bacillus anthracis. Infect. Immun.
72: 1291-1297
[Abstract][Full Text]
Ogus, A.C., Yoldas, B., Ozdemir, T., Uguz, A., Olcen, S., Keser, I., Coskun, M., Cilli, A., Yegin, O.
(2004). The Arg753Gln polymorphism of the human Toll-like receptor 2 gene in tuberculosis disease. Eur Respir J
23: 219-223
[Abstract][Full Text]
Schroder, K., Hertzog, P. J., Ravasi, T., Hume, D. A.
(2004). Interferon-{gamma}: an overview of signals, mechanisms and functions. J. Leukoc. Biol.
75: 163-189
[Abstract][Full Text]
Fuller, C. L., Flynn, J. L., Reinhart, T. A.
(2003). In Situ Study of Abundant Expression of Proinflammatory Chemokines and Cytokines in Pulmonary Granulomas That Develop in Cynomolgus Macaques Experimentally Infected with Mycobacterium tuberculosis. Infect. Immun.
71: 7023-7034
[Abstract][Full Text]
Lewinsohn, D. A., Heinzel, A. S., Gardner, J. M., Zhu, L., Alderson, M. R., Lewinsohn, D. M.
(2003). Mycobacterium tuberculosis-specific CD8+ T Cells Preferentially Recognize Heavily Infected Cells. Am. J. Respir. Crit. Care Med.
168: 1346-1352
[Abstract][Full Text]
Andrews, T., Sullivan, K. E.
(2003). Infections in Patients with Inherited Defects in Phagocytic Function. Clin. Microbiol. Rev.
16: 597-621
[Abstract][Full Text]
Shaw, M. H., Boyartchuk, V., Wong, S., Karaghiosoff, M., Ragimbeau, J., Pellegrini, S., Muller, M., Dietrich, W. F., Yap, G. S.
(2003). A natural mutation in the Tyk2 pseudokinase domain underlies altered susceptibility of B10.Q/J mice to infection and autoimmunity. Proc. Natl. Acad. Sci. USA
100: 11594-11599
[Abstract][Full Text]
Silver, R. F., Zukowski, L., Kotake, S., Li, Q., Pozuelo, F., Krywiak, A., Larkin, R.
(2003). Recruitment of Antigen-Specific Th1-Like Responses to the Human Lung following Bronchoscopic Segmental Challenge with Purified Protein Derivative of Mycobacterium tuberculosis. Am. J. Respir. Cell Mol. Bio.
29: 117-123
[Abstract][Full Text]
Koguchi, Y., Kawakami, K., Uezu, K., Fukushima, K., Kon, S., Maeda, M., Nakamoto, A., Owan, I., Kuba, M., Kudeken, N., Azuma, M., Yara, S., Shinzato, T., Higa, F., Tateyama, M., Kadota, J.-I., Mukae, H., Kohno, S., Uede, T., Saito, A.
(2003). High Plasma Osteopontin Level and Its Relationship with Interleukin-12-mediated Type 1 T Helper Cell Response in Tuberculosis. Am. J. Respir. Crit. Care Med.
167: 1355-1359
[Abstract][Full Text]
Bao, L., Chen, W., Zhang, H., Wang, X.
(2003). Virulence, Immunogenicity, and Protective Efficacy of Two Recombinant Mycobacterium bovis Bacillus Calmette-Guerin Strains Expressing the Antigen ESAT-6 from Mycobacterium tuberculosis. Infect. Immun.
71: 1656-1661
[Abstract][Full Text]
Worku, S., Hoft, D. F.
(2003). Differential Effects of Control and Antigen-Specific T Cells on Intracellular Mycobacterial Growth. Infect. Immun.
71: 1763-1773
[Abstract][Full Text]
Condos, R., Raju, B., Canova, A., Zhao, B.-Y., Weiden, M., Rom, W. N., Pine, R.
(2003). Recombinant Gamma Interferon Stimulates Signal Transduction and Gene Expression in Alveolar Macrophages In Vitro and in Tuberculosis Patients. Infect. Immun.
71: 2058-2064
[Abstract][Full Text]
Bellamy, R.
(2003). Interferon-{gamma} and Host Susceptibility to Tuberculosis. Am. J. Respir. Crit. Care Med.
167: 946-947
[Full Text]
Rendon-Mitchell, B., Ochani, M., Li, J., Han, J., Wang, H., Yang, H., Susarla, S., Czura, C., Mitchell, R. A., Chen, G., Sama, A. E., Tracey, K. J., Wang, H.
(2003). IFN-{gamma} Induces High Mobility Group Box 1 Protein Release Partly Through a TNF-Dependent Mechanism. J. Immunol.
170: 3890-3897
[Abstract][Full Text]
Lopez-Maderuelo, D., Arnalich, F., Serantes, R., Gonzalez, A., Codoceo, R., Madero, R., Vazquez, J. J., Montiel, C.
(2003). Interferon-{gamma} and Interleukin-10 Gene Polymorphisms in Pulmonary Tuberculosis. Am. J. Respir. Crit. Care Med.
167: 970-975
[Abstract][Full Text]
Safdar, A., Armstrong, D., Murray, H. W.
(2003). A Novel Defect in Interferon-{gamma} Secretion in Patients with Refractory Nontuberculous Pulmonary Mycobacteriosis. ANN INTERN MED
138: 521-521
[Full Text]
Fieschi, C., Dupuis, S., Catherinot, E., Feinberg, J., Bustamante, J., Breiman, A., Altare, F., Baretto, R., Le Deist, F., Kayal, S., Koch, H., Richter, D., Brezina, M., Aksu, G., Wood, P., Al-Jumaah, S., Raspall, M., da Silva Duarte, A. J., Tuerlinckx, D., Virelizier, J.-L., Fischer, A., Enright, A., Bernhoft, J., Cleary, A. M., Vermylen, C., Rodriguez-Gallego, C., Davies, G., Blutters-Sawatzki, R., Siegrist, C.-A., Ehlayel, M. S., Novelli, V., Haas, W. H., Levy, J., Freihorst, J., Al-Hajjar, S., Nadal, D., de Moraes Vasconcelos, D., Jeppsson, O., Kutukculer, N., Frecerova, K., Caragol, I., Lammas, D., Kumararatne, D. S., Abel, L., Casanova, J.-L.
(2003). Low Penetrance, Broad Resistance, and Favorable Outcome of Interleukin 12 Receptor {beta}1 Deficiency: Medical and Immunological Implications. JEM
197: 527-535
[Abstract][Full Text]
Majorov, K. B., Lyadova, I. V., Kondratieva, T. K., Eruslanov, E. B., Rubakova, E. I., Orlova, M. O., Mischenko, V. V., Apt, A. S.
(2003). Different Innate Ability of I/St and A/Sn Mice To Combat Virulent Mycobacterium tuberculosis: Phenotypes Expressed in Lung and Extrapulmonary Macrophages. Infect. Immun.
71: 697-707
[Abstract][Full Text]
Cardoso, F. L. L., Antas, P. R. Z., Milagres, A. S., Geluk, A., Franken, K. L. M. C., Oliveira, E. B., Teixeira, H. C., Nogueira, S. A., Sarno, E. N., Klatser, P., Ottenhoff, T. H. M., Sampaio, E. P.
(2002). T-Cell Responses to the Mycobacterium tuberculosis-Specific Antigen ESAT-6 in Brazilian Tuberculosis Patients. Infect. Immun.
70: 6707-6714
[Abstract][Full Text]
Rocha, V., Franco, R. F., Porcher, R., Bittencourt, H., Silva, W. A. Jr, Latouche, A., Devergie, A., Esperou, H., Ribaud, P., Socie, G., Zago, M. A., Gluckman, E.
(2002). Host defense and inflammatory gene polymorphisms are associated with outcomes after HLA-identical sibling bone marrow transplantation. Blood
100: 3908-3918
[Abstract][Full Text]
Reuter, U., Roesler, J., Thiede, C., Schulz, A., Classen, C. F., Oelschlagel, U., Debatin, K.-M., Friedrich, W.
(2002). Correction of complete interferon-gamma receptor 1 deficiency by bone marrow transplantation. Blood
100: 4234-4235
[Abstract][Full Text]
Janssen, R., van Wengen, A., Verhard, E., de Boer, T., Zomerdijk, T., Ottenhoff, T. H. M., van Dissel, J. T.
(2002). Divergent Role for TNF-{alpha} in IFN-{gamma}-Induced Killing of Toxoplasma gondii and Salmonella typhimurium Contributes to Selective Susceptibility of Patients with Partial IFN-{gamma} Receptor 1 Deficiency. J. Immunol.
169: 3900-3907
[Abstract][Full Text]
Hashimoto, K., Maeda, Y., Kimura, H., Suzuki, K., Masuda, A., Matsuoka, M., Makino, M.
(2002). Mycobacterium leprae Infection in Monocyte-Derived Dendritic Cells and Its Influence on Antigen-Presenting Function. Infect. Immun.
70: 5167-5176
[Abstract][Full Text]
Qin, Z., Kim, H.-J., Hemme, J., Blankenstein, T.
(2002). Inhibition of Methylcholanthrene-induced Carcinogenesis by an Interferon {gamma} Receptor-dependent Foreign Body Reaction. JEM
195: 1479-1490
[Abstract][Full Text]
Barker, A. F.
(2002). Bronchiectasis. NEJM
346: 1383-1393
[Full Text]
Hickman, S. P., Chan, J., Salgame, P.
(2002). Mycobacterium tuberculosis Induces Differential Cytokine Production from Dendritic Cells and Macrophages with Divergent Effects on Naive T Cell Polarization. J. Immunol.
168: 4636-4642
[Abstract][Full Text]
van Crevel, R., Ottenhoff, T. H. M., van der Meer, J. W. M.
(2002). Innate Immunity to Mycobacterium tuberculosis. Clin. Microbiol. Rev.
15: 294-309
[Abstract][Full Text]
Samten, B., Ghosh, P., Yi, A.-K., Weis, S. E., Lakey, D. L., Gonsky, R., Pendurthi, U., Wizel, B., Zhang, Y., Zhang, M., Gong, J., Fernandez, M., Safi, H., Vankayalapati, R., Young, H. A., Barnes, P. F.
(2002). Reduced Expression of Nuclear Cyclic Adenosine 5'-Monophospate Response Element-Binding Proteins and IFN-{gamma} Promoter Function in Disease Due to an Intracellular Pathogen. J. Immunol.
168: 3520-3526
[Abstract][Full Text]
Abu-Nader, R., Terrell, C. L.
(2002). Mycobacterium bovis Vertebral Osteomyelitis as a Complication of Intravesical BCG Use. Mayo Clin. Proc.
77: 393-397
[Abstract]
Portales-Perez, D. P., Baranda, L., Layseca, E., Fierro, N. A., de la Fuente, H., Rosenstein, Y., Gonzalez-Amaro, R.
(2002). Comparative and Prospective Study of Different Immune Parameters in Healthy Subjects at Risk for Tuberculosis and in Tuberculosis Patients. CVI
9: 299-307
[Abstract][Full Text]
Kennedy, H. E., Welsh, M. D., Bryson, D. G., Cassidy, J. P., Forster, F. I., Howard, C. J., Collins, R. A., Pollock, J. M.
(2002). Modulation of Immune Responses to Mycobacterium bovis in Cattle Depleted of WC1+{gamma}{delta} T Cells. Infect. Immun.
70: 1488-1500
[Abstract][Full Text]
Cooper, A. M., Kipnis, A., Turner, J., Magram, J., Ferrante, J., Orme, I. M.
(2002). Mice Lacking Bioactive IL-12 Can Generate Protective, Antigen-Specific Cellular Responses to Mycobacterial Infection Only if the IL-12 p40 Subunit Is Present. J. Immunol.
168: 1322-1327
[Abstract][Full Text]
Szabo, S. J., Sullivan, B. M., Stemmann, C., Satoskar, A. R., Sleckman, B. P., Glimcher, L. H.
(2002). Distinct Effects of T-bet in TH1 Lineage Commitment and IFN-gamma Production in CD4 and CD8 T Cells. Science
295: 338-342
[Abstract][Full Text]
Panigada, M., Sturniolo, T., Besozzi, G., Boccieri, M. G., Sinigaglia, F., Grassi, G. G., Grassi, F.
(2002). Identification of a Promiscuous T-Cell Epitope in Mycobacterium tuberculosis Mce Proteins. Infect. Immun.
70: 79-85
[Abstract][Full Text]
Fritz, C., Maass, S., Kreft, A., Bange, F.-C.
(2002). Dependence of Mycobacterium bovis BCG on Anaerobic Nitrate Reductase for Persistence Is Tissue Specific. Infect. Immun.
70: 286-291
[Abstract][Full Text]
Keane, J., Gershon, S., Wise, R. P., Mirabile-Levens, E., Kasznica, J., Schwieterman, W. D., Siegel, J. N., Braun, M. M.
(2001). Tuberculosis Associated with Infliximab, a Tumor Necrosis Factor {alpha}-Neutralizing Agent. NEJM
345: 1098-1104
[Abstract][Full Text]
Canaday, D. H., Wilkinson, R. J., Li, Q., Harding, C. V., Silver, R. F., Boom, W. H.
(2001). CD4+ and CD8+ T Cells Kill Intracellular Mycobacterium tuberculosis by a Perforin and Fas/Fas Ligand-Independent Mechanism. J. Immunol.
167: 2734-2742
[Abstract][Full Text]
Fjallbrant, H., Ridell, M., Larsson, L.O.
(2001). The tuberculin skin test in relation to immunological in vitro reactions in BCG-vaccinated healthcare workers. Eur Respir J
18: 376-380
[Abstract][Full Text]
Tomlinson, I P M, Ilyas, M
(2001). Molecular pathology of solid tumours: some practical suggestions for translating research into clinical practice. Mol. Pathol.
54: 203-205
[Abstract][Full Text]
Dupuis, S., Dargemont, C., Fieschi, C., Thomassin, N., Rosenzweig, S., Harris, J., Holland, S. M., Schreiber, R. D., Casanova, J.-L.
(2001). Impairment of Mycobacterial But Not Viral Immunity by a Germline Human STAT1 Mutation. Science
293: 300-303
[Abstract][Full Text]
Serbina, N. V., Flynn, J. L.
(2001). CD8+ T Cells Participate in the Memory Immune Response to Mycobacterium tuberculosis. Infect. Immun.
69: 4320-4328
[Abstract][Full Text]
Giacomini, E., Iona, E., Ferroni, L., Miettinen, M., Fattorini, L., Orefici, G., Julkunen, I., Coccia, E. M.
(2001). Infection of Human Macrophages and Dendritic Cells with Mycobacterium tuberculosis Induces a Differential Cytokine Gene Expression That Modulates T Cell Response. J. Immunol.
166: 7033-7041
[Abstract][Full Text]
Jepson, A., Fowler, A., Banya, W., Singh, M., Bennett, S., Whittle, H., Hill, A. V. S.
(2001). Genetic Regulation of Acquired Immune Responses to Antigens of Mycobacterium tuberculosis: a Study of Twins in West Africa. Infect. Immun.
69: 3989-3994
[Abstract][Full Text]
Boechat, N., Bouchonnet, F., Bonay, M., Grodet, A., Pelicic, V., Gicquel, B., Hance, A. J.
(2001). Culture at High Density Improves the Ability of Human Macrophages to Control Mycobacterial Growth. J. Immunol.
166: 6203-6211
[Abstract][Full Text]
Sakai, T., Matsuoka, M., Aoki, M., Nosaka, K., Mitsuya, H.
(2001). Missense mutation of the interleukin-12 receptor {beta}1 chain-encoding gene is associated with impaired immunity against Mycobacterium avium complex infection. Blood
97: 2688-2694
[Abstract][Full Text]
Marquet, S., Schurr, E.
(2001). Genetics of Susceptibility to Infectious Diseases: Tuberculosis and Leprosy as Examples. Drug Metab. Dispos.
29: 479-483
[Full Text]
Chackerian, A. A., Perera, T. V., Behar, S. M.
(2001). Gamma Interferon-Producing CD4+ T Lymphocytes in the Lung Correlate with Resistance to Infection with Mycobacterium tuberculosis. Infect. Immun.
69: 2666-2674
[Abstract][Full Text]
Villella, A., Picard, C., Jouanguy, E., Dupuis, S., Popko, S., Abughali, N., Meyerson, H., Casanova, J.-L., Hostoffer, R. W.
(2001). Recurrent Mycobacterium avium Osteomyelitis Associated With a Novel Dominant Interferon Gamma Receptor Mutation. Pediatrics
107: e47-e47
[Abstract][Full Text]
Fieschi, C., Dupuis, S., Picard, C., Smith, C. I. E., Holland, S. M., Casanova, J.-L.
(2001). High Levels of Interferon Gamma in the Plasma of Children With Complete Interferon Gamma Receptor Deficiency. Pediatrics
107: e48-e48
[Abstract][Full Text]
–Receptor Gene and Susceptibility to Mycobacterial Infection
by macrophages in response to interferon-
Previous
