The attenuated strain of Mycobacterium bovis bacille CalmetteGuérin(BCG) is the most widely used vaccine in the world. In mostchildren, inoculation of live BCG vaccine is harmless althoughit occasionally leads to a benign regional adenitis.1 In rarecases, however, vaccination causes disseminated BCG infection,which may be lethal. Impaired immunity of the host is generallythought to be the pathogenic mechanism. Disseminated BCG infectionhas been reported in children with inherited immune disorders.Most of these children had severe combined immunodeficiency,which is characterized by an absence of T cells, and some hadchronic granulomatous disease, which is marked by an impairmentof the phagocyte respiratory burst.2,3 Rare cases of BCG infectionhave also been reported in association with the acquired immunodeficiencysyndrome.2
However, a specific immunodeficiency can be identified in onlyabout half the cases of disseminated BCG infection.2 In theother cases, the pathogenesis remains unclear. Such idiopathiccases have been reported in 24 countries, with a prevalencein France of at least 0.59 case per 1 million children vaccinatedwith BCG.4 The high rates of consanguinity (30 percent) andfamilial forms (17 percent) and the equal sex distribution supportthe hypothesis of a new type of primary immune disorder withan autosomal recessive pattern of inheritance.
The pathological features and clinical outcomes suggest thatthere are two distinct forms of idiopathic BCG infection anda genetic heterogeneity of the underlying immune disorder.5Well-circumscribed and well-differentiated tuberculoid granulomaswith few visible acid-fast rods are associated with a good prognosis.In contrast, ill-defined and poorly differentiated, leproma-likegranulomas with many visible bacilli are associated with a fataloutcome, despite antimycobacterial therapy. We reasoned thatthe latter form of idiopathic BCG infection most likely resultsfrom a genetic defect affecting an obligatory and relativelyspecific step in the formation of a bactericidal BCG granuloma.
Mice in which the gene for the interferon- receptor high-affinitybinding chain (interferon-R1) has been deleted are highly susceptibleto BCG infection, with defects in granuloma structure and afatal outcome.6 In mice with deletions of the interferon- geneor the gene for interferon- regulatory factor 1 (IRF1), thereis a failure to control BCG growth.7,8 Mice treated with antibodiesagainst tumor necrosis factor (TNF-) are susceptible to BCGinfection, with defective granuloma structure and a fatal outcome.9Such a dramatic effect is not observed, however, in mice withdeletions of the gene for TNF- receptor 1 (TNF-R1).10
We examined the five genes coding for interferon-, interferon-R1,IRF1, TNF-, and TNF-R1 in a child with fatal idiopathic disseminatedBCG infection. We found a mutation of the gene for interferon-R1.There was no detectable interferon-R1 on the cells from theaffected child. These findings provide further evidence of theimportance of interferon- in the response to mycobacterial infection.
Case Report
A girl was born at term to parents of Tunisian origin who werefirst cousins (Patient 16 in Casanova et al.4). Her size andweight were normal, and she had no overt developmental defects.She was vaccinated with 25 mg of BCG substrain Pasteur at onemonth of age. Two older brothers, previously vaccinated withBCG, were healthy. She was healthy until 2.5 months of age,when fever and regional adenitis developed. Cachexia, granulomatousdermatitis, hepatosplenomegaly, lymph-node enlargement, diffusepneumonitis, and multiple osteolytic lesions developed rapidly,with continued fever. The values for blood leukocytes, erythrocytesedimentation rate, serum C-reactive protein, and serum fibrinogenwere elevated. Lymph-node and skin biopsies revealed ill-circumscribedareas of macrophages filled with acid-fast bacilli (Figure 1).There were no epithelioid or giant cells or surrounding lymphocyteswithin these leproma-like granulomas. Treatment with antimycobacterialagents (including rifampin, isoniazid, ethambutol, streptomycin,and clofazimine) was initiated. One month later, a mycobacteriumspecies was cultured from the lungs and bone marrow and identifiedas M. bovis BCG strain.
Figure 1. Leproma-like Granuloma in a Lymph-NodeBiopsy Specimen from an Infant with Bacille CalmetteGuérin Infection.
The granuloma has ill-circumscribed areas of poorly differentiated macrophages filled with acid-fast bacilli (Ziehl stain, x400).
Despite antimycobacterial treatment and adjuvant treatment withinterferon gamma, the child died at the age of 10 months fromBCG infection with multiorgan failure, including bone marrowand liver failure. No other opportunistic infectious agentswere identified. Neither autoimmune nor allergic processes werenoted. A diagnosis of idiopathic disseminated BCG infectionwas made on the basis of the absence of clinical, radiologic,or biologic signs of any known immunodeficiency.3 In particular,the spleen and lymph nodes were grossly normal. Immunologicstudies showed a normal leukocyte count, including normal proportionsof polymorphonuclear cells, B cells, CD4 and CD8 T cells, /and / T cells, and natural killer cells. IgM, IgG, IgA, andIgE levels were within the normal ranges or elevated. Complementlevels were within the normal ranges. Lymphocyte-functionassociatedantigen 1 and HLA class I and II molecules were present on thecell surface. The reduction of nitroblue tetrazolium by neutrophilicpolymorphonuclear leukocytes was normal. Mitogen-driven andtuberculin-driven T-cell proliferations were normal. A testof delayed hypersensitivity to purified protein derivative (10IU) was positive (a 16-mm induration). Antimycobacterial serologicstudies were also positive. Specific serologic tests for tetanustoxoid and poliovirus were positive after immunization. Repeatedserologic tests for infection with the human immunodeficiencyvirus were negative. All further investigations, reported below,were performed on a B-cell line transformed by EpsteinBarrvirus (EBV).
Methods
Microsatellites
The genes coding for human TNF-, TNF-R1, interferon- (IFN-),and IRF1 have been mapped to 6p21.3, 12p13, 12q24, and 5q31.1,respectively. Polymorphic microsatellites within a 2-cM intervalaround each of these genes, available from human-genome databases, included TNF1 (for TNF-), D12S93 and D12S314 (for TNF-R1),D12S342 (for IFN-), and D5S393 (for IRF1). The IFN-R1 genewas mapped at the Genethon Laboratories (Evry, France) withthe use of irradiation hybrids within a larger (10 cM) interval(D6S262 through D6S293) on 6q21q23.
Sequencing of Complementary DNA
Total RNA was extracted from EBV-transformed B cells in guanidiumisothiocyanate, as described elsewhere.11 Complementary DNA(cDNA) was synthesized by incubating 10 µg of total RNAwith oligo-dT12-18 and avian myeloblastosis virus reverse transcriptaseaccording to the manufacturer's instructions (Boehringer Mannheim,Mannheim, Germany). Polymerase chain reaction (PCR) with IFN-R1sense (5'TTAAGCTTGGAGCCAGCGACCGT3') and antisense (5'CGGATCCAAAGTTGGTGCAACT3')primers12 was carried out with a mixture of Taq polymerase (Promega,Madison, Wis.) and Pfu polymerase (Stratagene, La Jolla, Calif.)under the following conditions: five minutes at 94°C, followedby 35 cycles, each for one minute at 94°C, two minutes at55°C, and three minutes at 72°C. PCR products were treatedwith Taq polymerase and deoxyadenosine triphosphate for 60 minutesat 72°C, ligated to pGEM-T vectors (Promega), and transformedinto JM109 bacteria. Recombinant phagemids were sequenced withSequenase or Thermosequenase (U.S. Biochemical, Cleveland) withthe use of a series of nested primers. Double-stranded PCR productswere directly sequenced on both strands around nucleotide 131(nucleotides were numbered starting with the ATG sequence initiatingthe coding region) with Sequenase13 or Thermosequenase.
Genomic PCR
Genomic DNA was extracted from EBV-transformed B cells withproteinase K, sodium dodecyl sulfate, and a series of phenolchloroformextractions.11 Genomic sense (5'GCCTACACCAACTAATGTTA3') andantisense (5'ATAGTTCTTTACCTCTACGG3') primers within exon 2 ofthe IFN-R1 gene (Merlin G, et al.: personal communication)were used for genomic PCR. Genomic PCR was performed with theincorporation of [32P]deoxycytidine triphosphate and analyzedon a sequencing gel.
Northern Blotting
Total RNA (10 µg) from EBV-transformed B cells was runon a formaldehydeagarose gel, transferred to a nylonmembrane, and hybridized with a 32P-labeled double-strandedDNA probe corresponding to the IFN-R1 PCR product or to an actinfragment.11
Assay of 125I-LabeledInterferon- Binding
One million EBV-transformed B cells were incubated for two hoursat 4°C in RPMI 1640 supplemented with 5 percent fetal-calfserum in the presence of various amounts of 125I-labeled interferon-(specific radioactivity, 50x106 cpm per microgram). Parallelsamples were incubated under the same conditions with a 100-foldexcess of unlabeled interferon-. Cell suspensions were washedfour times with phosphate-buffered saline containing 1 percentfetal-calf serum, 0.1 mM calcium chloride, and 0.1 mM magnesiumchloride, and the radioactivity of the cell pellet was counted.Specific binding was calculated as the bound radioactivity thatcould be displaced by cold interferon- (the mean value of triplicatemeasurements).
Cell Staining
The available murine monoclonal antibodies specific for humaninterferon-R1 were 5362-6545 (IgG1) (Valbiotech, Paris) and1224-00 (IgG2b) (Genzyme, Cambridge, Mass.). Cells (2x105) wereincubated first in RPMI containing 10 percent AB+ serum with2 µg of ad hoc monoclonal antibodies, then with a biotinylatedgoat antimouse antibody (Immunotech, Marseille, France), andfinally with streptavidinphycoerythrin (Tebu, Paris).Staining was detected by flow cytometry (Becton Dickinson, Oxford,United Kingdom). Specific staining of interferon-R1 on EBV-transformedB cells was deduced from that obtained with an isotypic controlantibody.
Results
We first analyzed the intrafamilial segregation of polymorphicmicrosatellites located near each of the five candidate genescoding for TNF-, TNF-R1, interferon-, interferon-R1, and IRF1.Since the child had been born to consanguineous parents, shewas most likely homozygous for a mutant allele inherited froma common ancestor. Thus, we reasoned that microsatellite heterozygositywould rule out nearby genes, and homozygosity would prompt furtherinvestigation. Intrafamilial segregation of microsatellitessuggested that only the gene coding for interferon-R1 warrantedfurther investigation (data not shown).
Interferon-R1 is ubiquitously expressed, and the cDNA codingregion could therefore be amplified and sequenced from an EBV-transformedB-cell line. Two recombinant phagemids from distinct PCR productslacked nucleotide 131 in the coding region (Figure 2A).12 Noother mutations were found. The single-base deletion was confirmedby direct sequencing of an independent PCR product (Figure 2B).The single-nucleotide deletion designated 131delC creates aframe shift and leads to a premature stop codon (TAA) at nucleotides187 through 189 (Figure 2C). Both the deletion and the stopcodon are located in a region that codes for the N-terminalportion of the extracellular domain of the receptor.
Figure 2. Mutation of the Messenger RNA Coding Region of the Interferon-R1 Gene.
Panel A shows the results of a sequence analysis of reverse-transcriptasepolymerase-chain-reaction (PCR) products around nucleotide 131 (numbered from the ATG sequence initiating the coding region) from the patient and a control. The arrowhead indicates the deletion of nucleotide 131 in the patient. Panel B shows the results of direct sequencing of an independent reverse-transcriptase PCR product from the patient in the same region. Panel C shows a schematic representation of interferon-R1 messenger RNA (mRNA) with exon boundaries and protein with domain boundaries. Hydrophobic regions are shaded. L denotes leader domain and TM transmembrane domain. The deletion of nucleotide 131 results in a frame shift and a premature stop codon at nucleotides 187 through 189 in exon 2.
Intrafamilial segregation of the mutant allele of the IFN-R1gene was analyzed to confirm its role in the pathogenic process.On the basis of the genomic structure of IFN-R1 (Merlin G,Dembic Z: personal communication), the mutation was determinedto be located in exon 2 (Figure 2C). A genomic PCR product aroundthe single-base deletion within exon 2 showed that the affectedchild carried the mutant allele at both IFN-R1 loci (Figure 3).Both her parents and her two healthy brothers were heterozygouscarriers.
Figure 3. Intrafamilial Segregation of the Mutation in the Interferon-R1 Gene.
The results of sequencing gel analysis of radioactive PCR products are shown for genomic DNA from the patient and her father, mother, and healthy brothers, with genomic sense and antisense primers specific for exon 2 of the interferon-R1 gene. The normal product is 112 bp, and the mutant product is 111 bp. The squares denote male family members, and the circles female family members; the solid circle with a slash denotes the dead patient.
Northern blot analysis revealed a considerable decrease in detectableinterferon-R1 messenger RNA (mRNA) in EBV-transformed B cellsfrom the affected child, presumably due to a rapid degradationof the transcript (Figure 4A). Hybridization of the same blotwith a control probe (actin) revealed no difference in sizeor intensity between mRNA from a control and mRNA from the patient.The 2.3-kb specific transcript, along with a degradation smear,was visible with longer exposure (data not shown).
Figure 4. Results of Studies of Cell-Surface Interferon- Receptor (Interferon- R1) in the Patient and a Control.
Panel A shows the results of a Northern blot analysis of interferon- R1 and actin transcripts from EpsteinBarr virus (EBV)transformed B cells. Panel B shows the staining of EBV-transformed B cells with an IgG1 monoclonal antibody specific for interferon- R1, analyzed by flow cytometry. The dashed lines indicate the values obtained with an isotypic control antibody. Panel C shows the specific binding of 125I-labeled interferon- to EBV-transformed B cells.
We analyzed the expression of interferon-R1 on the EBV-transformedB-cell surface by flow cytometry with two specific monoclonalantibodies (Figure 4B). The specific binding of two monoclonalantibodies, each expressing a distinct isotype, on a controlcell line was faint. The expression of cell-surface interferon-R1on the cell line from the affected child, however, was not detectableon repeated experiments with either monoclonal antibody.
Specific binding of 125I-labeled interferon- was determinedon EBV-transformed B cells from a control and the patient toconfirm the absence of an interferon-R1 binding site for interferon-on the cell surface (Figure 4C). As expected, there was dose-dependentspecific interferon- binding in the control cell line. In contrast,there was dramatically reduced specific binding in the patient'scell line. Scatchard analysis revealed high-affinity (associationconstant, 1.25x10-9 M) specific binding on approximately 6500binding sites per cell in the control line. The residual specificbinding in the patient's cell line did not allow a precise Scatchardanalysis. Altogether, our data show a complete deficiency ofcell-surface expression of interferon-R1 in the child.
Discussion
In this child with a fatal BCG infection and in a kindred withatypical mycobacterial infection described by Newport et al.in this issue of the Journal,14 similar, yet distinct, mutationsof the IFN-R1 gene were found that precluded the expressionof interferon-R1. It thus appears that a complete deficiencyof interferon-R1 may lead to BCG infection in vaccinated childrenor to atypical mycobacterial infection in unvaccinated persons.The prognosis appears to be worst after BCG vaccination, probablybecause of the higher virulence of BCG as compared with mostatypical mycobacteria, the higher number of infecting BCG organisms,or the direct intradermal inoculation of BCG as opposed to naturalroutes of infection with atypical mycobacteria. In any event,vaccination with all currently used live BCG substrains is contraindicatedin children with interferon-R deficiency. Whether new generationsof live vaccine, such as auxotrophic BCG substrains,15 are safeand even protective in such children is unknown.
Fatal disseminated BCG or atypical mycobacterial infectionsin other patients may be due to a complete deficiency of interferon-R1.Milder forms of idiopathic disseminated BCG infections, characterizedby well-circumscribed tuberculoid granulomas and few visibleacid-fast rods within macrophages, have a favorable outcome5and may represent either different mutations of the IFN-R1 geneor mutation of another gene. Furthermore, alternative or heterozygousmutations of the IFN-R1 gene may contribute to the genetic susceptibilityto more virulent mycobacteria in tuberculosis16 or leprosy.17Mutations of the IFN-R1 gene may also confer a predispositionto other infections with intracellular microorganisms, suchas salmonella, which are frequently associated with idiopathicBCG or atypical mycobacterial infections.4 In any event, a completedeficiency of interferon-R1 provides molecular evidence of aselective genetic susceptibility to mycobacterial infection.
From recent studies in mice, much has been learned about thecharacteristics of interferon- at the cellular level.6,7,8,18,19,20After macrophage stimulation, such as that produced by mycobacterialinfection, the secretion of TNF-, interleukin-12, and possiblyother factors by macrophages promotes interferon- secretionby natural killer cells, differentiation of antigen-driven CD4T cells into interferon- producing TH1 cells, and activationof these TH1 cells to secrete interferon- and possibly othermacrophage-activating factors.18,19 Secretion of interferon-,in turn, results in macrophage secretion of TNF-9; activationof macrophage mycobactericidal mechanisms, such as nitric oxideproduction8; and impaired proliferation of interleukin-4secretingTH2 cells.20
It is likely that the susceptibility to mycobacterial infectionin children with a complete deficiency of interferon-R1 resultsprimarily from an intrinsic impairment of macrophages ratherthan a defective TH1 response. The strongly positive test fordelayed hypersensitivity to tuberculin in the child we studiedreflects a normal TH1 response, which is similar to the findingsin mice with deletions of the IFN-R1 gene.21 The normal TH1response may result from the fact that interferon- does notdirectly promote TH1 responses but instead impairs TH2 responses.20The uncontrolled growth of mycobacteria within macrophages frominterferon-R1deficient children is probably due to impairedactivation of bactericidal mechanisms rather than impaired inductionof major-histocompatibility-complex (MHC) class II molecules.Indeed, disseminated BCG infection after vaccination has notbeen reported in children with a complete deficiency of MHCclass II molecules.2 In vitro experiments in humans provideconflicting evidence, with interferon- alternatively enhancingor reducing the growth of mycobacteria within cultured monocytemacrophages.22,23,24,25,26,27,28 Moreover, the mycobactericidalmechanisms of human macrophages remain largely unknown.28 Thus,it is likely that the macrophage has a causal role in the pathogenesisof mycobacterial infections associated with interferon-R1 deficiency,but more direct and definitive evidence of such a role is required.
The selective susceptibility of children with a complete deficiencyof interferon-R1 contrasts with the broad susceptibility ofmice with deletions of the IFN- or IFN-R1 gene, which are susceptiblenot only to mycobacterial infection,6,7,29,30 but also to infectionwith other intracellular31 or extracellular32 bacteria, as wellas a number of viruses31,33,34,35 and parasites.21,36 Childrenwith interferon-R1 deficiency do not appear to be susceptibleto infection with agents other than mycobacteria. This apparentlyselective susceptibility may be the result of an underestimationof human interferon- mediated immunity due to early casesof fatal mycobacterial infection that preclude exposure to otherpotential pathogens; an overestimation of murine interferon-mediated immunity due to experimental, as opposed tonatural, modes of infection; or intrinsic differences betweenhuman and murine interferon- mediated immunity.
The clinical features and outcome of interferon-R1 deficiencyin children show that interferon- is obligatory for both anappropriate granuloma structure and efficient macrophage antimycobacterialactivity. This condition thus adds weight to the growing evidencesupporting the use of interferon- as a therapeutic agent inpatients with other mycobacterial diseases.37,38
Supported by grants from the Institut National de la Santéet de la Recherche Medicale, Association Française contreles Myopathies, Institut Smithkline Beecham, Fondation MarcelMérieux, Centre International des Etudiants et Stagiaires,Glaxo Wellcome, and Fonds d'Etudes et de Recherche des Hôpitauxde Paris.
We are indebted to Dr. J. Wietzerbin for the interferon- bindingassay; to Drs. G. Merlin and Z. Dembic for the IFN-R1 genomicstructure; to C. Hein for the microsatellite analysis; to Dr.F. Le Deist for immunologic investigations; to Dr. S. Ben Becherfor the referral of the patient's family; to Drs. D. Devictor,J.P. Dommergues, and G. Huault for the referral of the patient;to Dr. L. Jacques for the identification of the BCG strain;to Dr. J. Quillard for the biopsy specimen; to Drs. R. Dufourcq,J. Peake, J. Di Santo, F. Godeau, and D. Guy-Grand for helpfulcomments; and to Drs. P. Kourilsky and J.L. Maryanski for scientificguidance.
Source Information
From INSERM Unité 429 (E.J., F.A., S.L., P.R., A.F., J.-L.C.) and the Department of Pathology (J.-F.E.), Hôpital NeckerEnfants Malades, Paris; the Department of Pediatrics, Imperial College of Science, Technology, and Medicine, St. Mary's Hospital, London (M.N., M.L.); Genethon Laboratories, Evry, France (E.S.); and Unité d'Immunologie et Hématologie Pédiatrique, Hôpital Necker, Paris (S.B., A.F., J.-L.C.).
Address reprint requests to Dr. Casanova at INSERM U429, Pavillon Kirmisson, Hôpital Necker Enfants Malades, 149 rue de Sèvres, 75015 Paris, France.
References
Lotte A, Wasz-Höckert O, Poisson N, Dumitrescu N, Verron M, Couvet E. BCG complications: estimates of the risks among vaccinated subjects and statistical analysis of their characteristics. Adv Tuberc Res 1984;21:107-193. [Medline]
Casanova J-L, Jouanguy E, Lamhamedi S, Blanche S, Fischer A. Immunological conditions of children with BCG disseminated infection. Lancet 1995;346:581-581. [Medline]
Primary immunodeficiency diseases: report of a WHO scientific group. Clin Exp Immunol 1995;99:Suppl 1:1-24.
Casanova J-L, Blanche S, Emile J-F, et al. Idiopathic disseminated bacillus Calmette-Guérin (BCG) infection: a French national retrospective study. Pediatrics 1996;98:774-778. [Free Full Text]
Emile J-F, Patey N, Altare F, et al. Correlation of granuloma structure with clinical outcome defines two types of idiopathic disseminated bacillus Calmette-Guérin (BCG) infection. J Pathol (in press).
Kamijo R, Le J, Shapiro D, et al. Mice that lack the interferon- receptor have profoundly altered responses to infection with bacillus Calmette-Guérin and subsequent challenge with lipopolysaccharide. J Exp Med 1993;178:1435-1440. [Free Full Text]
Dalton DK, Pitts-Meek S, Keshav S, Figari IS, Bradley A, Stewart TA. Multiple defects of immune cell function in mice with disrupted interferon- genes. Science 1993;259:1739-1742. [Free Full Text]
Kamijo R, Harada H, Matsuyama T, et al. Requirement for transcription factor IRF-1 in NO synthase induction in macrophages. Science 1994;263:1612-1615. [Free Full Text]
Kindler V, Sappino AP, Grau GE, Piguet PF, Vassalli P. The inducing role of tumor necrosis factor in the development of bactericidal granulomas during BCG infection. Cell 1989;56:731-740. [CrossRef][Medline]
Flynn JL, Goldstein MM, Chan J, et al. Tumor necrosis factor- is required in the protective immune response against Mycobacterium tuberculosis in mice. Immunity 1995;2:561-572. [CrossRef][Medline]
Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory, 1989.
Aguet M, Dembi Z, Merlin G. Molecular cloning and expression of the human interferon- receptor. Cell 1988;55:273-280. [CrossRef][Medline]
Casanova JL, Pannetier C, Jaulin C, Kourilsky P. Optimal conditions for directly sequencing double-stranded PCR products with sequenase. Nucleic Acids Res 1990;18:4028-4028. [Free Full Text]
Newport MJ, Huxley CM, Huston S, et al. A mutation in the interferon--receptor gene and susceptibility to mycobacterial infection. N Engl J Med 1996;335:1941-1949. [Free Full Text]
Guleira I, Teitelbaum R, McAdam RA, Kalpana G, Jacobs WR Jr, Bloom BR. Auxotrophic vaccines for tuberculosis. Nat Med 1996;2:334-337. [CrossRef][Medline]
Stead WW. Genetics and resistance to tuberculosis: could resistance be enhanced by genetic engineering? Ann Intern Med 1992;116:937-941.
Abel L, Demenais F. Detection of major genes for susceptibility to leprosy and its subtypes in a Caribbean island: Desirade island. Am J Hum Genet 1988;42:256-266. [Medline]
Farrar MA, Schreiber RD. The molecular cell biology of interferon- and its receptor. Annu Rev Immunol 1993;11:571-611. [CrossRef][Medline]
Magram J, Connaughton SE, Warrier RR, et al. IL-12-deficient mice are defective in IFN production and type 1 cytokine production. Immunity 1996;4:471-481. [CrossRef][Medline]
Bach EA, Szabo SJ, Dighe AS, et al. Ligand-induced autoregulation of IFN- receptor chain expression in T helper cell subsets. Science 1995;270:1215-1218. [Free Full Text]
Swihart K, Fruth U, Messmer N, et al. Mice from a genetically resistant background lacking the interferon receptor are susceptible to infection with Leishmania major but mount a polarized T helper cell 1-type CD4+ T cell response. J Exp Med 1995;181:961-971. [Free Full Text]
Douvas GS, Looker DL, Vatter AE, Crowle AJ. Gamma interferon activates human macrophages to become tumoricidal and leishmanicidal but enhances replication of macrophage-associated mycobacteria. Infect Immun 1985;50:1-8. [Free Full Text]
Rook GAW, Steele J, Fraher L, et al. Vitamin D3, interferon, and control of proliferation of Mycobacterium tuberculosis by human monocytes. Immunology 1986;57:159-163. [Medline]
Rook GAW, Steele J, Ainsworth M, Champion BR. Activation of macrophages to inhibit proliferation of Mycobacterium tuberculosis: comparison of the effects of recombinant -interferon on human monocytes and murine peritoneal macrophages. Immunology 1986;59:333-338. [Medline]
Crowle AJ. Intracellular killing of mycobacteria. Res Microbiol 1990;141:231-236. [Medline]
Denis M. Killing of Mycobacterium tuberculosis within human monocytes: activation by cytokines and calcitriol. Clin Exp Immunol 1991;84:200-206. [Medline]
Denis M. Growth of Mycobacterium avium in human monocytes: identification of cytokines which reduce and enhance intracellular microbial growth. Eur J Immunol 1991;21:391-395. [Medline]
Flesch IEA, Kaufmann SHE. Role of cytokines in tuberculosis. Immunobiology 1993;189:316-339. [Medline]
Cooper AM, Dalton DK, Stewart TA, Griffin JP, Russell DG, Orme IM. Disseminated tuberculosis in interferon gene-disrupted mice. J Exp Med 1993;178:2243-2247. [Free Full Text]
Flynn JL, Chan J, Triebold KJ, Dalton DK, Stewart TA, Bloom BR. An essential role for interferon in resistance to Mycobacterium tuberculosis infection. J Exp Med 1993;178:2249-2254. [Free Full Text]
Huang S, Hendriks W, Althage A, et al. Immune response in mice that lack the interferon-gamma receptor. Science 1993;259:1742-1745. [Free Full Text]
Zhao Y-X, Tarkowski A. Impact of interferon- receptor deficiency on experimental Staphylococcus aureus septicemia and arthritis. J Immunol 1995;155:5736-5742. [Abstract]
Müller U, Steinhoff U, Reis LFL, et al. Functional role of type I and type II interferons in antiviral defense. Science 1994;264:1918-1921. [Free Full Text]
Fiette L, Aubert C, Müller U. Theiler's virus infection of 129Sv mice that lack the interferon / or interferon receptors. J Exp Med 1995;181:2069-2076. [Free Full Text]
Bouley DM, Kanangat S, Wire W, Rouse BT. Characterization of herpes simplex virus type-1 infection and herpetic stromal keratitis development in IFN-gamma knockout mice. J Immunol 1995;155:3964-3971. [Abstract]
Tsuji M, Miyahira Y, Nussenzweig RS, Aguet M, Reichel M, Zavala F. Development of antimalarial immunity in mice lacking IFN- receptor.J Immunol 1995;154:5338-44.
Murray HW. Interferon- and host antimicrobial defense: current and future clinical applications. Am J Med 1994;97:459-467. [CrossRef][Medline]
Bermudez LE, Kaplan G. Recombinant cytokines for controlling mycobacterial infections. Trends Microbiol 1995;3:22-27. [CrossRef][Medline]
Mikhak, Z., Farsidjani, A., Luster, A. D.
(2009). Endotoxin Augmented Antigen-Induced Th1 Cell Trafficking Amplifies Airway Neutrophilic Inflammation. J. Immunol.
182: 7946-7956
[Abstract][Full Text]
Wan, Y. Y., Flavell, R. A.
(2009). How Diverse--CD4 Effector T Cells and their Functions. J Mol Cell Biol
0: mjp001v1-mjp001
[Abstract][Full Text]
Blackwell, J. M., Jamieson, S. E., Burgner, D.
(2009). HLA and Infectious Diseases. Clin. Microbiol. Rev.
22: 370-385
[Abstract][Full Text]
Zhu, J., Paul, W. E.
(2008). CD4 T cells: fates, functions, and faults. Blood
112: 1557-1569
[Abstract][Full Text]
Dale, D. C., Boxer, L., Liles, W. C.
(2008). The phagocytes: neutrophils and monocytes. Blood
112: 935-945
[Abstract][Full Text]
Hussain, R., Talat, N., Shahid, F., Dawood, G.
(2007). Longitudinal Tracking of Cytokines after Acute Exposure to Tuberculosis: Association of Distinct Cytokine Patterns with Protection and Disease Development. CVI
14: 1578-1586
[Abstract][Full Text]
Pennini, M. E., Liu, Y., Yang, J., Croniger, C. M., Boom, W. H., Harding, C. V.
(2007). CCAAT/Enhancer-Binding Protein beta and {delta} Binding to CIITA Promoters Is Associated with the Inhibition of CIITA Expression in Response to Mycobacterium tuberculosis 19-kDa Lipoprotein. J. Immunol.
179: 6910-6918
[Abstract][Full Text]
Coelho, A. L., Schaller, M. A., Benjamim, C. F., Orlofsky, A. Z., Hogaboam, C. M., Kunkel, S. L.
(2007). The Chemokine CCL6 Promotes Innate Immunity via Immune Cell Activation and Recruitment. J. Immunol.
179: 5474-5482
[Abstract][Full Text]
Giannoudis, P. V., van Griensven, M., Tsiridis, E., Pape, H. C.
(2007). The genetic predisposition to adverse outcome after trauma. J Bone Joint Surg Br
89-B: 1273-1279
[Abstract][Full Text]
Okada, S., Ishikawa, N., Shirao, K., Kawaguchi, H., Tsumura, M., Ohno, Y., Yasunaga, S., Ohtsubo, M., Takihara, Y., Kobayashi, M.
(2007). The novel IFNGR1 mutation 774del4 produces a truncated form of interferon-{gamma} receptor 1 and has a dominant-negative effect on interferon-{gamma} signal transduction. J. Med. Genet.
44: 485-491
[Abstract][Full Text]
Plitas, G., Chaudhry, U. I., Kingham, T. P., Raab, J. R., DeMatteo, R. P.
(2007). NK Dendritic Cells Are Innate Immune Responders to Listeria monocytogenes Infection. J. Immunol.
178: 4411-4416
[Abstract][Full Text]
Loeuillet, C., Martinon, F., Perez, C., Munoz, M., Thome, M., Meylan, P. R.
(2006). Mycobacterium tuberculosis Subverts Innate Immunity to Evade Specific Effectors. J. Immunol.
177: 6245-6255
[Abstract][Full Text]
Filipe-Santos, O., Bustamante, J., Haverkamp, M. H., Vinolo, E., Ku, C.-L., Puel, A., Frucht, D. M., Christel, K., von Bernuth, H., Jouanguy, E., Feinberg, J., Durandy, A., Senechal, B., Chapgier, A., Vogt, G., de Beaucoudrey, L., Fieschi, C., Picard, C., Garfa, M., Chemli, J., Bejaoui, M., Tsolia, M. N., Kutukculer, N., Plebani, A., Notarangelo, L., Bodemer, C., Geissmann, F., Israel, A., Veron, M., Knackstedt, M., Barbouche, R., Abel, L., Magdorf, K., Gendrel, D., Agou, F., Holland, S. M., Casanova, J.-L.
(2006). X-linked susceptibility to mycobacteria is caused by mutations in NEMO impairing CD40-dependent IL-12 production. JEM
203: 1745-1759
[Abstract][Full Text]
Field, S. K., Cowie, R. L.
(2006). Lung Disease Due to the More Common Nontuberculous Mycobacteria. Chest
129: 1653-1672
[Abstract][Full Text]
Demissie, A., Wassie, L., Abebe, M., Aseffa, A., Rook, G., Zumla, A., Andersen, P., Doherty, T. M., the VACSEL Study Group,
(2006). The 6-kilodalton early secreted antigenic target-responsive, asymptomatic contacts of tuberculosis patients express elevated levels of interleukin-4 and reduced levels of gamma interferon.. Infect. Immun.
74: 2817-2822
[Abstract][Full Text]
Koch, O., Kwiatkowski, D. P., Udalova, I. A.
(2006). Context-specific functional effects of IFNGR1 promoter polymorphism. Hum Mol Genet
15: 1475-1481
[Abstract][Full Text]
Pennini, M. E., Pai, R. K., Schultz, D. C., Boom, W. H., Harding, C. V.
(2006). Mycobacterium tuberculosis 19-kDa Lipoprotein Inhibits IFN-{gamma}-Induced Chromatin Remodeling of MHC2TA by TLR2 and MAPK Signaling. J. Immunol.
176: 4323-4330
[Abstract][Full Text]
Khan, S., Kolls, J. K.
(2006). Malnutrition in the Critically III: Don't Hold the Leptin. Am. J. Respir. Crit. Care Med.
173: 140-141
[Full Text]
Sghiri, R., Feinberg, J., Thabet, F., Dellagi, K., Boukadida, J., Ben Abdelaziz, A., Casanova, J. L., Barbouche, M. R.
(2005). Gamma Interferon Is Dispensable for Neopterin Production In Vivo. CVI
12: 1437-1441
[Abstract][Full Text]
Mukherjee, S., Kashino, S. S., Zhang, Y., Daifalla, N., Rodrigues, V. Jr, Reed, S. G., Campos-Neto, A.
(2005). Cloning of the Gene Encoding a Protective Mycobacterium tuberculosis Secreted Protein Detected In Vivo during the Initial Phases of the Infectious Process. J. Immunol.
175: 5298-5305
[Abstract][Full Text]
Doherty, T. M., Andersen, P.
(2005). Vaccines for Tuberculosis: Novel Concepts and Recent Progress. Clin. Microbiol. Rev.
18: 687-702
[Abstract][Full Text]
Tzioupis, C. C, Katsoulis, S., Manidakis, N., Giannoudis, P. V
(2005). The immuno-inflammatory response to trauma. Trauma
7: 171-183
[Abstract]
Shin, S. J., Chang, C.-F., Chang, C.-D., McDonough, S. P., Thompson, B., Yoo, H. S., Chang, Y.-F.
(2005). In Vitro Cellular Immune Responses to Recombinant Antigens of Mycobacterium avium subsp. paratuberculosis. Infect. Immun.
73: 5074-5085
[Abstract][Full Text]
Casanova, J.-L., Abel, L.
(2005). Inborn errors of immunity to infection: the rule rather than the exception. JEM
202: 197-201
[Abstract][Full Text]
Bonanni, D., Rindi, L., Lari, N., Garzelli, C.
(2005). Immunogenicity of mycobacterial PPE44 (Rv2770c) in Mycobacterium bovis BCG-infected mice. J Med Microbiol
54: 443-448
[Abstract][Full Text]
Roberts, C. S., Pape, H.-C., Jones, A. L., Malkani, A. L., Rodriguez, J. L., Giannoudis, P. V.
(2005). Damage Control Orthopaedics. Evolving Concepts in the Treatment of Patients Who Have Sustained Orthopaedic Trauma. JBJS
87: 434-449
[Full Text]
Kampmann, B., Tena, G. N., Mzazi, S., Eley, B., Young, D. B., Levin, M.
(2004). Novel Human In Vitro System for Evaluating Antimycobacterial Vaccines. Infect. Immun.
72: 6401-6407
[Abstract][Full Text]
Fieschi, C., Bosticardo, M., de Beaucoudrey, L., Boisson-Dupuis, S., Feinberg, J., Santos, O. F., Bustamante, J., Levy, J., Candotti, F., Casanova, J.-L.
(2004). A novel form of complete IL-12/IL-23 receptor {beta}1 deficiency with cell surface-expressed nonfunctional receptors. Blood
104: 2095-2101
[Abstract][Full Text]
Bream, J. H., Hodge, D. L., Gonsky, R., Spolski, R., Leonard, W. J., Krebs, S., Targan, S., Morinobu, A., O'Shea, J. J., Young, H. A.
(2004). A Distal Region in the Interferon-{gamma} Gene Is a Site of Epigenetic Remodeling and Transcriptional Regulation by Interleukin-2. J. Biol. Chem.
279: 41249-41257
[Abstract][Full Text]
Rosenzweig, S. D., Dorman, S. E., Uzel, G., Shaw, S., Scurlock, A., Brown, M. R., Buckley, R. H., Holland, S. M.
(2004). A Novel Mutation in IFN-{gamma} Receptor 2 with Dominant Negative Activity: Biological Consequences of Homozygous and Heterozygous States. J. Immunol.
173: 4000-4008
[Abstract][Full Text]
Hallstrand, T.S., Ochs, H.D., Zhu, Q., Liles, W.C.
(2004). Inhaled IFN-{gamma} for persistent nontuberculous mycobacterial pulmonary disease due to functional IFN-{gamma} deficiency. Eur Respir J
24: 367-370
[Abstract][Full Text]
Gehring, A. J., Dobos, K. M., Belisle, J. T., Harding, C. V., Boom, W. H.
(2004). Mycobacterium tuberculosis LprG (Rv1411c): A Novel TLR-2 Ligand That Inhibits Human Macrophage Class II MHC Antigen Processing. J. Immunol.
173: 2660-2668
[Abstract][Full Text]
Field, S. K., Fisher, D., Cowie, R. L.
(2004). Mycobacterium avium complex Pulmonary Disease in Patients Without HIV Infection. Chest
126: 566-581
[Abstract][Full Text]
Skeiky, Y. A. W., Alderson, M. R., Ovendale, P. J., Guderian, J. A., Brandt, L., Dillon, D. C., Campos-Neto, A., Lobet, Y., Dalemans, W., Orme, I. M., Reed, S. G.
(2004). Differential Immune Responses and Protective Efficacy Induced by Components of a Tuberculosis Polyprotein Vaccine, Mtb72F, Delivered as Naked DNA or Recombinant Protein. J. Immunol.
172: 7618-7628
[Abstract][Full Text]
Demissie, A., Abebe, M., Aseffa, A., Rook, G., Fletcher, H., Zumla, A., Weldingh, K., Brock, I., Andersen, P., Doherty, T. M.
(2004). Healthy Individuals That Control a Latent Infection with Mycobacterium tuberculosis Express High Levels of Th1 Cytokines and the IL-4 Antagonist IL-4{delta}2. J. Immunol.
172: 6938-6943
[Abstract][Full Text]
Casanova, J.-L., Abel, L.
(2004). Human Mannose-binding Lectin in Immunity: Friend, Foe, or Both?. JEM
199: 1295-1299
[Abstract][Full Text]
Lim, M. S., Elenitoba-Johnson, K. S.J.
(2004). The Molecular Pathology of Primary Immunodeficiencies. J. Mol. Diagn.
6: 59-83
[Full Text]
Awomoyi, A A, Nejentsev, S, Richardson, A, Hull, J, Koch, O, Podinovskaia, M, Todd, J A, McAdam, K P W J, Blackwell, J M, Kwiatkowski, D, Newport, M J
(2004). No association between interferon-{gamma} receptor-1 gene polymorphism and pulmonary tuberculosis in a Gambian population sample. Thorax
59: 291-294
[Abstract][Full Text]
Toyoda, H., Ido, M., Hayashi, T., Gabazza, E. C., Suzuki, K., Bu, J., Tanaka, S., Nakano, T., Kamiya, H., Chipeta, J., Kisenge, R. R., Kang, J., Hori, H., Komada, Y.
(2004). Impairment of IL-12-Dependent STAT4 Nuclear Translocation in a Patient with Recurrent Mycobacterium avium Infection. J. Immunol.
172: 3905-3912
[Abstract][Full Text]
Holten-Andersen, L., Doherty, T. M., Korsholm, K. S., Andersen, P.
(2004). Combination of the Cationic Surfactant Dimethyl Dioctadecyl Ammonium Bromide and Synthetic Mycobacterial Cord Factor as an Efficient Adjuvant for Tuberculosis Subunit Vaccines. Infect. Immun.
72: 1608-1617
[Abstract][Full Text]
Ogus, A.C., Yoldas, B., Ozdemir, T., Uguz, A., Olcen, S., Keser, I., Coskun, M., Cilli, A., Yegin, O.
(2004). The Arg753Gln polymorphism of the human Toll-like receptor 2 gene in tuberculosis disease. Eur Respir J
23: 219-223
[Abstract][Full Text]
Schroder, K., Hertzog, P. J., Ravasi, T., Hume, D. A.
(2004). Interferon-{gamma}: an overview of signals, mechanisms and functions. J. Leukoc. Biol.
75: 163-189
[Abstract][Full Text]
Fuller, C. L., Flynn, J. L., Reinhart, T. A.
(2003). In Situ Study of Abundant Expression of Proinflammatory Chemokines and Cytokines in Pulmonary Granulomas That Develop in Cynomolgus Macaques Experimentally Infected with Mycobacterium tuberculosis. Infect. Immun.
71: 7023-7034
[Abstract][Full Text]
Andrews, T., Sullivan, K. E.
(2003). Infections in Patients with Inherited Defects in Phagocytic Function. Clin. Microbiol. Rev.
16: 597-621
[Abstract][Full Text]
Shaw, M. H., Boyartchuk, V., Wong, S., Karaghiosoff, M., Ragimbeau, J., Pellegrini, S., Muller, M., Dietrich, W. F., Yap, G. S.
(2003). A natural mutation in the Tyk2 pseudokinase domain underlies altered susceptibility of B10.Q/J mice to infection and autoimmunity. Proc. Natl. Acad. Sci. USA
100: 11594-11599
[Abstract][Full Text]
Dieli, F., Taniguchi, M., Kronenberg, M., Sidobre, S., Ivanyi, J., Fattorini, L., Iona, E., Orefici, G., De Leo, G., Russo, D., Caccamo, N., Sireci, G., Di Sano, C., Salerno, A.
(2003). An Anti-Inflammatory Role for V{alpha}14 NK T cells in Mycobacterium bovis Bacillus Calmette-Guerin-Infected Mice. J. Immunol.
171: 1961-1968
[Abstract][Full Text]
Weyand, C. M., Goronzy, J. J.
(2003). Medium- and Large-Vessel Vasculitis. NEJM
349: 160-169
[Full Text]
Koguchi, Y., Kawakami, K., Uezu, K., Fukushima, K., Kon, S., Maeda, M., Nakamoto, A., Owan, I., Kuba, M., Kudeken, N., Azuma, M., Yara, S., Shinzato, T., Higa, F., Tateyama, M., Kadota, J.-I., Mukae, H., Kohno, S., Uede, T., Saito, A.
(2003). High Plasma Osteopontin Level and Its Relationship with Interleukin-12-mediated Type 1 T Helper Cell Response in Tuberculosis. Am. J. Respir. Crit. Care Med.
167: 1355-1359
[Abstract][Full Text]
Condos, R., Raju, B., Canova, A., Zhao, B.-Y., Weiden, M., Rom, W. N., Pine, R.
(2003). Recombinant Gamma Interferon Stimulates Signal Transduction and Gene Expression in Alveolar Macrophages In Vitro and in Tuberculosis Patients. Infect. Immun.
71: 2058-2064
[Abstract][Full Text]
Huard, R. C., de Oliveira Lazzarini, L. C., Butler, W. R., van Soolingen, D., Ho, J. L.
(2003). PCR-Based Method To Differentiate the Subspecies of the Mycobacterium tuberculosis Complex on the Basis of Genomic Deletions. J. Clin. Microbiol.
41: 1637-1650
[Abstract][Full Text]
Bellamy, R.
(2003). Interferon-{gamma} and Host Susceptibility to Tuberculosis. Am. J. Respir. Crit. Care Med.
167: 946-947
[Full Text]
Lopez-Maderuelo, D., Arnalich, F., Serantes, R., Gonzalez, A., Codoceo, R., Madero, R., Vazquez, J. J., Montiel, C.
(2003). Interferon-{gamma} and Interleukin-10 Gene Polymorphisms in Pulmonary Tuberculosis. Am. J. Respir. Crit. Care Med.
167: 970-975
[Abstract][Full Text]
Fieschi, C., Dupuis, S., Catherinot, E., Feinberg, J., Bustamante, J., Breiman, A., Altare, F., Baretto, R., Le Deist, F., Kayal, S., Koch, H., Richter, D., Brezina, M., Aksu, G., Wood, P., Al-Jumaah, S., Raspall, M., da Silva Duarte, A. J., Tuerlinckx, D., Virelizier, J.-L., Fischer, A., Enright, A., Bernhoft, J., Cleary, A. M., Vermylen, C., Rodriguez-Gallego, C., Davies, G., Blutters-Sawatzki, R., Siegrist, C.-A., Ehlayel, M. S., Novelli, V., Haas, W. H., Levy, J., Freihorst, J., Al-Hajjar, S., Nadal, D., de Moraes Vasconcelos, D., Jeppsson, O., Kutukculer, N., Frecerova, K., Caragol, I., Lammas, D., Kumararatne, D. S., Abel, L., Casanova, J.-L.
(2003). Low Penetrance, Broad Resistance, and Favorable Outcome of Interleukin 12 Receptor {beta}1 Deficiency: Medical and Immunological Implications. JEM
197: 527-535
[Abstract][Full Text]
Majorov, K. B., Lyadova, I. V., Kondratieva, T. K., Eruslanov, E. B., Rubakova, E. I., Orlova, M. O., Mischenko, V. V., Apt, A. S.
(2003). Different Innate Ability of I/St and A/Sn Mice To Combat Virulent Mycobacterium tuberculosis: Phenotypes Expressed in Lung and Extrapulmonary Macrophages. Infect. Immun.
71: 697-707
[Abstract][Full Text]
Karplus, T. M., Jeronimo, S. M. B., Chang, H., Helms, B. K., Burns, T. L., Murray, J. C., Mitchell, A. A., Pugh, E. W., Braz, R. F. S., Bezerra, F. L., Wilson, M. E.
(2002). Association between the Tumor Necrosis Factor Locus and the Clinical Outcome of Leishmania chagasi Infection. Infect. Immun.
70: 6919-6925
[Abstract][Full Text]
Reuter, U., Roesler, J., Thiede, C., Schulz, A., Classen, C. F., Oelschlagel, U., Debatin, K.-M., Friedrich, W.
(2002). Correction of complete interferon-gamma receptor 1 deficiency by bone marrow transplantation. Blood
100: 4234-4235
[Abstract][Full Text]
Qin, Z., Kim, H.-J., Hemme, J., Blankenstein, T.
(2002). Inhibition of Methylcholanthrene-induced Carcinogenesis by an Interferon {gamma} Receptor-dependent Foreign Body Reaction. JEM
195: 1479-1490
[Abstract][Full Text]
Hickman, S. P., Chan, J., Salgame, P.
(2002). Mycobacterium tuberculosis Induces Differential Cytokine Production from Dendritic Cells and Macrophages with Divergent Effects on Naive T Cell Polarization. J. Immunol.
168: 4636-4642
[Abstract][Full Text]
van Crevel, R., Ottenhoff, T. H. M., van der Meer, J. W. M.
(2002). Innate Immunity to Mycobacterium tuberculosis. Clin. Microbiol. Rev.
15: 294-309
[Abstract][Full Text]
Olleros, M. L., Guler, R., Corazza, N., Vesin, D., Eugster, H.-P., Marchal, G., Chavarot, P., Mueller, C., Garcia, I.
(2002). Transmembrane TNF Induces an Efficient Cell-Mediated Immunity and Resistance to Mycobacterium bovis Bacillus Calmette-Guerin Infection in the Absence of Secreted TNF and Lymphotoxin-{alpha}. J. Immunol.
168: 3394-3401
[Abstract][Full Text]
Lang, R., Rutschman, R. L., Greaves, D. R., Murray, P. J.
(2002). Autocrine Deactivation of Macrophages in Transgenic Mice Constitutively Overexpressing IL-10 Under Control of the Human CD68 Promoter. J. Immunol.
168: 3402-3411
[Abstract][Full Text]
Abu-Nader, R., Terrell, C. L.
(2002). Mycobacterium bovis Vertebral Osteomyelitis as a Complication of Intravesical BCG Use. Mayo Clin Proc.
77: 393-397
[Abstract]
Engele, M., Castiglione, K., Schwerdtner, N., Wagner, M., Bolcskei, P., Rollinghoff, M., Stenger, S.
(2002). Induction of TNF in Human Alveolar Macrophages As a Potential Evasion Mechanism of Virulent Mycobacterium tuberculosis. J. Immunol.
168: 1328-1337
[Abstract][Full Text]
Szabo, S. J., Sullivan, B. M., Stemmann, C., Satoskar, A. R., Sleckman, B. P., Glimcher, L. H.
(2002). Distinct Effects of T-bet in TH1 Lineage Commitment and IFN-gamma Production in CD4 and CD8 T Cells. Science
295: 338-342
[Abstract][Full Text]
Panigada, M., Sturniolo, T., Besozzi, G., Boccieri, M. G., Sinigaglia, F., Grassi, G. G., Grassi, F.
(2002). Identification of a Promiscuous T-Cell Epitope in Mycobacterium tuberculosis Mce Proteins. Infect. Immun.
70: 79-85
[Abstract][Full Text]
Fritz, C., Maass, S., Kreft, A., Bange, F.-C.
(2002). Dependence of Mycobacterium bovis BCG on Anaerobic Nitrate Reductase for Persistence Is Tissue Specific. Infect. Immun.
70: 286-291
[Abstract][Full Text]
Fairbairn, I. P., Stober, C. B., Kumararatne, D. S., Lammas, D. A.
(2001). ATP-Mediated Killing of Intracellular Mycobacteria by Macrophages Is a P2X7-Dependent Process Inducing Bacterial Death by Phagosome-Lysosome Fusion. J. Immunol.
167: 3300-3307
[Abstract][Full Text]
Zeerleder, S., Hack, C. E., Caliezi, C., Hebeisen, R., Wuillemin, W. A.
(2001). Bacillus Calmette-Guerin sepsis: shift of an intended local toward a detrimental systemic cytotoxic immune response. Blood
98: 890-891
[Full Text]
Dupuis, S., Dargemont, C., Fieschi, C., Thomassin, N., Rosenzweig, S., Harris, J., Holland, S. M., Schreiber, R. D., Casanova, J.-L.
(2001). Impairment of Mycobacterial But Not Viral Immunity by a Germline Human STAT1 Mutation. Science
293: 300-303
[Abstract][Full Text]
Serbina, N. V., Flynn, J. L.
(2001). CD8+ T Cells Participate in the Memory Immune Response to Mycobacterium tuberculosis. Infect. Immun.
69: 4320-4328
[Abstract][Full Text]
Giacomini, E., Iona, E., Ferroni, L., Miettinen, M., Fattorini, L., Orefici, G., Julkunen, I., Coccia, E. M.
(2001). Infection of Human Macrophages and Dendritic Cells with Mycobacterium tuberculosis Induces a Differential Cytokine Gene Expression That Modulates T Cell Response. J. Immunol.
166: 7033-7041
[Abstract][Full Text]
Boechat, N., Bouchonnet, F., Bonay, M., Grodet, A., Pelicic, V., Gicquel, B., Hance, A. J.
(2001). Culture at High Density Improves the Ability of Human Macrophages to Control Mycobacterial Growth. J. Immunol.
166: 6203-6211
[Abstract][Full Text]
Sakai, T., Matsuoka, M., Aoki, M., Nosaka, K., Mitsuya, H.
(2001). Missense mutation of the interleukin-12 receptor {beta}1 chain-encoding gene is associated with impaired immunity against Mycobacterium avium complex infection. Blood
97: 2688-2694
[Abstract][Full Text]
Marquet, S., Schurr, E.
(2001). Genetics of Susceptibility to Infectious Diseases: Tuberculosis and Leprosy as Examples. Drug Metab. Dispos.
29: 479-483
[Full Text]
Villella, A., Picard, C., Jouanguy, E., Dupuis, S., Popko, S., Abughali, N., Meyerson, H., Casanova, J.-L., Hostoffer, R. W.
(2001). Recurrent Mycobacterium avium Osteomyelitis Associated With a Novel Dominant Interferon Gamma Receptor Mutation. Pediatrics
107: e47-e47
[Abstract][Full Text]
Fieschi, C., Dupuis, S., Picard, C., Smith, C. I. E., Holland, S. M., Casanova, J.-L.
(2001). High Levels of Interferon Gamma in the Plasma of Children With Complete Interferon Gamma Receptor Deficiency. Pediatrics
107: e48-e48
[Abstract][Full Text]
Rook, G.A.W., Seah, G., Ustianowski, A.
(2001). M. tuberculosis: immunology and vaccination. Eur Respir J
17: 537-557
[Abstract][Full Text]
Wigginton, J. E., Kirschner, D.
(2001). A Model to Predict Cell-Mediated Immune Regulatory Mechanisms During Human Infection with Mycobacterium tuberculosis. J. Immunol.
166: 1951-1967
[Abstract][Full Text]
Allende, L. M., Lopez-Goyanes, A., Paz-Artal, E., Corell, A., Garcia-Perez, M. A., Varela, P., Scarpellini, A., Negreira, S., Palenque, E., Arnaiz-Villena, A.
(2001). A Point Mutation in a Domain of Gamma Interferon Receptor 1 Provokes Severe Immunodeficiency. CVI
8: 133-137
[Abstract][Full Text]
Halloran, P. F., Afrouzian, M., Ramassar, V., Urmson, J., Zhu, L.-F., Helms, L. M. H., Solez, K., Kneteman, N. M.
(2001). Interferon-{{gamma}} Acts Directly on Rejecting Renal Allografts to Prevent Graft Necrosis. Am. J. Pathol.
158: 215-226
[Abstract][Full Text]
Skeiky, Y. A. W., Ovendale, P. J., Jen, S., Alderson, M. R., Dillon, D. C., Smith, S., Wilson, C. B., Orme, I. M., Reed, S. G., Campos-Neto, A.
(2000). T Cell Expression Cloning of a Mycobacterium tuberculosis Gene Encoding a Protective Antigen Associated with the Early Control of Infection. J. Immunol.
165: 7140-7149
[Abstract][Full Text]
Lekstrom-Himes, J. A., Gallin, J. I.
(2000). Immunodeficiency Diseases Caused by Defects in Phagocytes. NEJM
343: 1703-1714
[Full Text]
Thoma-Uszynski, S., Stenger, S., Modlin, R. L.
(2000). CTL-Mediated Killing of Intracellular Mycobacterium tuberculosis Is Independent of Target Cell Nuclear Apoptosis. J. Immunol.
165: 5773-5779
[Abstract][Full Text]
Lyadova, I. V., Eruslanov, E. B., Khaidukov, S. V., Yeremeev, V. V., Majorov, K. B., Pichugin, A. V., Nikonenko, B. V., Kondratieva, T. K., Apt, A. S.
(2000). Comparative Analysis of T Lymphocytes Recovered from the Lungs of Mice Genetically Susceptible, Resistant, and Hyperresistant to Mycobacterium tuberculosis-Triggered Disease. J. Immunol.
165: 5921-5931
[Abstract][Full Text]
Olakanmi, O., Britigan, B. E., Schlesinger, L. S.
(2000). Gallium Disrupts Iron Metabolism of Mycobacteria Residing within Human Macrophages. Infect. Immun.
68: 5619-5627
[Abstract][Full Text]
Dovhey, S. E., Ghosh, N. S., Wright, K. L.
(2000). Loss of Interferon-{{gamma}} Inducibility of TAP1 and LMP2 in a Renal Cell Carcinoma Cell Line. Cancer Res.
60: 5789-5796
[Abstract][Full Text]
Schwander, S. K., Torres, M., Carranza C, C., Escobedo, D., Tary-Lehmann, M., Anderson, P., Toossi, Z., Ellner, J. J., Rich, E. A., Sada, E.
(2000). Pulmonary Mononuclear Cell Responses to Antigens of Mycobacterium tuberculosis in Healthy Household Contacts of Patients with Active Tuberculosis and Healthy Controls from the Community. J. Immunol.
165: 1479-1485
[Abstract][Full Text]
TAKAHASHI, M., ISHIZAKA, A., NAKAMURA, H., KOBAYASHI, K., NAKAMURA, M., NAMIKI, M., SEKITA, T., OKAJIMA, S.
(2000). Specific HLA in Pulmonary MAC Infection in a Japanese Population. Am. J. Respir. Crit. Care Med.
162: 316-318
[Abstract][Full Text]
Nau, G. J., Chupp, G. L., Emile, J.-F., Jouanguy, E., Berman, J. S., Casanova, J.-L., Young, R. A.
(2000). Osteopontin Expression Correlates with Clinical Outcome in Patients with Mycobacterial Infection. Am. J. Pathol.
157: 37-42
[Abstract][Full Text]
Ehlers, S., Richter, E.
(2000). Gamma Interferon Is Essential for Clearing Mycobacterium genavense Infection. Infect. Immun.
68: 3720-3723
[Abstract][Full Text]
Alderson, M. R., Bement, T., Day, C. H., Zhu, L., Molesh, D., Skeiky, Y. A. W., Coler, R., Lewinsohn, D. M., Reed, S. G., Dillon, D. C.
(2000). Expression Cloning of an Immunodominant Family of Mycobacterium tuberculosis Antigens Using Human CD4+ T Cells. JEM
191: 551-560
[Abstract][Full Text]
TAKEI, Y., SIMS, T. N., URMSON, J., HALLORAN, P. F.
(2000). Central Role for Interferon-{gamma} Receptor in the Regulation of Renal MHC Expression. J. Am. Soc. Nephrol.
11: 250-261
[Abstract][Full Text]
Rigamonti, L., Ariotti, S., Losana, G., Gradini, R., Russo, M. A., Jouanguy, E., Casanova, J.-L., Forni, G., Novelli, F.
(2000). Surface Expression of the IFN-{gamma}R2 Chain Is Regulated by Intracellular Trafficking in Human T Lymphocytes. J. Immunol.
164: 201-207
[Abstract][Full Text]
Ahuja, S. S., Reddick, R. L., Sato, N., Montalbo, E., Kostecki, V., Zhao, W., Dolan, M. J., Melby, P. C., Ahuja, S. K.
(1999). Dendritic Cell (DC)-Based Anti-Infective Strategies: DCs Engineered to Secrete IL-12 Are a Potent Vaccine in a Murine Model of an Intracellular Infection. J. Immunol.
163: 3890-3897
[Abstract][Full Text]
Serbina, N. V., Flynn, J. L.
(1999). Early Emergence of CD8+ T Cells Primed for Production of Type 1 Cytokines in the Lungs of Mycobacterium tuberculosis-Infected Mice. Infect. Immun.
67: 3980-3988
[Abstract][Full Text]
Hoft, D. F., Tennant, J. M.
(1999). Persistence and Boosting of Bacille Calmette-Guerin-Induced Delayed-Type Hypersensitivity. ANN INTERN MED
131: 32-36
[Abstract][Full Text]
Florido, M., Goncalves, A. S., Silva, R. A., Ehlers, S., Cooper, A. M., Appelberg, R.
(1999). Resistance of Virulent Mycobacterium avium to Gamma Interferon-Mediated Antimicrobial Activity Suggests Additional Signals for Induction of Mycobacteriostasis. Infect. Immun.
67: 3610-3618
[Abstract][Full Text]
Tang, Y.-W., Mitchell, P. S., Espy, M. J., Smith, T. F., Persing, D. H.
(1999). Molecular Diagnosis of Herpes Simplex Virus Infections in the Central Nervous System. J. Clin. Microbiol.
37: 2127-2136
[Full Text]
Wilkinson, R. J., Patel, P., Llewelyn, M., Hirsch, C. S., Pasvol, G., Snounou, G., Davidson, R. N., Toossi, Z.
(1999). Influence of Polymorphism in the Genes for the Interleukin (IL)-1 Receptor Antagonist and IL-1beta on Tuberculosis. JEM
189: 1863-1874
[Abstract][Full Text]