| |||||||||||||||||||||||||||||||
In this report, we describe a patient with HCV-associated fulminant hepatitis in whom serial studies were done that provided a unique opportunity to establish a temporal association between the acquisition of HCV infection and the development of fulminant hepatitis and to define the clinical, virologic, and histologic profile of fulminant hepatitis C.
Case Report
A 68-year-old white man, who has been described previously,15 was admitted to Georgetown University Hospital in Washington, D.C., to undergo coronary-artery bypass grafting and aortic-valve replacement on March 21, 1990, about two months before the introduction of anti-HCV screening for blood donors. He was enrolled in a prospective study of post-transfusion non-A, non-B hepatitis being conducted at the National Institutes of Health at that time.16 He had no evidence of liver disease and had not received any transfusions in the previous six months (these were exclusion criteria for entry into the study).16 During surgery, the patient received a total of 39 units of red-cell concentrate, 15 units of platelets, 21 units of fresh-frozen plasma, and 2 units of plasma cryoprecipitate; no halothane was administered. He recovered quickly and was discharged seven days after surgery. He was readmitted four weeks later because of increasing malaise and nausea, at which time his serum alanine aminotransferase concentration was 4493 U per liter (it was 27 U per liter at the time of discharge). After readmission, icterus and progressive encephalopathy and coagulopathy developed, and the patient died in hepatic coma on the 11th hospital day, almost 7 weeks after surgery. His peak serum bilirubin concentration was 15 mg per deciliter (256 µmol per liter), and the longest prothrombin time was 70 seconds.
The diagnosis of fulminant hepatitis C was based on the assessment of clinical,17 virologic, and histologic measures. None of the medications that were administered to the patient were known to be hepatotoxic. Serial serum samples were tested for the presence and amount of HCV RNA, the HCV genotype, the degree of genetic heterogeneity within individual isolates, and the immune response to HCV. None of the serum samples had detectable levels of hepatitis B surface antigen, IgM antibodies against hepatitis A or hepatitis B core antigens, or antibodies against cytomegalovirus, EpsteinBarr virus, or the human immunodeficiency virus. To exclude the possibility of coinfection with HBV and hepatitis G virus (HGV), all serum samples were tested for the presence of HBV DNA and HGV RNA by the polymerase chain reaction (PCR), and all were negative.
Methods
Anti-HCV Testing
First- and second-generation enzyme immunoassays (Ortho Diagnostic Systems, Raritan, N.J.) were used to test for anti-HCV.
Detection, Titration, Genotyping, and Sequencing of HCV RNA
Total RNA extracted from 100 µl of serum by the guanidinium isothiocyanatephenolchloroform method18 was amplified by PCR with two sets of nested primers. The first set, derived from the 5' noncoding region,19 was used to investigate the course of HCV viremia, and the second set, from the E1 and E2 genes,19 including the hypervariable region 1,20 was used to determine the HCV genotype21 and the degree of variation within individual viral isolates. The sensitivity and specificity of this nested-PCR assay have been reported previously.18 The concentration of HCV RNA in serum was measured by the branched-chain DNA test with the Amplex Chiron assay (Chiron, Emeryville, Calif.).22
The PCR products derived from the E1 and E2 regions were analyzed both by direct sequencing, as previously described,19 and by sequencing of molecular clones. The amplified PCR products were also cloned into pGEM-T vector systems (Promega Biotech, Madison, Wis.), and 8 to 10 clones from each sample were sequenced with an automated DNA sequencer (model 373, Applied Biosystems, Foster City, Calif.) by a modified Sanger method.
Detection of Serum HGV RNA
Total RNA extracted from 100 µl of serum was amplified by PCR with primers derived from the putative fifth nonstructural region of the HGV genome, as previously reported.23 The PCR products were analyzed by dot blot hybridization with a 32P-labeled oligonucleotide probe.23
Detection of Serum HBV DNA
Serum HBV DNA was extracted,24 and PCR was performed with nested primers derived from the preS1 gene and the major S gene of the HBV genome. The outer primer pair consisted of F1 (5'GGGTGGAGCCCTCAGGCTCAGGGCA3'), starting at map position 1679, and F2 (5'GAAGATGAGGCATAGCAGCAGGAT3'), starting at map position 2254. The inner primer pair consisted of F3 (5'CCTCCTGCCTCCACCAAT3'), starting at map position 1730, and F4 (5'GAGGTTGGTGGTGAGTGATTG3'), starting at map position 2166.
Liver-Biopsy Studies and Immunohistochemical Staining for the Detection of HCV Antigen in the Liver
Liver tissue obtained at autopsy was stained for an HCV antigen encoded by the fourth nonstructural (ns4) gene; the percentage of cells that were antigen-positive was determined. Deparaffinized tissue sections were pretreated with protease XXIV solution and rinsed in TRIShydrochloric acid buffer. The sections were incubated for 30 minutes with a mouse monoclonal antibody against protein expressed from the NS4 region of the HCV genome (MA 292, Biogenex, San Ramon, Calif.). The sections were washed and then incubated with biotinylated antimouse antibody (HK 335-5K, Biogenex) for 30 minutes. The samples were rinsed, and a streptavidinphosphatase label (HK 331-5K, Biogenex) was applied, followed by a rinse and application of 6-bromo-2-hydroxy-3-naphtholic blue substrate solution. Fifteen minutes later, the sections were rinsed again and coverslips were applied with mounting medium.
Results
Serial serum samples were tested for the presence and concentration of HCV RNA and for anti-HCV. HCV viremia was not detected before or 1 week after transfusion, but it was detected in the next available sample, obtained 5 weeks after transfusion, when the patient was readmitted to the hospital, and remained detectable until the patient's death, 11 days later (Figure 1). Before surgery, anti-HCV antibodies were not detected in serum, but these antibodies were detected by a second-generation enzyme immunoassay one day before the patient's death. The level of HCV viremia, as measured by the branched-chain DNA test, increased in parallel with serum alanine aminotransferase concentrations to a peak value of more than 108 genome equivalents per milliliter, and then rapidly decreased below the level of sensitivity of this test, despite the fact that serum HCV RNA was continuously detected by PCR until the patient's death (Figure 1). No HBV or HGV sequences were detected in any of the serial samples tested. Postmortem examination revealed areas of submassive and massive necrosis of the liver (Figure 2A), and immunohistochemical staining for intrahepatic HCV NS4 antigen was positive in 20 percent of the residual liver cells (Figure 2B).
|
|
Discussion
The availability of serial serum samples from a patient in whom fulminant hepatic failure developed provided us with the opportunity to demonstrate a temporal association between HCV infection and the development of fulminant hepatitis. The appearance of viremia, followed by seroconversion, unequivocally indicated the acquisition of primary HCV infection. The longitudinal analysis and molecular studies allowed us to rule out the etiologic role of other hepatitis viruses, including HGV, a recently described hepatitis agent.23 In this patient, fulminant hepatitis C was associated with continuous replication of HCV. As previously documented in acute hepatitis C,18 the detection of serum HCV RNA was the earliest marker for the diagnosis of fulminant hepatitis C. In contrast, anti-HCV was detected only one day before the patient's death. This suggests that in fulminant hepatitis, because of the extremely rapid course of the disease, there may not always be sufficient time for the development of antibodies. The patient's persistent HCV viremia was a critical marker in the differential diagnosis of non-A, non-B fulminant hepatitis. On the basis of this finding, a negative test for HCV RNA in a patient with fulminant hepatitis makes it extremely unlikely that the patient has HCV infection, even in cases in which only a single serum sample is available for testing. By extension, we infer that the previously described cases of fulminant non-A, non-B hepatitis that tested negative for HCV by PCR were probably unrelated to HCV infection. Whether these cases were due to unidentified infectious agents or, as recently proposed,4 to noninfectious hepatotoxic agents is not known.
In our patient, fulminant hepatitis C was characterized by high levels of viremia. Although the pathogenetic mechanism of virally induced fulminant hepatic failure is not known, the extent of liver damage correlated with the magnitude of viral replication in the absence of detectable antibodies. In contrast, in patients with fulminant hepatitis B, HBV replication is barely detectable or is undetectable, and antibody titers are high.25 This suggests that the mechanisms of fulminant liver injury differ in the two types of hepatitis. In viral isolates from our patient, we found a remarkably low degree of diversity, whereas in chronic hepatitis C there is considerable diversity.26 This finding may reflect a lack of selective pressure on the viral population because there is insufficient time for the development of a specific immune response in this rapidly evolving syndrome.
Although the temporal association between the acquisition of HCV infection and the development of fulminant hepatitis in this patient suggests that HCV was the causative agent, we cannot exclude the role of nonviral factors. Nevertheless, the incidence of post-transfusion fulminant hepatitis associated with major surgical operations is exceedingly low.27 Among more than 100 prospectively followed transfusion recipients in whom non-A, non-B hepatitis developed after major surgery, this patient was the only one in whom fulminant hepatitis developed.27 Thus, it is very unlikely that intraoperative factors were responsible for the fulminant hepatic failure.
In summary, HCV can cause fulminant hepatic failure. The disease is characterized by continuous viral replication. The detection of serum HCV RNA by PCR is the earliest and most valuable marker for the diagnosis of fulminant hepatitis C.
Presented in part at the Annual Meeting of the American Association for the Study of Liver Diseases, Chicago, November 1115, 1994.
Source Information
From the Hepatitis Viruses Section, Laboratory of Infectious Diseases, National Institute of Allergy and Infectious Diseases (P.F., A.S., R.H.P.), and the Department of Transfusion Medicine, Warren G. Magnuson Clinical Center (H.J.A., L.C.C., J.C.M., J.W.S.), National Institutes of Health, Bethesda, Md.; the Department of Pathology, Rancho Los Amigos Medical Center, Downey, Calif. (S.G.); and the Division of Clinical and Laboratory Service, Georgetown Medical Center, Washington, D.C. (R.A.S.).
Address reprint requests to Dr. Farci at the Istituto di Medicina Interna, University of Cagliari, Via San Giorgio 12, 09124 Cagliari, Italy.
References
| |||||||||||||||||||||||||||||||
This article has been cited by other articles:
HOME | SUBSCRIBE | SEARCH | CURRENT ISSUE | PAST ISSUES | COLLECTIONS | PRIVACY | TERMS OF USE | HELP | beta.nejm.org Comments and questions? Please contact us. The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved. |