The New England Journal of Medicine
e-mail icon  FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |    Advanced Search
Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe
 
Original Article
Brief Report
PreviousPrevious
Volume 335:631-634 August 29, 1996 Number 9
NextNext

Hepatitis C Virus–Associated Fulminant Hepatic Failure
Patrizia Farci, M.D., Harvey J. Alter, M.D., Atsushi Shimoda, M.D., Sugantha Govindarajan, M.D., Ling C. Cheung, M.D., Jacqueline C. Melpolder, B.Sc., Ronald A. Sacher, M.D., James W. Shih, Ph.D., and Robert H. Purcell, M.D.

 

This Article
- PDF

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation
Fulminant hepatic failure is a dramatic clinical syndrome characterized by massive necrosis of liver cells.1 It is most often caused by hepatitis A virus and hepatitis B virus (HBV)2; whether hepatitis C virus (HCV) can cause it is still controversial.3,4 Among patients with non-A, non-B fulminant hepatitis, antibodies against HCV (anti-HCV) or serum HCV RNA were found in 40 to 60 percent in Japan5,6 and Taiwan,7 but in only 2 percent (range, 0 to 12 percent) in Western countries,8,9,10,11,12,13 with one exception: a recent study conducted in California reported a prevalence of 60 percent associated with low socioeconomic status and Hispanic ethnicity.14 Whether these discrepancies reflect geographic differences in the epidemiology of HCV infection or the pathogenicity of the prevalent viral strains is not known. Furthermore, because of the dramatic course of fulminant hepatic failure, in most patients only a single serum sample, often obtained late in the course of the disease, was studied.

In this report, we describe a patient with HCV-associated fulminant hepatitis in whom serial studies were done that provided a unique opportunity to establish a temporal association between the acquisition of HCV infection and the development of fulminant hepatitis and to define the clinical, virologic, and histologic profile of fulminant hepatitis C.

Case Report

A 68-year-old white man, who has been described previously,15 was admitted to Georgetown University Hospital in Washington, D.C., to undergo coronary-artery bypass grafting and aortic-valve replacement on March 21, 1990, about two months before the introduction of anti-HCV screening for blood donors. He was enrolled in a prospective study of post-transfusion non-A, non-B hepatitis being conducted at the National Institutes of Health at that time.16 He had no evidence of liver disease and had not received any transfusions in the previous six months (these were exclusion criteria for entry into the study).16 During surgery, the patient received a total of 39 units of red-cell concentrate, 15 units of platelets, 21 units of fresh-frozen plasma, and 2 units of plasma cryoprecipitate; no halothane was administered. He recovered quickly and was discharged seven days after surgery. He was readmitted four weeks later because of increasing malaise and nausea, at which time his serum alanine aminotransferase concentration was 4493 U per liter (it was 27 U per liter at the time of discharge). After readmission, icterus and progressive encephalopathy and coagulopathy developed, and the patient died in hepatic coma on the 11th hospital day, almost 7 weeks after surgery. His peak serum bilirubin concentration was 15 mg per deciliter (256 µmol per liter), and the longest prothrombin time was 70 seconds.

The diagnosis of fulminant hepatitis C was based on the assessment of clinical,17 virologic, and histologic measures. None of the medications that were administered to the patient were known to be hepatotoxic. Serial serum samples were tested for the presence and amount of HCV RNA, the HCV genotype, the degree of genetic heterogeneity within individual isolates, and the immune response to HCV. None of the serum samples had detectable levels of hepatitis B surface antigen, IgM antibodies against hepatitis A or hepatitis B core antigens, or antibodies against cytomegalovirus, Epstein–Barr virus, or the human immunodeficiency virus. To exclude the possibility of coinfection with HBV and hepatitis G virus (HGV), all serum samples were tested for the presence of HBV DNA and HGV RNA by the polymerase chain reaction (PCR), and all were negative.

Methods

Anti-HCV Testing

First- and second-generation enzyme immunoassays (Ortho Diagnostic Systems, Raritan, N.J.) were used to test for anti-HCV.

Detection, Titration, Genotyping, and Sequencing of HCV RNA

Total RNA extracted from 100 µl of serum by the guanidinium isothiocyanate–phenol–chloroform method18 was amplified by PCR with two sets of nested primers. The first set, derived from the 5' noncoding region,19 was used to investigate the course of HCV viremia, and the second set, from the E1 and E2 genes,19 including the hypervariable region 1,20 was used to determine the HCV genotype21 and the degree of variation within individual viral isolates. The sensitivity and specificity of this nested-PCR assay have been reported previously.18 The concentration of HCV RNA in serum was measured by the branched-chain DNA test with the Amplex Chiron assay (Chiron, Emeryville, Calif.).22

The PCR products derived from the E1 and E2 regions were analyzed both by direct sequencing, as previously described,19 and by sequencing of molecular clones. The amplified PCR products were also cloned into pGEM-T vector systems (Promega Biotech, Madison, Wis.), and 8 to 10 clones from each sample were sequenced with an automated DNA sequencer (model 373, Applied Biosystems, Foster City, Calif.) by a modified Sanger method.

Detection of Serum HGV RNA

Total RNA extracted from 100 µl of serum was amplified by PCR with primers derived from the putative fifth nonstructural region of the HGV genome, as previously reported.23 The PCR products were analyzed by dot blot hybridization with a 32P-labeled oligonucleotide probe.23

Detection of Serum HBV DNA

Serum HBV DNA was extracted,24 and PCR was performed with nested primers derived from the preS1 gene and the major S gene of the HBV genome. The outer primer pair consisted of F1 (5'GGGTGGAGCCCTCAGGCTCAGGGCA3'), starting at map position 1679, and F2 (5'GAAGATGAGGCATAGCAGCAGGAT3'), starting at map position 2254. The inner primer pair consisted of F3 (5'CCTCCTGCCTCCACCAAT3'), starting at map position 1730, and F4 (5'GAGGTTGGTGGTGAGTGATTG3'), starting at map position 2166.

Liver-Biopsy Studies and Immunohistochemical Staining for the Detection of HCV Antigen in the Liver

Liver tissue obtained at autopsy was stained for an HCV antigen encoded by the fourth nonstructural (ns4) gene; the percentage of cells that were antigen-positive was determined. Deparaffinized tissue sections were pretreated with protease XXIV solution and rinsed in TRIS–hydrochloric acid buffer. The sections were incubated for 30 minutes with a mouse monoclonal antibody against protein expressed from the NS4 region of the HCV genome (MA 292, Biogenex, San Ramon, Calif.). The sections were washed and then incubated with biotinylated antimouse antibody (HK 335-5K, Biogenex) for 30 minutes. The samples were rinsed, and a streptavidin–phosphatase label (HK 331-5K, Biogenex) was applied, followed by a rinse and application of 6-bromo-2-hydroxy-3-naphtholic blue substrate solution. Fifteen minutes later, the sections were rinsed again and coverslips were applied with mounting medium.

Results

Serial serum samples were tested for the presence and concentration of HCV RNA and for anti-HCV. HCV viremia was not detected before or 1 week after transfusion, but it was detected in the next available sample, obtained 5 weeks after transfusion, when the patient was readmitted to the hospital, and remained detectable until the patient's death, 11 days later (Figure 1). Before surgery, anti-HCV antibodies were not detected in serum, but these antibodies were detected by a second-generation enzyme immunoassay one day before the patient's death. The level of HCV viremia, as measured by the branched-chain DNA test, increased in parallel with serum alanine aminotransferase concentrations to a peak value of more than 108 genome equivalents per milliliter, and then rapidly decreased below the level of sensitivity of this test, despite the fact that serum HCV RNA was continuously detected by PCR until the patient's death (Figure 1). No HBV or HGV sequences were detected in any of the serial samples tested. Postmortem examination revealed areas of submassive and massive necrosis of the liver (Figure 2A), and immunohistochemical staining for intrahepatic HCV NS4 antigen was positive in 20 percent of the residual liver cells (Figure 2B).


View larger version (5K):
[in this window]
[in a new window]
 
Figure 1. Biochemical, Serologic, and Molecular Profiles of Fulminant Hepatitis C in a Patient Who Acquired HCV Infection after Blood Transfusion for Heart Surgery.

Open bars indicate negative assays for serum HCV RNA by PCR, and solid bars positive assays. A logarithmic scale is used to show the titer of serum HCV RNA; the horizontal line indicates the limit of sensitivity of the assay. Anti-HCV was detected by a second-generation enzyme immunoassay one day before the patient's death.

 


View larger version (35K):
[in this window]
[in a new window]
 
Figure 2. Photomicrographs of a Liver-Biopsy Specimen from a Patient with Fulminant Hepatitis C.

Panel A shows areas of submassive and massive hepatic necrosis (Masson's trichrome stain, x59). The three portal tracts are close to collapsed reticulin, and there are no viable intervening hepatocytes. Islands of viable hepatocytes are seen in other lobules. Panel B shows positive (red) staining for HCV NS4 antigen within the cytoplasm of the residual liver cells on immunohistochemical analysis with a monoclonal antibody against HCV NS4 peptide (x297).

 
The genotype of the HCV strain recovered from this patient was 1b. Direct sequencing of 525 nucleotides derived from the E1 and E2 genes showed that the two viral isolates recovered during the course of the disease, at week 5 and just before death 11 days later, were identical. Sequencing of molecular clones confirmed that the viral strain was the same but revealed the presence of genetic heterogeneity within each of the two isolates. Comparative sequence analysis of 18 clones showed the presence of 11 closely related viral variants, each differing from the consensus sequence by only one or two amino acids (data not shown).

Discussion

The availability of serial serum samples from a patient in whom fulminant hepatic failure developed provided us with the opportunity to demonstrate a temporal association between HCV infection and the development of fulminant hepatitis. The appearance of viremia, followed by seroconversion, unequivocally indicated the acquisition of primary HCV infection. The longitudinal analysis and molecular studies allowed us to rule out the etiologic role of other hepatitis viruses, including HGV, a recently described hepatitis agent.23 In this patient, fulminant hepatitis C was associated with continuous replication of HCV. As previously documented in acute hepatitis C,18 the detection of serum HCV RNA was the earliest marker for the diagnosis of fulminant hepatitis C. In contrast, anti-HCV was detected only one day before the patient's death. This suggests that in fulminant hepatitis, because of the extremely rapid course of the disease, there may not always be sufficient time for the development of antibodies. The patient's persistent HCV viremia was a critical marker in the differential diagnosis of non-A, non-B fulminant hepatitis. On the basis of this finding, a negative test for HCV RNA in a patient with fulminant hepatitis makes it extremely unlikely that the patient has HCV infection, even in cases in which only a single serum sample is available for testing. By extension, we infer that the previously described cases of fulminant non-A, non-B hepatitis that tested negative for HCV by PCR were probably unrelated to HCV infection. Whether these cases were due to unidentified infectious agents or, as recently proposed,4 to noninfectious hepatotoxic agents is not known.

In our patient, fulminant hepatitis C was characterized by high levels of viremia. Although the pathogenetic mechanism of virally induced fulminant hepatic failure is not known, the extent of liver damage correlated with the magnitude of viral replication in the absence of detectable antibodies. In contrast, in patients with fulminant hepatitis B, HBV replication is barely detectable or is undetectable, and antibody titers are high.25 This suggests that the mechanisms of fulminant liver injury differ in the two types of hepatitis. In viral isolates from our patient, we found a remarkably low degree of diversity, whereas in chronic hepatitis C there is considerable diversity.26 This finding may reflect a lack of selective pressure on the viral population because there is insufficient time for the development of a specific immune response in this rapidly evolving syndrome.

Although the temporal association between the acquisition of HCV infection and the development of fulminant hepatitis in this patient suggests that HCV was the causative agent, we cannot exclude the role of nonviral factors. Nevertheless, the incidence of post-transfusion fulminant hepatitis associated with major surgical operations is exceedingly low.27 Among more than 100 prospectively followed transfusion recipients in whom non-A, non-B hepatitis developed after major surgery, this patient was the only one in whom fulminant hepatitis developed.27 Thus, it is very unlikely that intraoperative factors were responsible for the fulminant hepatic failure.

In summary, HCV can cause fulminant hepatic failure. The disease is characterized by continuous viral replication. The detection of serum HCV RNA by PCR is the earliest and most valuable marker for the diagnosis of fulminant hepatitis C.

Presented in part at the Annual Meeting of the American Association for the Study of Liver Diseases, Chicago, November 11–15, 1994.


Source Information

From the Hepatitis Viruses Section, Laboratory of Infectious Diseases, National Institute of Allergy and Infectious Diseases (P.F., A.S., R.H.P.), and the Department of Transfusion Medicine, Warren G. Magnuson Clinical Center (H.J.A., L.C.C., J.C.M., J.W.S.), National Institutes of Health, Bethesda, Md.; the Department of Pathology, Rancho Los Amigos Medical Center, Downey, Calif. (S.G.); and the Division of Clinical and Laboratory Service, Georgetown Medical Center, Washington, D.C. (R.A.S.).

Address reprint requests to Dr. Farci at the Istituto di Medicina Interna, University of Cagliari, Via San Giorgio 12, 09124 Cagliari, Italy.

References

  1. Bernuau J, Rueff B, Benhamou JP. Fulminant and subfulminant liver failure: definitions and causes. Semin Liver Dis 1986;6:97-106. [Medline]
  2. Sherlock S. Fulminant hepatic failure. Adv Intern Med 1993;38:245-267. [Medline]
  3. Lee WM. Acute liver failure. N Engl J Med 1993;329:1862-1872. [Erratum, N Engl J Med 1994;330:584.] [Free Full Text]
  4. Wright TL. Etiology of fulminant hepatic failure: is another virus involved? Gastroenterology 1993;104:640-643. [Medline]
  5. Muto Y, Sugihara J, Ohnishi H, Moriwaki H, Nishioka K. Anti-hepatitis C virus antibody prevails in fulminant hepatic failure. Gastroenterol Jpn 1990;25:32-35. [Medline]
  6. Yanagi M, Kaneko S, Unoura M, et al. Hepatitis C virus in fulminant hepatic failure. N Engl J Med 1991;324:1895-1896. [Medline]
  7. Chu CM, Sheen IS, Liaw YF. The role of hepatitis C virus in fulminant viral hepatitis in an area with endemic hepatitis A and B. Gastroenterology 1994;107:189-195. [Medline]
  8. Wright TL, Hsu H, Donegan E, et al. Hepatitis C virus not found in fulminant non-A, non-B hepatitis. Ann Intern Med 1991;115:111-112.
  9. Theilmann L, Solbach C, Toex U, et al. Role of hepatitis C virus infection in German patients with fulminant and subacute hepatic failure. Eur J Clin Invest 1992;22:569-571. [Medline]
  10. Feray C, Gigou M, Samuel D, et al. Hepatitis C virus RNA and hepatitis B virus DNA in serum and liver of patients with fulminant hepatitis. Gastroenterology 1993;104:549-555. [Medline]
  11. Liang TJ, Jeffers L, Reddy RK, et al. Fulminant or subfulminant non-A, non-B viral hepatitis: the role of hepatitis C and E viruses. Gastroenterology 1993;104:556-562. [Medline]
  12. Kuwada SK, Patel VM, Hollinger FB, et al. Non-A, non-B fulminant hepatitis is also non-E and non-C. Am J Gastroenterol 1994;89:57-61. [Medline]
  13. Sallie R, Silva AE, Purdy M, et al. Hepatitis C and E in non-A non-B fulminant hepatic failure: a polymerase chain reaction and serological study. J Hepatol 1994;20:580-588. [CrossRef][Medline]
  14. Villamil FG, Hu KQ, Yu CH, et al. Detection of hepatitis C virus with RNA polymerase chain reaction in fulminant hepatic failure. Hepatology 1995;22:1379-1386. [CrossRef][Medline]
  15. Sacher RA, Melpolder JJ. Hepatitis C virus and fulminant hepatitis. Ann Intern Med 1991;115:984-985. 
  16. Koziol DE, Holland PV, Alling DW, et al. Antibody to hepatitis B core antigen as a paradoxical marker for non-A, non-B hepatitis agents in donated blood. Ann Intern Med 1986;104:488-495.
  17. Trey C, Davidson CS. The management of fulminant hepatic failure. Prog Liver Dis 1970;3:282-298. [Medline]
  18. Farci P, Alter HJ, Wong D, et al. A long-term study of hepatitis C virus replication in non-A, non-B hepatitis. N Engl J Med 1991;325:98-104. [Abstract]
  19. Farci P, Alter HJ, Govindarajan S, et al. Lack of protective immunity against reinfection with hepatitis C virus. Science 1992;258:135-140. [Free Full Text]
  20. Weiner AJ, Brauer MJ, Rosenblatt J, et al. Variable and hypervariable domains are found in the regions of HCV corresponding to the flavivirus envelope and NS1 proteins and the pestivirus envelope glycoproteins. Virology 1991;180:842-848. [CrossRef][Medline]
  21. Bukh J, Purcell RH, Miller RH. At least 12 genotypes of hepatitis C virus predicted by sequence analysis of the putative E1 gene of isolates collected worldwide. Proc Natl Acad Sci U S A 1993;90:8234-8238. [Free Full Text]
  22. Alter HJ, Sanchez-Pescador R, Urdea MS, et al. Evaluation of branched DNA signal amplification for the detection of hepatitis C virus RNA. J Viral Hepat 1995;2:121-132. [Medline]
  23. Linnen J, Wages J Jr, Zhang-Keck Z-Y, et al. Molecular cloning and disease association of hepatitis G virus: a transfusion-transmissible agent. Science 1996;271:505-508. [Abstract]
  24. Shih JW, Cheung LC, Alter HJ, Lee LM, Gu JR. Strain analysis of hepatitis B virus on the basis of restriction endonuclease analysis of polymerase chain reaction products. J Clin Microbiol 1991;29:1640-1644. [Free Full Text]
  25. Brechot C, Bernuau J, Thiers V, et al. Multiplication of hepatitis B virus in fulminant hepatitis B. BMJ 1984;288:270-271.
  26. Martell M, Esteban JI, Quer J, et al. Hepatitis C virus (HCV) circulates as a population of different but closely related genomes: quasispecies nature of HCV genome distribution. J Virol 1992;66:3225-3229. [Free Full Text]
  27. Alter HJ. To C or not to C: these are the questions. Blood 1995;85:1681-1695. [Free Full Text]

 

This Article
- PDF

Tools and Services
-Add to Personal Archive
-Add to Citation Manager
-Notify a Friend
-E-mail When Cited

More Information
-PubMed Citation

This article has been cited by other articles:



HOME  |  SUBSCRIBE  |  SEARCH  |  CURRENT ISSUE  |  PAST ISSUES  |  COLLECTIONS  |  PRIVACY  |  TERMS OF USE  |  HELP  |  beta.nejm.org

Comments and questions? Please contact us.

The New England Journal of Medicine is owned, published, and copyrighted © 2009 Massachusetts Medical Society. All rights reserved.