FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 335:635-638 August 29, 1996 Number 9 Next

PDF Letters Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

In the United States, the hemolytic–uremic syndrome of childhood typically follows gastrointestinal infection with Escherichia coli O157:H7.^1,2,3 It is presumed that the absorption from the gastrointestinal tract of Shiga toxins 1, 2, or both (formerly called Shiga-like toxins⁴) produced by E. coli O157:H7 causes microangiopathic hemolytic anemia as a result of endothelial-cell injury.⁵ Shiga-toxin–producing E. coli belonging to serotypes other than O157:H7 can also cause the hemolytic–uremic syndrome.^5,6 However, even though such organisms have been implicated as causes of sporadic cases⁷ or outbreaks⁸ of gastroenteritis, they are not believed to be important causes of the hemolytic–uremic syndrome in this country.

The hemolytic–uremic syndrome occasionally follows urinary tract infections.^{9,10,11,12,13,14} In two cases, the syndrome was atypical: it was recurrent in one case⁹ and associated with familial hypocomplementemia in another.¹⁰ In two other reports that associated the hemolytic–uremic syndrome with urinary tract infection, E. coli O157:H7 was recovered from the urine of one child with hemorrhagic colitis and cystitis,¹³ and Shiga-toxin–producing E. coli O17:H18 was recovered from the urine and blood of a child with antecedent diarrhea.¹⁴

We describe a child who had the hemolytic–uremic syndrome but no prodromal diarrhea after a nonbacteremic urinary tract infection with E. coli O103:H2 that produced Shiga toxin 1. We also describe the characteristics of the infecting organism.

Case Report

A previously healthy six-year-old girl was seen after eight hours of abdominal and left-flank pain, vomiting, and dysuria. Constipation had been treated by enema on the preceding day. The child had not had diarrhea during the two weeks before evaluation.

On examination, the patient had an oral temperature of 39.8°C, a pulse rate of 120 per minute, and a blood pressure of 111/59 mm Hg. There was tenderness of the suprapubic area and left costovertebral angle. The white-cell count was 23,400 per cubic millimeter (58 percent neutrophils, 23 percent band forms, 9 percent lymphocytes, and 10 percent monocytes), the hematocrit was 40 percent, and the platelet count was 293,000 per cubic millimeter. Morphologic analysis of erythrocytes demonstrated no abnormalities. The blood urea nitrogen concentration was 18 mg per deciliter (6.4 mmol per liter), and the serum creatinine concentration was 0.5 mg per deciliter (44 µmol per liter). Urine obtained by catheterization had a specific gravity of 1.028 and a ph of 5, and dipstick analysis was positive for leukocyte esterase (++), protein (++), ketones (++), and blood (+++). The urinary sediment contained 21 to 100 red cells, more than 100 white cells, 1 to 5 renal tubular cells, and 1 to 5 granular casts per high-power field. Many bacteria were observed by microscopy. Abdominal ultrasonography demonstrated attenuation of fat and a probable collection of fluid around the left kidney; the right kidney was normal. Blood was obtained for culture before treatment with ceftriaxone was begun.

The patient was admitted to the hospital with a diagnosis of pyelonephritis. On the next day, the urine culture was reported as growing pure E. coli at a concentration of more than 10⁵ colony-forming units per milliliter. Treatment was changed to ampicillin, in accordance with the antibiotic susceptibilities of the urinary isolate. Hydration and intravenous antibiotic therapy initially produced improvement, but on the second hospital day nonbloody diarrhea began and abdominal pain and vomiting recurred. A simultaneous laboratory evaluation demonstrated persistent leukocytosis (27,100 white cells per cubic millimeter, with 86 percent neutrophils, 3 percent band forms, 6 percent lymphocytes, and 5 percent monocytes), anemia (hematocrit of 30 percent), and thrombocytopenia (34,000 platelets per cubic millimeter). Erythrocyte fragments were seen on a blood smear. The prothrombin time, activated partial-thromboplastin time, and circulating d-dimer concentration were normal. The blood urea nitrogen concentration was 17 mg per deciliter (6.1 mmol per liter), but the serum creatinine concentration had risen to 1.0 mg per deciliter (88 µmol per liter). Stool was obtained for bacterial culture (including screening for campylobacter, E. coli O157:H7, salmonella, shigella, and yersinia) and an assay for Clostridium difficile toxin. Cultures of blood and urine were also repeated.

During the next 48 hours, progressive microangiopathic hemolytic anemia, thrombocytopenia, and uremia developed, without evidence of consumptive coagulopathy, thereby establishing a diagnosis of the hemolytic–uremic syndrome. Both blood cultures and the second urine culture remained sterile. The stool culture did not yield enteric pathogens, and fecal C. difficile toxin was not detected. The patient required 11 days of hemodialysis for oliguria, hypertension, and uremia, and erythrocyte and platelet transfusions for severe anemia and thrombocytopenia. Parenteral ampicillin was continued. Ultrasonography on hospital day 15 revealed a marginated lesion 15 mm in diameter in the lower pole of the left kidney, consistent with the occurrence of infarction or abscess; both kidneys had echogenic changes characteristic of the hemolytic–uremic syndrome.

The patient was sent home after 20 days of hospitalization. A voiding cystourethrogram was normal three weeks later, and ultrasonography six weeks after discharge demonstrated that the focal abnormality in the left kidney had resolved. As of this writing, two years later, the patient has normal blood urea nitrogen and serum creatinine concentrations, iothalamate clearance, and blood pressure, and her urine is free of protein and blood. She has not had a recurrence of either a urinary tract infection or the hemolytic–uremic syndrome.

Characteristics of the Infecting Strain

The urinary tract isolate was identified as E. coli serotype O103:H2 (Figure 1A, Figure 1B, Figure 1C, Figure 1D, Figure 1E, Figure 1F. This isolate ferments sorbitol when plated on sorbitol MacConkey agar, is hemolytic¹⁵ and cytotoxic for Vero cells,¹⁶ adheres to HeLa cells in a localized pattern (Figure 1B), and induces actin aggregation in the cells to which it adheres (Figure 1E).^7,17 This strain does not agglutinate galactose 1-4galactose–coated beads or sheep or human erythrocytes,^18,19 nor does it possess sequences homologous to the pap operon or the Dr-receptor–recognizing family of adhesins.^19,20

View larger version (82K): [in this window] [in a new window]   Figure 1. Adherence of Various Strains of E. coli to HeLa Cells. Nontoxigenic, enteropathogenic E. coli O111:NM (Panel A) and E. coli O103:H2, which was isolated from the patient's urinary tract (Panel B), adhere to epithelial cells in a localized pattern, whereas E. coli HB101 (Panel C) is nonadherent, as demonstrated by Giemsa staining (x1005). Actin aggregates are present at the site of adherence of bacterial microcolonies to HeLa cells incubated with E. coli O111:NM (Panel D) and E. coli O103:H2, which was isolated from the patient's urinary tract (Panel E), as demonstrated by fluorescein–phalloidin staining (x635).17 HeLa cells incubated with E. coli HB101 do not have any actin aggregates (Panel F, x635).

 
The infecting strain contains stx1, encoding Shiga toxin 1, as evidenced by Southern hybridization under stringent conditions²¹ of the stx1 probe²² to a 9-kb EcoRI fragment of the bacterial DNA. The stx2 probe²² (encoding Shiga toxin 2) failed to hybridize to sequences in the bacterial DNA. Furthermore, primers specific for stx1 (5'GAAGAGTCCGTGGGATTACG3' and 5'AGCGATGCAGCTATTAATAA3') amplified a fragment of 130 base pairs, whereas stx2-specific primers (5'TTAACCACACCCACGGCAGT3' and 5'GCTCTGGATGCATCTCTGGT3') failed to amplify any stx2 sequences.²³ Southern hybridization also showed that this strain of E. coli O103:H2 possesses eaeA, encoding intimin,²⁴ a bacterial protein that mediates the effacement of enterocytes by attached enteropathogenic E. coli.

Discussion

A strain of E. coli O103:H2 producing Shiga toxin 1 was recovered from the urine of a six-year-old girl one day before the first laboratory evidence of the hemolytic–uremic syndrome appeared. Since there was no antecedent diarrhea, it is probable that urinary Shiga-toxin–producing E. coli O103:H2 produced the absorbed toxin that precipitated the syndrome. Diarrhea, which began at the same time as microangiopathic changes were observed on a blood smear, was more likely to have been a side effect of the broad-spectrum antibiotic used to treat the urinary tract infection than of gastrointestinal infection due to Shiga-toxin–producing E. coli. The demonstration of Shiga-toxin–producing E. coli in the urinary system in the absence of bacteremia or diarrhea before the onset of the hemolytic–uremic syndrome suggests that the human uroepithelium, like the gastrointestinal mucosa, might permit the absorption of Shiga toxin 1. Ultrasonography and voiding cystourethrography revealed no anatomical abnormalities that would predispose the patient to urinary stasis. However, the possible abscess in the lower pole of the left kidney might have provided a portal of entry for the toxin. Although it is unlikely given the sequence of events, we cannot exclude with certainty a gastrointestinal source of the absorbed toxin, because the microbiologic analysis of the stool on the second hospital day would not have detected sorbitol-fermenting E. coli O103:H2, since assays for fecal Shiga toxin or an analysis of recovered E. coli for toxigenicity was not performed.

This case demonstrates that the hemolytic–uremic syndrome can be caused by Shiga-toxin–producing E. coli other than E. coli O157:H7 in the United States. The serotype and toxin genotype of the urinary E. coli O103:H2 isolate are identical to those of strains associated with sporadic postdiarrheal hemolytic–uremic syndrome in France.²⁵ However, the toxin genotype of this urinary isolate contrasts with that of E. coli O157:H7, which almost always contains genes encoding Shiga toxin 2, especially strains recovered from patients with the hemolytic–uremic syndrome.²⁶ In the United States, Shiga-toxin–producing E. coli O103:H2 has been isolated from cultures of feces in cattle.^27,28 The recovery of E. coli O103:H2 from our patient suggests that E. coli O103:H2 might emerge as a pathogen in North America.

The ability of the infecting strain to adhere to epithelial cells in a localized pattern and to induce the aggregation of actin in cells to which it adheres are cardinal virulence traits of enteropathogenic E. coli (Figure 1A and Figure 1D),²⁹ and of E. coli O157:H7. Indeed, diarrhea was observed in French children infected with E. coli O103:H2²⁵ and in Italian children with the hemolytic–uremic syndrome whose serum contained antibodies against E. coli O103 lipopolysaccharide.³⁰ It is impossible to identify the sorbitol-fermenting strain of E. coli O103:H2 in a stool culture with techniques that identify E. coli O157:H7, which rely on screening with sorbitol MacConkey agar followed by determination of the O157 antigen. Although the infecting E. coli O103:H2 isolate was identified with ease in a urine specimen obtained by catheterization, this organism would probably have been interpreted by microbiology laboratories as belonging to the normal gastrointestinal flora had it been present in a stool specimen, and would not have been subjected to cytotoxicity assays (cell culture) or DNA hybridization analysis (gene probing or the polymerase chain reaction), since these studies are usually performed only in reference laboratories. New assays,^31,32 which rapidly and specifically identify Shiga toxins produced by fecal E. coli by exploiting the binding of these toxins to globotriaosylceramide, should increase the ability of clinical microbiology laboratories to identify these enteric pathogens.

Supported by an American Gastroenterological Association/Blackwell Scientific Publications Research Scholar Award (to Dr. Tarr), the Edwin Beer Foundation of the New York Academy of Medicine, and a grant (AI01115) from the National Institutes of Health (to Dr. Stapleton).

We are indebted to Christine A. Merrikin for secretarial assistance, to Kimberly Seebart and Mike Davis for technical assistance, and to Dr. Niki Becker for translating the paper by Lavocat et al.¹²

Source Information

From the Children's Hospital and Medical Center, Seattle (P.I.T., L.S.F., H.H.K., J.C.V., C.R.C.); the Departments of Pediatrics (P.I.T., L.S.F.), Microbiology (P.I.T.), Medicine (A.E.S.), and Laboratory Medicine (C.R.C.), University of Washington School of Medicine, Seattle; and the Department of Veterinary Sciences and the Institute of Molecular Evolutionary Genetics, Pennsylvania State University, University Park (R.A.W.).

Address reprint requests to Dr. Tarr at the Division of Gastroenterology, Mail Stop CH-24, Children's Hospital and Medical Center, 4800 Sand Point Way NE, Seattle, WA 98105.

References

1. Tarr PI, Neill MA, Clausen CR, Watkins SL, Christie DL, Hickman RO. Escherichia coli O157:H7 and the hemolytic uremic syndrome: importance of early cultures in establishing the etiology. J Infect Dis 1990;162:553-556. [Medline]
2. Greatorex JS, Thorne GM. Humoral immune responses to Shiga-like toxins and Escherichia coli O157 lipopolysaccharide in hemolytic-uremic syndrome patients and healthy subjects. J Clin Microbiol 1994;32:1172-1178. [Free Full Text]
3. Martin DL, MacDonald KL, White KE, Soler JT, Osterholm MT. The epidemiology and clinical aspects of the hemolytic uremic syndrome in Minnesota. N Engl J Med 1990;323:1161-1167. [Abstract]
4. Calderwood SB, Acheson DWK, Keusch GT, et al. Proposed new nomenclature for Shiga-like toxin (verotoxin) family. ASM News 1996;3:118-9.
5. Pickering LK, Obrig TG, Stapleton FB. Hemolytic-uremic syndrome and enterohemorrhagic Escherichia coli. Pediatr Infect Dis J 1994;13:459-475. [Medline]
6. Tarr PI. Escherichia coli O157:H7: clinical, diagnostic, and epidemiological aspects of human infection. Clin Infect Dis 1995;20:1-8. [Medline]
7. Bokete TN, O'Callahan CM, Clausen CR, et al. Shiga-like toxin-producing Escherichia coli in Seattle children: a prospective study. Gastroenterology 1993;105:1724-1731. [Medline]
8. Outbreak of acute gastroenteritis attributable to Escherichia coli serotype O104:H21 -- Helena, Montana, 1994. JAMA 1995;274:529-530. [CrossRef][Medline]
9. Rao SP, Sutton AL, Falter ML, Robinson MG. Chronic microangiopathic hemolytic anemia: association with Escherichia coli infections. N Y State J Med 1979;79:1763-1765. [Medline]
10. Carreras L, Romero R, Requesens C, et al. Familial hypocomplementemic hemolytic uremic syndrome with HLA-A3,B7 haplotype. JAMA 1981;245:602-604. [Abstract]
11. Loirat C, Sonsino E, Moreno AV, et al. Hemolytic-uremic syndrome: an analysis of the natural history and prognostic features. Acta Paediatr Scand 1984;73:505-514. [Medline]
12. Lavocat MP, Freycon MT, Rayet I, Teyssier G, Gilly J, Desebbe C. Syndrome hémolytique et urémique et infection urinaire fébrile à Escherichia coli. Pediatrie 1989;44:641-643. [Medline]
13. Grandsen WR, Damm MAS, Anderson JD, Carter JE, Lior H. Haemorrhagic cystitis and balanitis associated with verotoxin-producing Escherichia coli O157:H7. Lancet 1985;2:150-150. 
14. Reymond D, Bianchetti MB, Burnens A, Lior H. Haemolytic-uraemic syndrome. Lancet 1994;343:1042-1043. [CrossRef][Medline]
15. Felmlee T, Pellett S, Welch RA. Nucleotide sequence of an Escherichia coli chromosomal hemolysin. J Bacteriol 1985;163:94-105. [Free Full Text]
16. Gentry MK, Dalrymple JM. Quantitative microtiter cytotoxicity assay for Shigella toxin. J Clin Microbiol 1980;12:361-366. [Free Full Text]
17. Knutton S, Baldwin T, Williams PH, McNeish AS. Actin accumulation at sites of bacterial adhesion to tissue culture cells: basis of a new diagnostic test for enteropathogenic and enterohemorrhagic Escherichia coli. Infect Immun 1989;57:1290-1298. [Free Full Text]
18. Marklund B-I, Tennent JM, Garcia E, et al. Horizontal gene transfer of the Escherichia coli pap and prs pili operons as a mechanism for the development of tissue-specific adhesive properties. Mol Microbiol 1992;6:2225-2242. [CrossRef][Medline]
19. Stapleton A, Moseley S, Stamm WE. Urovirulence determinants in Escherichia coli isolates causing first-episode and recurrent cystitis in women. J Infect Dis 1991;163:773-779. [Medline]
20. Johnson JR, Brown JJ. A novel multiply primed polymerase chain reaction assay for identification of variant papG genes encoding the Gal(1-4)Gal-binding PapG adhesins of Escherichia coli. J Infect Dis 1996;173:920-926. [Medline]
21. Sambrook J, Fritsch EF, Maniatis T. Molecular cloning: a laboratory manual. 2nd ed. Cold Spring Harbor, N.Y.: Cold Spring Harbor Laboratory Press, 1989.
22. Newland JW, Neill RJ. DNA probes for Shiga-like toxins I and II and for toxin-converting bacteriophages. J Clin Microbiol 1988;26:1292-1297. [Free Full Text]
23. Pollard DR, Johnson WM, Lior H, Tyler SD, Rozee KR. Rapid and specific detection of verotoxin genes in Escherichia coli by the polymerase chain reaction. J Clin Microbiol 1990;28:540-545. [Erratum, J Clin Microbiol 1990;28:1491.] [Free Full Text]
24. Jerse AE, Yu J, Tall BD, Kaper JB. A genetic locus of enteropathogenic Escherichia coli necessary for the production of attaching and effacing lesions on tissue culture cells. Proc Natl Acad Sci U S A 1990;87:7839-7843. [Free Full Text]
25. Mariani-Kurkdjian P, Denamur E, Milon A, et al. Identification of a clone of Escherichia coli O103:H2 as a potential agent of hemolytic-uremic syndrome in France. J Clin Microbiol 1993;31:296-301. [Erratum, J Clin Microbiol 1994;32:860.] [Free Full Text]
26. Ostroff SM, Tarr PI, Neill MA, Lewis JH, Hargrett-Bean N, Kobayashi JM. Toxin genotypes and plasmid profiles as determinants of systemic sequelae in Escherichia coli O157:H7 infections. J Infect Dis 1989;160:994-998. [Medline]
27. Wells JG, Shipman LD, Greene KD, et al. Isolation of Escherichia coli serotype O157:H7 and other Shiga-like-toxin-producing E. coli from dairy cattle. J Clin Microbiol 1991;29:985-989. [Free Full Text]
28. Dorn CR, Francis DH, Angrick EJ, et al. Characteristics of Vero cytotoxin producing Escherichia coli associated with intestinal colonization and diarrhea in calves. Vet Microbiol 1993;36:149-159. [CrossRef][Medline]
29. Law D. Adhesion and its role in the virulence of enteropathogenic Escherichia coli. Clin Microbiol Rev 1994;7:152-173. [Free Full Text]
30. Luzzi I, Tozzi AE, Rizzoni G, et al. Detection of serum antibodies to the lipopolysaccharide of Escherichia coli O103 in patients with hemolytic-uremic syndrome. J Infect Dis 1995;171:514-515. [Medline]
31. Basta M, Karmali M, Lingwood C. Sensitive receptor-specified enzyme-linked immunosorbent assay for Escherichia coli verocytotoxin. J Clin Microbiol 1989;27:1617-1622. [Free Full Text]
32. Park CH, Gates KM, Hixon DL. Isolation of Shiga-like toxin producing Escherichia coli (O157 and non-O157) in a community hospital. In: Abstracts of the 96th American Society for Microbiology General Meeting, New Orleans, May 19–23, 1996:65. abstract.

PDF Letters Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

Related Letters:

Escherichia coli and the Hemolytic–Uremic Syndrome
Acheson D. W.K., Wolf L. E., Park C. H., Rossboth D. W., Tarr P. I., Stapleton A. E., Wilson R. A., Rondeau E., Peraldi M.-N.
Extract | Full Text  
N Engl J Med 1997; 336:515-516, Feb 13, 1997. Correspondence

This article has been cited by other articles:

• Zhang, W., Bielaszewska, M., Pulz, M., Becker, K., Friedrich, A. W., Karch, H., Kuczius, T. (2008). New Immuno-PCR Assay for Detection of Low Concentrations of Shiga Toxin 2 and Its Variants. J. Clin. Microbiol. 46: 1292-1297 [Abstract] [Full Text]  
• Baker, D. R., Moxley, R. A., Steele, M. B., LeJeune, J. T., Christopher-Hennings, J., Chen, D.-G., Hardwidge, P. R., Francis, D. H. (2007). Differences in Virulence among Escherichia coli O157:H7 Strains Isolated from Humans during Disease Outbreaks and from Healthy Cattle. Appl. Environ. Microbiol. 73: 7338-7346 [Abstract] [Full Text]  
• Vali, L., Hamouda, A., Hoyle, D. V., Pearce, M. C., Whitaker, L. H. R., Jenkins, C., Knight, H. I., Smith, A. W., Amyes, S. G. B. (2007). Antibiotic resistance and molecular epidemiology of Escherichia coli O26, O103 and O145 shed by two cohorts of Scottish beef cattle. J Antimicrob Chemother 59: 403-410 [Abstract] [Full Text]  
• Guth, B. E., Vaz, T. M., Gomes, T. A., Chinarelli, S. H, Rocha, M. M., Pestana de Castro, A. F., Irino, K. (2005). Re-emergence of O103 : H2 Shiga toxin-producing Escherichia coli infections in Sao Paulo, Brazil. J Med Microbiol 54: 805-806 [Full Text]  
• Beutin, L., Kaulfuss, S., Herold, S., Oswald, E., Schmidt, H. (2005). Genetic Analysis of Enteropathogenic and Enterohemorrhagic Escherichia coli Serogroup O103 Strains by Molecular Typing of Virulence and Housekeeping Genes and Pulsed-Field Gel Electrophoresis. J. Clin. Microbiol. 43: 1552-1563 [Abstract] [Full Text]  
• Hussein, H. S., Omaye, S. T. (2003). Introduction to the Food Safety Concerns of Verotoxin-Producing Escherichia coli. Exp. Biol. Med. 228: 331-332 [Abstract] [Full Text]  
• Bettelheim, K. A. (2003). Non-O157 Verotoxin-Producing Escherichia coli: A Problem, Paradox, and Paradigm. Exp. Biol. Med. 228: 333-344 [Abstract] [Full Text]  
• Hussein, H. S., Thran, B. H., Hall, M. R., Kvasnicka, W. G., Torell, R. C. (2003). Verotoxin-Producing Escherichia coli in Culled Beef Cows Grazing Rangeland Forages. Exp. Biol. Med. 228: 352-357 [Abstract] [Full Text]  
• COOKSON, A. L., HAYES, C. M., PEARSON, G. R., ROE, J. M., WALES, A. D., WOODWARD, M. J. (2002). Isolation from a sheep of an attaching and effacing Escherichia coli O115:H- with a novel combination of virulence factors. J Med Microbiol 51: 1041-1049 [Abstract] [Full Text]  
• Siegler, R. L., Pavia, A. T., Sherbotie, J. R. (2002). Recurrent Hemolytic Uremic Syndrome. CLIN PEDIATR 41: 705-709 [Abstract]  
• Johnson, J. R., Jerome, C., Boster, D. R., Stapleton, A. E., Tarr, P. I. (2002). Analysis of Urinary Escherichia coli Isolates for Ability To Produce Shiga Toxin. J. Clin. Microbiol. 40: 2247-2248 [Abstract] [Full Text]  
• Braunstein, J. B., Kershner, D. W., Bray, P., Gerstenblith, G., Schulman, S. P., Post, W. S., Blumenthal, R. S. (2002). Interaction of Hemostatic Genetics With Hormone Therapy : New Insights To Explain Arterial Thrombosis in Postmenopausal Women. Chest 121: 906-920 [Abstract] [Full Text]  
• Eklund, M., Scheutz, F., Siitonen, A. (2001). Clinical Isolates of Non-O157 Shiga Toxin-Producing Escherichia coli: Serotypes, Virulence Characteristics, and Molecular Profiles of Strains of the Same Serotype. J. Clin. Microbiol. 39: 2829-2834 [Abstract] [Full Text]  
• Heczko, U., Carthy, C. M., O'Brien, B. A., Finlay, B. B. (2001). Decreased Apoptosis in the Ileum and Ileal Peyer's Patches: a Feature after Infection with Rabbit Enteropathogenic Escherichia coli O103. Infect. Immun. 69: 4580-4589 [Abstract] [Full Text]  
• Unkmeir, A., Schmidt, H. (2000). Structural Analysis of Phage-Borne stx Genes and Their Flanking Sequences in Shiga Toxin-Producing Escherichia coli and Shigella dysenteriae Type 1 Strains. Infect. Immun. 68: 4856-4864 [Abstract] [Full Text]  
• Tarr, P. I., Bilge, S. S., Vary, J. C. Jr., Jelacic, S., Habeeb, R. L., Ward, T. R., Baylor, M. R., Besser, T. E. (2000). Iha: a Novel Escherichia coli O157:H7 Adherence-Conferring Molecule Encoded on a Recently Acquired Chromosomal Island of Conserved Structure. Infect. Immun. 68: 1400-1407 [Abstract] [Full Text]  
• Oswald, E., Schmidt, H., Morabito, S., Karch, H., Marches, O., Caprioli, A. (2000). Typing of Intimin Genes in Human and Animal Enterohemorrhagic and Enteropathogenic Escherichia coli: Characterization of a New Intimin Variant. Infect. Immun. 68: 64-71 [Abstract] [Full Text]  
• Karch, H., Schubert, S., Zhang, D., Zhang, W., Schmidt, H., Olschlager, T., Hacker, J. (1999). A Genomic Island, Termed High-Pathogenicity Island, Is Present in Certain Non-O157 Shiga Toxin-Producing Escherichia coli Clonal Lineages. Infect. Immun. 67: 5994-6001 [Abstract] [Full Text]  
• Hashimoto, H., Mizukoshi, K., Nishi, M., Kawakita, T., Hasui, S., Kato, Y., Ueno, Y., Takeya, R., Okuda, N., Takeda, T. (1999). Epidemic of Gastrointestinal Tract Infection Including Hemorrhagic Colitis Attributable to Shiga Toxin 1-producing Escherichia coli O118:H2 at a Junior High School in Japan. Pediatrics 103: e2-2 [Abstract] [Full Text]  
• Abe, A., Heczko, U., Hegele, R. G., Brett Finlay, B. (1998). Two Enteropathogenic Escherichia coli Type III Secreted Proteins, EspA and EspB, Are Virulence Factors. J. Exp. Med. 188: 1907-1916 [Abstract] [Full Text]  
• Nataro, J. P., Kaper, J. B. (1998). Diarrheagenic Escherichia coli. Clin. Microbiol. Rev. 11: 142-201 [Abstract] [Full Text]  
• Acheson, D. W.K., Wolf, L. E., Park, C. H., Rossboth, D. W., Tarr, P. I., Stapleton, A. E., Wilson, R. A., Rondeau, E., Peraldi, M.-N. (1997). Escherichia coli and the Hemolytic-Uremic Syndrome. NEJM 336: 515-516 [Full Text]  
• Rondeau, E., Peraldi, M.-N. (1996). Escherichia coli and the Hemolytic-Uremic Syndrome. NEJM 335: 660-662 [Full Text]