FREE NEJM E-TOC    HOME   |   SUBSCRIBE   |   CURRENT ISSUE   |   PAST ISSUES   |   COLLECTIONS   |   Search Term  Advanced Search

Sign in | Get NEJM's E-Mail Table of Contents — Free | Subscribe

Previous Volume 336:988-993 April 3, 1997 Number 14 Next

Abstract PDF Letters Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

ABSTRACT

Background Kaposi's sarcoma has features of both hyperplastic proliferation and neoplastic growth. Multiple lesions, in which spindle cells are prominent, often arise synchronously over widely dispersed areas. We tested the hypothesis that the spindle cells in these multicentric lesions originate from a single clone of precursor cells.

Methods To determine whether Kaposi's sarcoma is a monoclonal disorder, we assessed the methylation patterns of the androgen-receptor gene (HUMARA) in multiple lesions from women with the acquired immunodeficiency syndrome. In polyclonal tissues, about half the copies of each HUMARA allele are methylated, whereas in cells derived from a single clone all the copies of only one allele are methylated. To minimize contamination by normal DNA, we used microdissection to isolate areas composed primarily of spindle cells, the putative tumor cells.

Results Eight patients with a total of 32 tumors were studied. Of these tumors, 28 had highly unbalanced methylation patterns (i.e., predominant methylation of one HUMARA allele). In all the tumors that had unbalanced methylation from a given patient, the same allele predominated.

Conclusions These data indicate that Kaposi's sarcoma is a disseminated monoclonal cancer and that the changes that permit the clonal outgrowth of spindle cells occur before the disease spreads.

We assessed clonal relatedness in Kaposi's sarcoma cells from women by studying patterns of X-chromosome methylation.^9,10 At an early stage of development, one of the two X chromosomes in each cell of a female embryo is inactivated by methylation, and that methylation status is retained in subsequent somatic-cell divisions. Thus, in polyclonal tissues, approximately half the cells have a methylated X chromosome from one parent, and half have a methylated X chromosome from the other parent. By contrast, in a clone derived from a common progenitor, the same X chromosome is methylated and the other is unmethylated in every cell. This principle is applicable only to tissues from female subjects who are heterozygous for an X-linked marker gene and whose normal tissue has an approximately balanced pattern of methylation. For the marker gene, we used the X-linked androgen-receptor gene (HUMARA), which has a highly polymorphic (with a greater than 90 percent prevalence of heterozygosity) trinucleotide-repeat sequence proximal to a methylation site and is thus suitable for study by an assay of clonality based on the polymerase chain reaction (PCR).¹¹ We used a methylation-sensitive restriction endonuclease (HpaII) to digest unmethylated HUMARA sequences before PCR amplification; both alleles of the gene are amplified in randomly methylated tissue, whereas in clonal tissue one allele is absent because all its copies are unmethylated (Figure 1).

View larger version (28K): [in this window] [in a new window]   Figure 1. Clonality Assay of the HUMARA Gene. In women, each somatic cell contains two X chromosomes, one derived from the father (red) and the other derived from the mother (blue). One of the X chromosomes is inactivated by methylation (yellow halo), but the other is active and unmethylated. Normal somatic tissue (upper rows) is a mosaic of cells. In some cells the maternally derived X chromosome is methylated, and in others the paternally derived chromosome is methylated. In tumor tissue (lower rows) the same X chromosome is methylated in all cells (the maternally derived chromosome, in this example). DNA from methylated chromosomes resists digestion by methyl-sensitive restriction endonucleases such as Hpa II, which preferentially digest unmethylated DNA sequences. After Hpa II digestion, DNA from normal tissue contains a mixture of maternal and paternal X-chromosome sequences, whereas DNA from clonal tissue contains one or the other, but not both. Over 90 percent of people are heterozygous for the number of trinucleotide repeats in exon 1 of the X-linked androgen-receptor gene (HUMARA). After amplification by PCR of the region containing the repeats (delineated by red lines), the maternal and paternal HUMARA alleles can be separated by polyacrylamide-gel electrophoresis and visualized as bands on autoradiography. DNA from normal tissue, which contains a mixture of two methylated alleles, generates bands of approximately equal intensity for each (upper gel). DNA from a monoclonal population of cells generates a single band that corresponds to its one methylated allele (lower gel). In practice, tumors usually contain some polyclonal stromal cells and generate a second band, of diminished intensity.

 
Methods

Ten women with multiple nodular Kaposi's sarcoma lesions were recruited between April and June 1994 from among the patients of the Dermatovenereology Clinic of the University Teaching Hospital in Lusaka, Zambia. Human immunodeficiency virus (HIV) infection was confirmed serologically in eight women and diagnosed clinically in the other two, who declined serologic testing for HIV. Two women had received a single dose of intravenous vincristine two to five months before recruitment, and the remaining eight had not been treated for Kaposi's sarcoma. The median age of the women was 26 years (range, 20 to 35). All the women gave informed consent for their participation. The study protocol was reviewed and approved by the institutional review boards of the University Teaching Hospital and the National Cancer Institute.

Biopsy specimens were obtained from five widely separated superficial cutaneous nodular tumors in each patient, as well as from nonadjacent normal skin. The specimens were immediately snap-frozen in liquid nitrogen and kept frozen until they were sectioned. At that time, the specimens were mounted in Optimal Cutting Temperature compound (Miles, Elkhart, Ind.), and frozen sections 10 µm thick were cut on a cryostat. The sections used for microdissection were fixed on slides and stained with hematoxylin and eosin.

The number of CAG repeats in exon 1 of the HUMARA gene was determined for each allele. DNA for these assays was obtained from unstained sections of whole tissue, which were first washed with distilled water to remove the Optimal Cutting Temperature compound. The tissues were digested with proteinase K buffer, and the DNA was extracted with phenol and chloroform. Regions containing microsatellite repeats were amplified by direct PCR with Taq polymerase and one of the following primer pairs (designed from GenBank entry HUMARA01): 5'GAAGGGGAGGCGGGGTAAGGGAAGT3' and 5'CGACTGCGGCTGTGAAGGTTGCTGT3'; 5'TCCAGAATCTGTTCCAGAGCGTGCG3' and 5'GCTGTGAAGGTTGCTGTTCCTCAT3'; or 5'GCGCGAAGTGATCCAGAAC3' and 5'CCAGGACCAGGTAGCCTG3'. Allele-specific PCR fragments were separated on vertical 8 to 12 percent denaturing polyacrylamide gels, stained with ethidium bromide, purified with Geneclean (Bio 101, La Jolla, Calif.), ligated into pCRII vectors, and cloned in Escherichia coli (Invitrogen, San Diego, Calif.). Plasmid DNA was prepared and used as template to determine the number of microsatellite-repeat units in each allele by the dideoxy chain-termination method with the Sequenase kit (USB, Cleveland) or by cycle sequencing with the Femtomole kit (Promega, Madison, Wis.).

To obtain samples of tumor DNA and normal DNA, the tissue sections were subjected to microdissection with a 30-gauge needle under magnification by a power of 40, as previously described.¹² Tumor material was dissected from areas with a high proportion of spindle cells and a low proportion of lymphocytes (Figure 2A and Figure 2B). Normal tissue was obtained from areas of dermis, including glands, lymphocytes, or both, in the biopsy specimens of nonadjacent normal skin. However, in two cases adjacent normal skin was used because of the scant cellularity of the biopsy specimens of nonadjacent normal skin. The tissue scrapings were suspended in 15 to 30 µl of proteinase K buffer (0.1 mg of proteinase K per milliliter, 0.1 mol of EDTA per liter, 1 percent polysorbate 20 [Tween 20], and TRIS–hydrochloric acid [pH 8.0]). The suspensions were incubated overnight at 42°C, then inactivated by heat at 95°C for five minutes before their subsequent manipulation.

View larger version (45K): [in this window] [in a new window]   Figure 2. Representative Samples of Kaposi's Sarcoma Tissue before and after Microdissection. Panel A (x40) shows a section of a Kaposi's sarcoma nodule from Patient 2, with prominent proliferating spindle cells. Panel B (x100) shows the area within the rectangle in Panel A after a portion containing tumor (arrowheads) has been removed by microdissection. Microdissection is used to obtain a sample free of dermis and lymphocytes (arrows) that are presumed to contain normal DNA rather than tumor DNA. (Hematoxylin and eosin.)

 
Clonality was determined with an adaptation¹³ of the HUMARA methylation assay.¹¹ In brief, 10 units of the methyl-sensitive restriction endonuclease HpaII was added to 5 µl of the DNA-preparation mixture, incubated at 37°C for one to three hours, and then inactivated by heat at 95°C for five minutes. Half this solution was then added to a 10-µl reaction mixture for PCR amplification of the HUMARA gene with the primer pair 5'GCTGTGAAGGTTGCTGTTCCTCAT3' and 5'TCCAGAATCTGTTCCAGAGCGTGC3'.¹⁴ The reaction mixture contained 50 pmol of each primer, 20 nmol of each deoxynucleotide triphosphate, 0.2 µl of [-³²P]deoxycytidine triphosphate (600 Ci per millimole), 1 mM TRIS–hydrochloric acid (pH 8.3), 50 mM potassium chloride, 1.5 mM magnesium chloride, 0.01 percent gelatin (wt/vol), and 0.1 unit of Taq polymerase. Thermal cycling was carried out at 94°C for 45 seconds, 63°C for 45 seconds, and 72°C for 40 seconds, for a total of 35 cycles. The reaction products were subjected to electrophoresis on 6 percent denaturing polyacrylamide sequencing gels and visualized by autoradiography on photographic film. A 75 percent diminution in allelic intensity (relative to the intensity of the remaining allele) was arbitrarily considered to be indicative of unbalanced methylation (i.e., predominant methylation of one HUMARA allele) and — assuming that the methylation pattern of the alleles was balanced in the corresponding normal DNA — clonal derivation of tumor DNA.

Results

Two of the 10 patients were excluded from further analysis because they were homozygous for the HUMARA gene. The eight heterozygous patients had from 7 to 20 CAG trinucleotide repeats at that locus, with a minimal difference of 3 repeats (i.e., 9 base pairs) between the two alleles (Table 1). In two cases, there was scant DNA from normal dermis that could not be amplified after digestion with a restriction endonuclease. Digested normal DNA from the other six patients contained two allelic bands of approximately equal intensity. Hence, balanced methylation of normal-dermis DNA was demonstrated in six of the eight patients.

View this table: [in this window] [in a new window]   Table 1. Selected Clinical and Genotypic Characteristics of 10 Women with AIDS-Related Kaposi's Sarcoma.

 
Of the 40 tumors, 32 could be studied for clonality; in the rest, there was insufficient material for microdissection (2 tumors) or a failure of PCR amplification after endonuclease restriction (6 tumors). The six women who had balanced methylation patterns in normal dermis had a total of 27 tumors that could be evaluated. Unbalanced methylation (the predominance of one HUMARA allele) was found in 23 of these tumors (85 percent); the remaining 4 had balanced methylation (Figure 3). The two patients whose samples of normal-dermis DNA could not be amplified by PCR had a total of five tumors that could be evaluated, all of which had unbalanced methylation.

View larger version (38K): [in this window] [in a new window]   Figure 3. Assessment of the Clonality of Kaposi's Sarcoma Lesions from Patients Heterozygous for the HUMARA Allele. DNA from four or five distinct tumors (lanes 1 through 5) and normal skin (N) from each of eight patients was digested with Hpa II and amplified by PCR. The dark bands are due to the presence of methylated HUMARA alleles, with larger alleles causing the upper bands and smaller alleles the lower ones. The presence of multiple bands is attributable to the slippage of DNA polymerase during amplification. The arrowheads designate diminished or absent parental alleles owing to the unbalanced methylation pattern in clonal populations of cells. The asterisk indicates a constant band not specifically detected by the HUMARA assay; the blank lanes represent samples containing DNA that could not be amplified by PCR after digestion by a restriction endonuclease. In Patients 1 and 4, all five tumors studied showed unbalanced methylation patterns; in Patient 5, three tumors showed such patterns and DNA from the other two tumors could not be amplified. Patients 2, 3, and 6 had balanced methylation patterns in one or two tumors each, but there was unbalanced methylation in the remaining three or four tumors. For Patients 7 and 8, the samples of DNA from normal skin could not be amplified after endonuclease digestion; for these patients, the lanes denoted N represent undigested DNA. Patients 7 and 8 each had two or three samples of tumor DNA that showed unbalanced methylation, and the remaining samples from these patients could not be amplified. In each of the eight patients, all the tumors with unbalanced methylation had the same methylated allele.

 
In each patient, the same HUMARA allele was methylated in all the tumors with unbalanced methylation (Figure 3). The larger allele was preferentially methylated in three patients, and the smaller allele predominated in the other five. No patient had tumors with discordant patterns of unbalanced methylation. When the two patients were excluded in whom balanced methylation of normal DNA could not be confirmed, the remaining six patients had a total of 23 tumors with concordant methylation of one of the two alleles: two patients with 5 tumors each, one with 4, and three with 3 each. Assuming that the chances of methylation of either allele were equal, the probability of concordant patterns was 50 percent for two tumors, 25 percent for three tumors, 12.5 percent for four tumors, and 6.25 percent for five tumors. Under the hypothesis that the alleles in different tumors from the same patient were independent of each other with respect to their methylation patterns, the combined probability of the observed results was less than 0.00001 (0.0625² x 0.125 x 0.25³).

Discussion

We have demonstrated concordance among the patterns of methylation of the X-linked HUMARA alleles in different Kaposi's sarcoma tumors from a given female patient. This finding indicates that multiple Kaposi's sarcoma lesions in the same patient arise from a single clone of cells. This evidence argues that Kaposi's sarcoma is a disseminated monoclonal cancer.

The specificity of the tumor DNA we analyzed was enhanced by increasing the spindle-cell content of the samples by microdissection. Nevertheless, some tumors with balanced methylation may have contained excessive normal stromal DNA. We estimate that the tumor DNA content of a sample must be at least 80 percent for unbalanced methylation to be detected consistently by autoradiography. An additional consideration is the limited recovery of DNA after microdissection, a likely cause of the failure of PCR amplification after endonuclease restriction in several samples.

Previous tests of clonality in spindle cells from Kaposi's sarcoma lesions have yielded variable results. Immunostaining of spindle cells has been reported to be heterogeneous, which would be inconsistent with monoclonality.⁵ However, opposite findings have also been reported with this technique.⁴ Spindle cells typically have a diploid DNA content,^15,16 but some high-grade lesions appear to be aneuploid, which would indicate the clonal proliferation of abnormal cells.^17,18

Our approach assumes that multiple stem cells form the normal tissue from which spindle cells arise.¹⁹ We used unaffected dermis as a polyclonal control because this normal tissue has not been identified. But if this tissue arises from a single cell after the embryologic phase of X-chromosome inactivation, it would have an unbalanced methylation pattern and would invalidate our assay. Although we cannot rule out this possibility, our findings cannot be explained by the presence of local monoclonality in patches of such normal tissue, because we found concordant allelic methylation in widely separated tumor nodules in the same patient. Validation of our results may require that the cell of origin of spindle cells and its distribution in normal tissues be identified.

The role of human herpesvirus 8 (HHV-8) in Kaposi's sarcoma is uncertain. This virus, which is found nearly universally in Kaposi's sarcoma tissues, may be necessary for the development of the disease.²⁰ Plausibly, HHV-8 infection may transform a circulating precursor cell, which in tissues develops into spindle cells. In lymphocytes transformed by the related Epstein–Barr virus (EBV), the linear EBV genome becomes circular by joining its ends in a way that produces episomes of variable size. Clonally related cells contain episomes in one or several specific sizes, indicating that the entry and circularization of EBV precede clonal outgrowth.²¹ If intracellular HHV-8 becomes circular in a similar way, then the structure of the fused termini could be an independent indicator of clonality in Kaposi's sarcoma.

Our data imply that each lesion of Kaposi's sarcoma arises from a monoclonal population of circulating progenitor cells that home to multiple local sites and proliferate. The circulating cells are potentially related to the spindle-shaped cells that can be cultured from peripheral blood, whose concentration is increased in HIV-infected patients who have Kaposi's sarcoma or are at high risk for it.²² We do not know whether this process occurs in the endemic or transplantation-associated cases of Kaposi's sarcoma. In addition, it remains to be demonstrated whether the neoplastic clone persists over time in recurrent Kaposi's sarcoma, as has been demonstrated with regard to B-lymphocyte neoplasms.²³ These data also warrant the examination of Kaposi's sarcoma lesions for other genetic changes, such as mutations, rearrangements, amplifications, deletions, and allelic losses, to further our understanding of this enigmatic disorder.

We are indebted to George Chibwe for the recruitment of patients; to David Waters, Ph.D., and James Watson for assistance with specimens; to Miriam Anver, D.V.M., Ph.D., for histologic diagnoses; to Ana Albuquerque and Galina Kovalchuk, M.D., for performing assays; and to James J. Goedert, M.D., for helpful discussions.

Source Information

From the Viral Epidemiology Branch (C.S.R., R.J.B.), the Laboratory of Genetics (S.J., A.E.C.), and the Laboratory of Pathology (A.L., L.L., Z.Z.), National Cancer Institute, Bethesda, Md.; and the University Teaching Hospital, Lusaka, Zambia (E.M.).

Address reprint requests to Dr. Rabkin at the Viral Epidemiology Branch, National Cancer Institute, EPN/434, Bethesda, MD 20892.

References

1. Jacobson LP, Armenian HK. An integrated approach to the epidemiology of Kaposi's sarcoma. Curr Opin Oncol 1995;7:450-455. [Medline]
2. Safai B, Schwartz JJ. Kaposi's sarcoma and the acquired immunodeficiency syndrome. In: DeVita VT Jr, Hellman S, Rosenberg SA, eds. AIDS: etiology, diagnosis, treatment, and prevention. 3rd ed. Philadelphia: J.B. Lippincott, 1992:209-23.
3. Nadji M, Morales AR, Ziegles-Weissman J, Penneys NS. Kaposi's sarcoma: immunohistologic evidence for an endothelial origin. Arch Pathol Lab Med 1981;105:274-275. [Medline]
4. Kostianovsky M, Lamy Y, Greco MA. Immunohistochemical and electron microscopic profiles of cutaneous Kaposi's sarcoma and bacillary angiomatosis. Ultrastruct Pathol 1992;16:629-640. [Medline]
5. Kaaya EE, Parravicini C, Ordonez C, et al. Heterogeneity of spindle cells in Kaposi's sarcoma: comparison of cells in lesions and in culture. J Acquir Immune Defic Syndr Hum Retrovirol 1995;10:295-305. [Medline]
6. Ensoli B, Gendelman R, Markham P, et al. Synergy between basic fibroblast growth factor and HIV-1 Tat protein in induction of Kaposi's sarcoma. Nature 1994;371:674-680. [CrossRef][Medline]
7. Rabkin CS, Bedi G, Musaba E, et al. AIDS-related Kaposi's sarcoma is a clonal neoplasm. Clin Cancer Res 1995;1:257-260. [Abstract]
8. Lunardi-Iskandar Y, Gill P, Lam VH, et al. Isolation and characterization of an immortal neoplastic cell line (KS Y-1) from AIDS-associated Kaposi's sarcoma. J Natl Cancer Inst 1995;87:974-981. [Free Full Text]
9. Fialkow PJ, Klein G, Gartler SM, Clifford P. Clonal origin for individual Burkitt tumours. Lancet 1970;1:384-386. [Medline]
10. Vogelstein B, Fearon ER, Hamilton SR, Feinberg AP. Use of restriction fragment length polymorphisms to determine the clonal origin of human tumors. Science 1985;227:642-645. [Free Full Text]
11. Allen RC, Zoghbi HY, Moseley AB, Rosenblatt HM, Belmont JW. Methylation of HpaII and HhaI sites near the polymorphic CAG repeat in the human androgen-receptor gene correlates with X chromosome inactivation. Am J Hum Genet 1992;51:1229-1239. [Medline]
12. Zhuang Z, Bertheau P, Emmert-Buck MR, et al. A microdissection technique for archival DNA analysis of specific cell populations in lesions <1 mm in size. Am J Pathol 1995;146:620-625. [Abstract]
13. Zhuang Z, Vortmeyer AO, Mark EJ, et al. Barrett's esophagus: metaplastic cells with loss of heterozygosity at the APC gene locus are clonal precursors to invasive adenocarcinoma. Cancer Res 1996;56:1961-1964. [Free Full Text]
14. Willman CL, Busque L, Griffith BB, et al. Langerhans'-cell histiocytosis (histiocytosis X) -- a clonal proliferative disease. N Engl J Med 1994;331:154-160. [Free Full Text]
15. Fukunaga M, Silverberg SG. Kaposi's sarcoma in patients with acquired immune deficiency syndrome: a flow cytometric DNA analysis of 26 lesions in 21 patients. Cancer 1990;66:758-764. [Medline]
16. Kaaya EE, Parravicini C, Sundelin B, et al. Spindle cell ploidy and proliferation in endemic and epidemic African Kaposi's sarcoma. Eur J Cancer 1992;28:1890-1894. [CrossRef]
17. Saikevych IA, Mayer M, White RL, Ho RC. Cytogenetic study of Kaposi's sarcoma associated with acquired immunodeficiency syndrome. Arch Pathol Lab Med 1988;112:825-828. [Medline]
18. Dictor M, Ferno M, Baldetorp B. Flow cytometric DNA content in Kaposi's sarcoma by histologic stage: comparison with angiosarcoma. Anal Quant Cytol Histol 1991;13:201-208. [Medline]
19. Gale RE, Wheadon H, Boulos P, Linch DC. Tissue specificity ofX-chromosome inactivation patterns. Blood 1994;83:2899-2905. [Free Full Text]
20. Moore PS, Gao SJ, Dominguez G, et al. Primary characterization of a herpesvirus agent associated with Kaposi's sarcoma. J Virol 1996;70:549-558. [Abstract]
21. Raab-Traub N, Flynn K. The structure of the termini of the Epstein-Barr virus as a marker of clonal cellular proliferation. Cell 1986;47:883-889. [CrossRef][Medline]
22. Browning PJ, Sechler MG, Kaplan M, et al. Identification and culture of Kaposi's sarcoma-like spindle cells from the peripheral blood of human immunodeficiency virus-1-infected individuals and normal controls. Blood 1994;84:2711-2720. [Free Full Text]
23. Muller JR, Janz S, Goedert JJ, Potter M, Rabkin CS. Persistence of immunoglobulin heavy chain/c-myc recombination-positive lymphocyte clones in the blood of human immunodeficiency virus-infected homosexual men. Proc Natl Acad Sci U S A 1995;92:6577-6581. [Free Full Text]

Abstract PDF Letters Add to Personal Archive Add to Citation Manager Notify a Friend E-mail When Cited PubMed Citation

Related Letters:

Clonality in Kaposi's Sarcoma
Gill P., Tsai Y., Rao A. P., Jones P., Diaz-Cano S. J., Wolfe H. J., Rabkin C. S., Janz S., Zhuang Z.
Extract | Full Text  
N Engl J Med 1997; 337:570-572, Aug 21, 1997. Correspondence

This article has been cited by other articles:

• Efklidou, S., Bailey, R., Field, N., Noursadeghi, M., Collins, M. K. (2008). vFLIP from KSHV inhibits anoikis of primary endothelial cells. J. Cell Sci. 121: 450-457 [Abstract] [Full Text]  
• Duprez, R., Lacoste, V., Briere, J., Couppie, P., Frances, C., Sainte-Marie, D., Kassa-Kelembho, E., Lando, M.-J., Essame Oyono, J.-L., Nkegoum, B., Hbid, O., Mahe, A., Lebbe, C., Tortevoye, P., Huerre, M., Gessain, A. (2007). Evidence for a Multiclonal Origin of Multicentric Advanced Lesions of Kaposi Sarcoma. JNCI J Natl Cancer Inst 99: 1086-1094 [Abstract] [Full Text]  
• Gill, P. S. (2007). The Origin of Kaposi Sarcoma. JNCI J Natl Cancer Inst 99: 1063-1063 [Full Text]  
• Teo, C.G. (2006). Conceptual Emergence of Human Herpesvirus 8 (Kaposi's Sarcoma-associated Herpesvirus) as an Oral Herpesvirus. ADR 19: 85-90 [Abstract] [Full Text]  
• Langlais, C. L., Jones, J. M., Estep, R. D., Wong, S. W. (2006). Rhesus Rhadinovirus R15 Encodes a Functional Homologue of Human CD200. J. Virol. 80: 3098-3103 [Abstract] [Full Text]  
• Boccellino, M., Camussi, G., Giovane, A., Ferro, L., Calderaro, V., Balestrieri, C., Quagliuolo, L. (2005). Platelet-Activating Factor Regulates Cadherin-Catenin Adhesion System Expression and {beta}-Catenin Phosphorylation during Kaposi's Sarcoma Cell Motility. Am. J. Pathol. 166: 1515-1522 [Abstract] [Full Text]  
• Guo, H.-G., Pati, S., Sadowska, M., Charurat, M., Reitz, M. (2004). Tumorigenesis by Human Herpesvirus 8 vGPCR Is Accelerated by Human Immuodeficiency Virus Type 1 Tat. J. Virol. 78: 9336-9342 [Abstract] [Full Text]  
• Staudt, M. R., Kanan, Y., Jeong, J. H., Papin, J. F., Hines-Boykin, R., Dittmer, D. P. (2004). The Tumor Microenvironment Controls Primary Effusion Lymphoma Growth in Vivo. Cancer Res. 64: 4790-4799 [Abstract] [Full Text]  
• Buttiglieri, S., Deregibus, M. C., Bravo, S., Cassoni, P., Chiarle, R., Bussolati, B., Camussi, G. (2004). Role of Pax2 in Apoptosis Resistance and Proinvasive Phenotype of Kaposi's Sarcoma Cells. J. Biol. Chem. 279: 4136-4143 [Abstract] [Full Text]  
• Guo, H.-G., Sadowska, M., Reid, W., Tschachler, E., Hayward, G., Reitz, M. (2003). Kaposi's Sarcoma-Like Tumors in a Human Herpesvirus 8 ORF74 Transgenic Mouse. J. Virol. 77: 2631-2639 [Abstract] [Full Text]  
• van Dijk, J. P., Heuver, L. H., van der Reijden, B. A., Raymakers, R. A., de Witte, T., Jansen, J. H. (2002). A Novel, Essential Control for Clonality Analysis with Human Androgen Receptor Gene Polymerase Chain Reaction. Am. J. Pathol. 161: 807-812 [Abstract] [Full Text]  
• Deregibus, M. C., Cantaluppi, V., Doublier, S., Brizzi, M. F., Deambrosis, I., Albini, A., Camussi, G. (2002). HIV-1-Tat Protein Activates Phosphatidylinositol 3-Kinase/ AKT-dependent Survival Pathways in Kaposi's Sarcoma Cells. J. Biol. Chem. 277: 25195-25202 [Abstract] [Full Text]  
• Ablashi, D. V., Chatlynne, L. G., Whitman, J. E. Jr., Cesarman, E. (2002). Spectrum of Kaposi's Sarcoma-Associated Herpesvirus, or Human Herpesvirus 8, Diseases. Clin. Microbiol. Rev. 15: 439-464 [Abstract] [Full Text]  
• Barillari, G., Ensoli, B. (2002). Angiogenic Effects of Extracellular Human Immunodeficiency Virus Type 1 Tat Protein and Its Role in the Pathogenesis of AIDS-Associated Kaposi's Sarcoma. Clin. Microbiol. Rev. 15: 310-326 [Abstract] [Full Text]  
• Cassoni, P., Sapino, A., Deaglio, S., Bussolati, B., Volante, M., Munaron, L., Albini, A., Torrisi, A., Bussolati, G. (2002). Oxytocin Is a Growth Factor for Kaposi's Sarcoma Cells: Evidence of Endocrine-Immunological Cross-Talk. Cancer Res. 62: 2406-2413 [Abstract] [Full Text]  
• Poole, L. J., Yu, Y., Kim, P. S., Zheng, Q.-Z., Pevsner, J., Hayward, G. S. (2002). Altered Patterns of Cellular Gene Expression in Dermal Microvascular Endothelial Cells Infected with Kaposi's Sarcoma-Associated Herpesvirus. J. Virol. 76: 3395-3420 [Abstract] [Full Text]  
• Davis, D. A., Rinderknecht, A. S., Zoeteweij, J. P., Aoki, Y., Read-Connole, E. L., Tosato, G., Blauvelt, A., Yarchoan, R. (2001). Hypoxia induces lytic replication of Kaposi sarcoma-associated herpesvirus. Blood 97: 3244-3250 [Abstract] [Full Text]  
• Foster, C. B., Lehrnbecher, T., Samuels, S., Stein, S., Mol, F., Metcalf, J. A., Wyvill, K., Steinberg, S. M., Kovacs, J., Blauvelt, A., Yarchoan, R., Chanock, S. J. (2000). An IL6 promoter polymorphism is associated with a lifetime risk of development of Kaposi sarcoma in men infected with human immunodeficiency virus. Blood 96: 2562-2567 [Abstract] [Full Text]  
• Little, R. F., Wyvill, K. M., Pluda, J. M., Welles, L., Marshall, V., Figg, W. D., Newcomb, F. M., Tosato, G., Feigal, E., Steinberg, S. M., Whitby, D., Goedert, J. J., Yarchoan, R. (2000). Activity of Thalidomide in AIDS-Related Kaposi's Sarcoma. JCO 18: 2593-2602 [Abstract] [Full Text]  
• Sgadari, C., Toschi, E., Palladino, C., Barillari, G., Carlei, D., Cereseto, A., Ciccolella, C., Yarchoan, R., Monini, P., Sturzl, M., Ensoli, B. (2000). Mechanism of Paclitaxel Activity in Kaposi's Sarcoma. J. Immunol. 165: 509-517 [Abstract] [Full Text]  
• Antonescu, C. R., Elahi, A., Healey, J. H., Brennan, M. F., Lui, M. Y., Lewis, J., Jhanwar, S. C., Woodruff, J. M., Ladanyi, M. (2000). Monoclonality of Multifocal Myxoid Liposarcoma: Confirmation by Analysis of TLS-CHOP or EWS-CHOP Rearrangements. Clin. Cancer Res. 6: 2788-2793 [Abstract] [Full Text]  
• Weiss, R., Boshoff, C. (2000). Addressing Controversies Over Kaposi's Sarcoma. JNCI J Natl Cancer Inst 92: 677-679 [Full Text]  
• Judde, J.-G., Lacoste, V., Briere, J., Kassa-Kelembho, E., Clyti, E., Couppie, P., Buchrieser, C., Tulliez, M., Morvan, J., Gessain, A. (2000). Monoclonality or Oligoclonality of Human Herpesvirus 8 Terminal Repeat Sequences in Kaposi's Sarcoma and Other Diseases. JNCI J Natl Cancer Inst 92: 729-736 [Abstract] [Full Text]  
• Alexander, L., Denekamp, L., Knapp, A., Auerbach, M. R., Damania, B., Desrosiers, R. C. (2000). The Primary Sequence of Rhesus Monkey Rhadinovirus Isolate 26-95: Sequence Similarities to Kaposi's Sarcoma-Associated Herpesvirus and Rhesus Monkey Rhadinovirus Isolate 17577. J. Virol. 74: 3388-3398 [Abstract] [Full Text]  
• Aboulafia, D. M. (2000). The Epidemiologic, Pathologic, and Clinical Features of AIDS-Associated Pulmonary Kaposi’s Sarcoma. Chest 117: 1128-1145 [Abstract] [Full Text]  
• nbecher, T. L., Foster, C. B., Zhu, S., Venzon, D., Steinberg, S. M., Wyvill, K., Metcalf, J. A., Cohen, S. S., Kovacs, J., Yarchoan, R., Blauvelt, A., Chanock, S. J. (2000). Variant genotypes of Fcgamma RIIIA influence the development of Kaposi's sarcoma in HIV-infected men. Blood 95: 2386-2390 [Abstract] [Full Text]  
• Biancone, L., Cantaluppi, V., Boccellino, M., Bussolati, B., Del Sorbo, L., Conaldi, P. G., Albini, A., Toniolo, A., Camussi, G. (1999). Motility Induced by Human Immunodeficiency Virus-1 Tat on Kaposi’s Sarcoma Cells Requires Platelet-Activating Factor Synthesis. Am. J. Pathol. 155: 1731-1739 [Abstract] [Full Text]  
• Reitz, M. S. Jr., Nerurkar, L. S., Gallo, R. C. (1999). Perspective on Kaposi's Sarcoma: Facts, Concepts, and Conjectures. JNCI J Natl Cancer Inst 91: 1453-1458 [Full Text]  
• Dupin, N., Fisher, C., Kellam, P., Ariad, S., Tulliez, M., Franck, N., van Marck, E., Salmon, D., Gorin, I., Escande, J.-P., Weiss, R. A., Alitalo, K., Boshoff, C. (1999). Distribution of human herpesvirus-8 latently infected cells in Kaposi's sarcoma, multicentric Castleman's disease, and primary effusion lymphoma. Proc. Natl. Acad. Sci. USA 96: 4546-4551 [Abstract] [Full Text]  
• Searles, R. P., Bergquam, E. P., Axthelm, M. K., Wong, S. W. (1999). Sequence and Genomic Analysis of a Rhesus Macaque Rhadinovirus with Similarity to Kaposi's Sarcoma-Associated Herpesvirus/Human Herpesvirus 8. J. Virol. 73: 3040-3053 [Abstract] [Full Text]  
• Friborg, J. Jr., Kong, W.-P., Flowers, C. C., Flowers, S. L., Sun, Y., Foreman, K. E., Nickoloff, B. J., Nabel, G. J. (1998). Distinct Biology of Kaposi's Sarcoma-Associated Herpesvirus from Primary Lesions and Body Cavity Lymphomas. J. Virol. 72: 10073-10082 [Abstract] [Full Text]  
• TUDER, R. M., RADISAVLJEVIC, Z., SHROYER, K. R., POLAK, J. M., VOELKEL, N. F. (1998). Monoclonal Endothelial Cells in Appetite Suppressant-associated Pulmonary Hypertension. Am. J. Respir. Crit. Care Med. 158: 1999-2001 [Abstract] [Full Text]  
• Gill, P. S., Tsai, Y. C., Rao, A. P., Spruck, C. H. III, Zheng, T., Harrington, W. A. Jr., Cheung, T., Nathwani, B., Jones, P. A. (1998). Evidence for multiclonality in multicentric Kaposi's sarcoma. Proc. Natl. Acad. Sci. USA 95: 8257-8261 [Abstract] [Full Text]  
• Ganju, R. K., Munshi, N., Nair, B. C., Liu, Z.-Y., Gill, P., Groopman, J. E. (1998). Human Immunodeficiency Virus Tat Modulates the Flk-1/KDR Receptor, Mitogen-Activated Protein Kinases, and Components of Focal Adhesion in Kaposi's Sarcoma Cells. J. Virol. 72: 6131-6137 [Abstract] [Full Text]  
• Gallo, R. C. (1998). Some Aspects of the Pathogenesis of HIV-1-Associated Kaposi's Sarcoma. J Natl Cancer Inst Monogr 1998: 55-57 [Abstract] [Full Text]  
• Moore, P. S., Chang, Y. (1998). Kaposi's Sarcoma-Associated Herpesvirus-Encoded Oncogenes and Oncogenesis. J Natl Cancer Inst Monogr 1998: 65-71 [Abstract] [Full Text]  
• Gill, P., Tsai, Y., Rao, A. P., Jones, P., Diaz-Cano, S. J., Wolfe, H. J., Rabkin, C. S., Janz, S., Zhuang, Z. (1997). Clonality in Kaposi's Sarcoma. NEJM 337: 570-572 [Full Text]